Abstract
The first confirmed case of Rickettsia parkeri infection in Uruguay is reported. To date, in South America, molecularly confirmed cases of human infection have been found in Argentina and probably, Brazil. Our patient returned to Spain after a 7-day trip to Colonia Suiza (Southwestern Uruguay). He presented fever (39°C), chills, and two eschars (tache noire-like) surrounded by an indurated, erythematous halo on the inner side of the left ankle besides a maculopapular rash on the legs. After treatment with doxycycline for 7 days, he fully recovered. R. parkeri infection was diagnosed by molecular-based detection of the microorganism in a swab specimen of the eschar. Diagnosis was supported by seroconversion between acute- and convalescent-phase sera specimens.
Until recently, Rocky Mountain spotted fever (RMSF) or Rickettsia rickettsii infection was the unique tick-borne rickettsiosis known in the New World. However, during last decades, new Rickettsia species have been identified as human tick-borne pathogens, which is the case of R. parkeri. Human cases caused by this microorganism and confirmed using molecular assays have been mainly described in North America,1–5 and retrospective analyses have shown that some cases of RMSF could be now attributed to R. parkeri.6 In South America, two molecularly confirmed cases of human infection with R. parkeri have been reported in Argentina, and recent molecular results strongly suggest that this infection is also distributed in Brazil.7–9 Herein, we report a confirmed case of R. parkeri human disease in a patient who returned to Spain after acquiring the infection in Uruguay.
A 54-year-old man returned to Spain on December 16, 2012 after a 7-day trip to Uruguay. He did not notice any arthropod bites. A risk factor for being bitten by ticks is walking in grassy areas, and our patient had been walking barefoot along a grassy area in Colonia Suiza (southwestern Uruguay). Two days after arrival in Spain, he noticed two crusted lesions on the inner side of the left ankle. The next day, he presented with malaise, fever, and chills. He was treated with amoxicillin-clavulanic acid and mupirocin cream for 4 days by a primary care physician, but his symptoms persisted. On December 25, he was admitted to the Hospital San Pedro in La Rioja (Spain) with the presumptive diagnosis of cellulitis after probable arthropod bite. Examination showed fever (39°C) and two eschars (tache noire-like) surrounded by an indurated, erythematous halo on the inner side of the left ankle (Figure 1). A petechial rash was also observed on legs. Rickettsiosis was suspected, and DNA was extracted from ethylenediaminetetraacetic acid disodium salt-treated blood and cutaneous swab specimens from the eschar using the DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany) and tested for the presence of Rickettsia spp. using polymerase chain reaction (PCR) assays for gltA and ompA genes (Table 1).10,11 In addition, acute and convalescent sera specimens (collected 2 weeks after the onset of the illness) were tested by immunofluorescence assays (IFAs) using R. conorii (VIRCELL S.L., Granada, Spain) and R. rickettsii (FOCUS Diagnostics, Cypress, CA) as antigens. Fragments of gltA and ompA rickettsial genes were amplified from the swab sample. Partial gltA (285/285 bp) and ompA (535/536 bp) sequences showed 100% and 99.8% identity to the corresponding sequences of R. parkeri. Diagnostic antibodies against spotted fever group rickettsiae were not detected in the acute serum specimen, but the convalescent specimen was positive for immunoglobulin G (IgG) at a titer of 4,096 with both antigens. Doxycycline (100 mg/12 hours) was administered for 7 days, and the patient fully recovered (fever disappeared in the first 24 hours after initiation of doxycycline therapy).
Figure 1.
Crusted lesions on the inner side of the left ankle.
Table 1.
