Changes in the expression of four heat shock proteins during the aging process in Brachionus calyciflorus (rotifera)

Abstract

Heat shock proteins (HSPs) are molecular chaperones and have an important role in the refolding and degradation of misfolded proteins, and these functions are related to aging. Rotifer is a useful model organism in aging research, owing to small body size (0.1–1 mm), short lifespan (6–14 days), and senescence phenotypes that can be measured relatively easily. Therefore, we used rotifer as a model to determine the role of four typical hsp genes on the aging process in order to provide a better understanding of rotifer aging. We cloned cDNA encoding hsp genes (hsp40, hsp60, hsp70, and hsp90) from the rotifer Brachionus calyciflorus Pallas, analyzed their molecular characteristics, determined its modulatory response under different temperatures and H₂O₂ concentrations and investigated the changes in expression of these genes during the aging process. We found that Bchsp70 mRNA expression significantly decreased with aging. In addition, we also studied the effects of dietary restriction (DR) and vitamin E on rotifer lifespan and reproduction and analyzed the changes in expression of these four Bchsp genes in rotifers treated with DR and vitamin E. The results showed that DR extended the lifespan of rotifers and reduced their fecundity, whereas vitamin E had no significant effect on rotifer lifespan or reproduction. Real-time PCR indicated that DR increased the expression of these four Bchsps. However, vitamin E only improved the expression of Bchsp60, and reduced the expression of Bchsp40, Bchsp70, and Bchsp90. DR pretreatment also increased rotifer survival rate under paraquat-induced oxidative stress. These results indicated that hsp genes had an important role in the anti-aging process.

Introduction

Heat shock proteins (HSPs) are a highly conserved, ubiquitously expressed family of stress-response proteins (Hartl 1996) and are classified into six subfamilies according to their molecular weight, such as small HSPs (16–30 kDa), HSP40, HSP60, HSP70, HSP90, and the large HSP110 (Becker and CRAIG 1994; Kalmar and Greensmith 2009). HSPs can act as molecular chaperones facilitating protein folding, preventing protein aggregation, and targeting improperly folded proteins to specific degradation pathways (Kalmar and Greensmith 2009), and most of these functions are related to aging. Reactive oxygen species (ROS), such as hydrogen peroxide (H₂O₂) and superoxide anion (O₂⁻), which are mainly by-products of aerobic respiration, can damage many cell macromolecules, including lipids, nucleic acids, and proteins (Finkel and Holbrook 2000; Kalmar and Greensmith 2009). The proteins damaged by ROS can easily lose their native folded conformation to become misfolded leading to functional abnormalities (Kalmar and Greensmith 2009). Some HSPs facilitate the refolding of damaged proteins and improve their impaired functions (Heikkila 2010). If the damaged proteins cannot recover, some HSPs, mainly members of the HSP70 family and its co-chaperones, play a crucial role in protein sorting and quality control by selecting and directing aberrant proteins to proteasomes or lysosomes for degradation (Mayer and Bukau 2005). Thus, HSPs regulate the quality of proteins and have an important role in the aging process. Indeed, hsp70 induced by moderate, nonlethal heat treatment is a candidate protein for longevity in the yeast Saccharomyces cerevisiae (Shama et al. 1998). More directly, the life expectancy of hsp70 transgenic Drosophila melanogaster increased by 30 % compared with the wild type when its gene expression was induced by heat treatment (Tatar et al. 1997). However, changes in hsps gene expression in rotifer aging process is very rarely reported. The rotifer, Brachionus calyciflorus, has a short lifespan (5–7 days), and it is easy to detect the changes in gene expression during the aging process. Therefore, we analyzed the changes in hsps gene expression in B. calyciflorus at different ages to explore the role of hsps genes in aging.

Dietary restriction (DR) is usually defined as a moderate (normally 20–40 %) reduction in available nutrients without causing malnutrition. It was first noted in the 1930s that food restriction significantly extended the lifespan of rodents (McCay et al. 1935). In the laboratory, DR is one of the most common lifespan-extending methods in evolutionarily distinct eukaryotes from single cell to multi-cellular organisms (Fanestil and Barrows 1965; Klass 1977; Lin et al. 2002; Lints 1985; Walker et al. 2005). It was reported by Kaneko et al. that the mRNA levels of hsp70 and glucose-regulated protein 94 (GRP94) were significantly higher in the exponential growth phase than in the stationary phase (Kaneko et al. 2002) and that rotifers in the stationary phase lived longer than those in the exponential phase (Yoshinaga et al. 2000). Nutritional deprivation also potentiates HSP60 protein induction (Wheelock et al. 2002). Therefore, we also analyzed the effects of DR on the expression of hsps genes to explore the reasons why DR extends life.