Primers used for amplification of partial rickettsial genes
| Primer name | Primer sequence (5′ → 3′) | Amplified fragment (bp) | Annealing temperature (°C) | Ref. |
|---|---|---|---|---|
| ompA | ||||
| Rr190.70p | ATGGCGAATATTTCTCCAAAA | 631 | 46 | 10 |
| Rr190.701n | GTTCCGTTAATGGCAGCATCT | |||
| Rr190.70p | ATGGCGAATATTTCTCCAAAA | 532 | 48 | 10 |
| Rr190.602n | AGTGCAGCATTCGCTCCCCCT | |||
| gltA | ||||
| RpCS.877p | GGGGGCCTGCTCACGGCGG | 381 | 48 | 10 |
| RpCS.1,258n | ATTGCAAAAAGTACAGTGAACA | |||
| RpCS.896p | GGCTAATGAAGCAGTGATAA | 337 | 56 | 11 |
| RpCS.1,233n | GCGACGGTATACCCATAGC | |||
Previously considered non-pathogenic in humans, R. parkeri was first described in Amblyomma maculatum ticks.12 In 2004, Paddock and others1 described the first human cases associated with this bacterium in the United States. At the same time, this Rickettsia species was also suspected to be the responsible agent for the tick-borne spotted fevers in Uruguay, because it was amplified from one A. triste tick attached to a patient who developed a rickettsial syndrome.13 Regarding clinical features, it seems that R. parkeri causes a spotted fever syndrome that is less severe than RMSF. Also, it can be differentiated from RMSF by the presence of an eschar at the site of the tick attachment.3 In South America, rickettsial illness caused by R. parkeri has been described in Uruguay, Argentina, and probably, Brazil.14 Cases from Argentina have been confirmed with molecular tools,7 whereas rickettsial taxonomy related to Brazilian cases remains unclear.8,9 All confirmed and probable cases referred to tick bites. Most presented an eschar at the tick bite site besides a maculopapular rash that was accompanied by fever, myalgias, or headache. As we observed in our patient, the clinical course was benign in all published cases, with clinical resolution after doxycycline prescription.7 Recently, two cases of spotted fever group rickettsiosis caused by a non-cultured Rickettsia closely related to R. parkeri as well as R. africae and R. sibirica have been reported in Brazil.8,9 To date, whether these taxonomic names may be considered a single species is discussed.15
R. parkeri is a common microorganism found in ticks from South American countries.13,16–19 In Uruguay, R. parkeri is present in a relatively high percentage of A. triste ticks.20 A. triste is present in at least 12 other Latin American countries, and it is probable that this infection is widely distributed in most of the continent.21,22 Higher R. parkeri infection rates among tick populations, compared with R. rickettsii, suggest that R. parkeri rickettsiosis is likely to be misdiagnosed.23 In conclusion, we must consider the possibility of rickettsiosis in people returning from South America.
ACKNOWLEDGMENTS
The American Committee on Clinical Tropical Medicine and Travelers' Health (ACCTMTH) assisted with publication expenses.
Footnotes
Authors' addresses: Aránzazu Portillo, Concepción García-García, M. Mercedes Sanz, Sonia Santibáñez, and José A. Oteo, Departamento de Enfermedades Infecciosas, Hospital San Pedro-CIBIR, Logroño, La Rioja, Spain, E-mails: aportillo@riojasalud.es, cgarciag@riojasalud.es, mmsanz@riojasalud.es, ssantibanez@riojasalud.es, and jaoteo@riojasalud.es. José M. Venzal, Departamento de Parasitología Veterinaria, Universidad de La República, Salto, Uruguay, E-mail: dpvuru@hotmail.com.
References
- 1.Paddock CD, Sumner JW, Comer JA, Zaki SR, Goldsmith CS, Goddard J, McLellan SL, Tamminga CL, Ohl CA. Rickettsia parkeri: a newly recognized cause of spotted fever rickettsiosis in the United States. Clin Infect Dis. 2004;38:805–811. doi: 10.1086/381894. [DOI] [PubMed] [Google Scholar]
- 2.Whitman TJ, Richards AL, Paddock CD, Tamminga CL, Sniezek PJ, Jiang J. Rickettsia parkeri infection after tick bite, Virginia. Emerg Infect Dis. 2007;13:334–336. doi: 10.3201/eid1302.061295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Paddock CD, Finley RW, Wright CS, Robinson HN, Schrodt BJ, Lane CC, Ekenna O, Blass MA, Tamminga CL, Ohl CA, McLellan SL, Goddard J, Holman RC, Openshaw JJ, Sumner JW, Zaki SR, Eremeeva ME. Rickettsia parkeri rickettsiosis and its clinical distinction from Rocky Mountain spotted fever. Clin Infect Dis. 2008;47:1188–1196. doi: 10.1086/592254. [DOI] [PubMed] [Google Scholar]
- 4.Cragun WC, Bartlett BL, Ellis MW, Hoover AZ, Tyring SK, Mendoza N, Vento TJ, Nicholson WL, Eremeeva ME, Olano JP, Rapini RP, Paddock CD. The expanding spectrum of eschar-associated rickettsioses in the United States. Arch Dermatol. 2010;146:641–648. doi: 10.1001/archdermatol.2010.48. [DOI] [PubMed] [Google Scholar]
- 5.Myers T, Lalani T, Dent M, Jiang J, Daly PL, Maguire JD, Richards AL. Detecting Rickettsia parkeri infection from eschar swab specimens. Emerg Infect Dis. 2013;19:778–780. doi: 10.3201/eid1905.120622. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Raoult D, Paddock CD. Rickettsia parkeri infection and other spotted fevers in the United States. N Engl J Med. 2005;353:626–627. doi: 10.1056/NEJM200508113530617. [DOI] [PubMed] [Google Scholar]
- 7.Romer Y, Seijo AC, Crudo F, Nicholson WL, Varela-Stokes A, Lash RR, Paddock CD. Rickettsia parkeri rickettsiosis, Argentina. Emerg Infect Dis. 2011;17:1169–1173. doi: 10.3201/eid1707.101857. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Spolidorio MG, Labruna MB, Mantovani E, Brandao PE, Richtzenhain LJ, Yoshinari NH. Novel spotted fever group rickettsiosis, Brazil. Emerg Infect Dis. 2010;16:521–523. doi: 10.3201/eid1603.091338. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Silva N, Eremeeva ME, Rozental T, Ribeiro GS, Paddock CD, Ramos EAG, Favacho ARM, Reis MG, Dasch GA, de Lemos ERS, Ko AI. Eschar-associated spotted fever rickettsiosis, Bahia, Brazil. Emerg Infect Dis. 2011;17:275–278. doi: 10.3201/eid1702.100859. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Regnery RL, Spruill CL, Plikaytis BD. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J Bacteriol. 1991;173:1576–1589. doi: 10.1128/jb.173.5.1576-1589.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Choi YJ, Jang WJ, Ryu JS, Lee SH, Park KH, Paik HS, Koh YS, Choi MS, Kim IS. Spotted fever group and typhus group rickettsioses in humans, South Korea. Emerg Infect Dis. 2005;11:237–244. doi: 10.3201/eid1102.040603. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Parker RR, Kohls GM, Cox GW, Davis GE. Observations on an infectious agent from Amblyomma maculatum. Public Health Rep. 1939;54:1482–1484. [Google Scholar]
- 13.Venzal JM, Portillo A, Estrada-Peña A, Castro O, Cabrera PA, Oteo JA. Rickettsia parkeri in Amblyomma triste from Uruguay. Emerg Infect Dis. 2004;10:1493–1495. doi: 10.3201/eid1008.030999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Labruna MB, Mattar S, Nava S, Bermudez S, Venzal JM, Dolz G, Abarca K, Romero L, de Sousa R, Oteo J, Zavala-Castro J. Rickettsioses in Latin America, Caribbean, Spain and Portugal. Rev MVZ Córdoba. 2011;16:2435–2457. [Google Scholar]
- 15.Walker DH, Ismail N. Emerging and re-emerging rickettsioses: endothelial cell infection and early disease events. Nat Rev Microbiol. 2008;6:375–386. doi: 10.1038/nrmicro1866. [DOI] [PubMed] [Google Scholar]
- 16.Silveira I, Pacheco RC, Szabó MP, Ramos HG, Labruna MB. Rickettsia parkeri in Brazil. Emerg Infect Dis. 2007;13:1111–1113. doi: 10.3201/eid1307.061397. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Nava S, Elshewany Y, Eremeeva ME, Sumner JW, Mastropaolo M, Paddock CD. Rickettsia parkeri in Argentina. Emerg Infect Dis. 2008;14:1894–1897. doi: 10.3201/eid1412.080860. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Tomassone L, Conte V, Parrilla G, De Meneghi D. Rickettsia infection in dogs and Rickettsia parkeri in Amblyomma tigrinum ticks, Cochabamba Department, Bolivia. Vector Borne Zoonotic Dis. 2010;10:953–958. doi: 10.1089/vbz.2009.0126. [DOI] [PubMed] [Google Scholar]
- 19.Flores-Mendoza C, Florin D, Felices V, Pozo EJ, Graf PC, Burrus RG, Richards AL. Detection of Rickettsia parkeri from within Piura, Peru, and the first reported presence of Candidatus Rickettsia andeanae in the tick Rhipicephalus sanguineus. Vector Borne Zoonotic Dis. 2013;13:505–508. doi: 10.1089/vbz.2012.1028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Venzal JM, Estrada-Peña A, Portillo A, Mangold AJ, Castro O, De Souza CG, Félix ML, Pérez-Martínez L, Santibánez S, Oteo JA. Rickettsia parkeri: a rickettsial pathogen transmitted by ticks in endemic areas for spotted fever rickettsiosis in southern Uruguay. Rev Inst Med Trop Sao Paulo. 2012;54:131–134. doi: 10.1590/s0036-46652012000300003. [DOI] [PubMed] [Google Scholar]
- 21.Guglielmone AA, Estrada-Peña A, Keirans JE, Robbins RG. International Consortium on Ticks and Tick-Borne Diseases: Atalanta, Houten; 2003. Ticks (Acari: Ixodida) of the neotropical zoogeographic region. The Netherlands, 173 pp. [Google Scholar]
- 22.Pacheco RC, Venzal JM, Richtzenhain LJ, Labruna MB. Rickettsia parkeri in Uruguay. Emerg Infect Dis. 2006;12:1804–1805. doi: 10.3201/eid1211.060577. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Labruna MB. Ecology of Rickettsia in South America. Ann N Y Acad Sci. 2009;1166:156–166. doi: 10.1111/j.1749-6632.2009.04516.x. [DOI] [PubMed] [Google Scholar]