Vitamin E is an antioxidant and acts as a H₂O₂ radical scavenger, preventing the propagation of ROS in tissues and can affect lifespan (Traber and Stevens 2011). Previous studies have shown that vitamin E extended the lifespan of several types of rotifers (Litton 1987; Sawada and Enesco 1984; Snell et al. 2012). Thus, we hypothesized that the antioxidant effects produced by vitamin E may affect the expression of hsp genes.

The aims of this study were to: (1) clone the hsp40, hsp60, hsp70, and hsp90 cDNAs in the freshwater rotifer B. calyciflorus; (2) detect the expression of these four hsps under temperature stress and oxidative stress (produced by H₂O₂) conditions; (3) examine the mRNA expression levels of these four hsps during the aging process using highly sensitive quantitative real-time PCR; (4) investigate the effect of DR and vitamin E on the expression of the four hsps. These studies were undertaken to provide a better understanding of the role of hsps in rotifer aging.

Materials and methods

Rotifers

The animals used during the study, B. calyciflorus, were female neonates (0–2 h old) hatched from resting eggs in artificial freshwater medium (EPA medium, pH ∼7.8) composed of 96 mg NaHCO₃, 60 mg CaSO₄ · H₂0, 123 mg MgSO₄, and 4 mg KCl in 1 L deionized water at 25 °C (ASTM 2001). This species was originally collected in Gainesville, Florida in 1983 (Snell et al. 1991) and since then, has been cultured in the laboratory continuously with periodic collection and storage of resting eggs. The females were fed by suspending the green alga Chlorella pyrenoidosa (Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, China) in the culture media at ∼3 × 10⁶ cells/mL. The feeding alga was cultured in Bold’s basal medium at 25 °C in 3-L flasks under constant fluorescent illumination at 2,000 lux.

Bchsps cloning

To clone the hsps from B. calyciflorus Pallas, the degenerate primers were designed with reference to DNA nucleotide sequences of the hsps gene reported for the rotifer Brachionus plicatilis, Brachionus ibericus, Brachionus manjavacas, the yeast S. cerevisiae, the nematode Caenorhabditis elegans, and humans.

The extraction of total RNAs from rotifer was conducted using the Trizol (Invitrogen, China) technique following the manufacturer's instructions. The total RNA concentration was determined by measuring the absorbance at OD₂₆₀. RNA integrity was checked by electrophoresis. The total RNA was reverse transcribed into cDNA using the aM-MLV RTase cDNA Synthesis Kit (TaKaRa, Japan).

Polymerase chain reaction (PCR) was conducted for 3 min at 94 °C followed by 35 cycles at 94 °C for 10 s, 48 °C for 40 s, and 72 °C for 30 s. The final extension step was performed at 72 °C for 10 min. Each of the 20 μL reaction mixtures contained 1.5 mM of MgCl₂, 0.2 mM of dNTP, 0.2 mM of each of the primers, 1 U of Taq DNA polymerase (TaKaRa, Japan), and 5 ng of cDNA. Amplicons of expected sizes were purified using an Agarose Gel DNA Purification Kit (TaKaRa, Japan), and then subcloned into the pMD-19T cloning vector (TaKaRa, Japan). Positive clones containing inserts of an expected size were sequenced using M13 primers and sequenced at BGI (Shanghai, China). The Bchsps partial cDNA sequence was extended using the 5′ and 3′ rapid amplification of cDNA ends (RACE; SMART™ cDNA Kit) technique following the manufacturer's instructions. A total of five gene-specific primers were designed based on the Bchsps partial cDNA sequence.

Bchsp40, Bchsp60, Bchsp70, and Bchsp90 were cloned respectively via the procedure described above. The degenerate primers for PCR and the specific primers for RACE are shown in Table 1.

Table 1.

Degenerate and specific primers used in the experiment

Primers	Sequence (5′–3′)	Application
Hsp40F	TCTAGTNTGCCAGGTGAGAT	Hsp40 amplification
Hsp40R	TTCTNTCATAAGCTGGATCC	Hsp40 amplification
Hsp40-5′1	CACCCTTTCCACTACA	Hsp40 RACE
Hsp40-5′2	CACCACCACCGCCGAAGA	Hsp40 RACE
Hsp40-5′3	GAAAATATCCATTGGTGAACT	Hsp40 RACE
Hsp40-3′1	TCACCAGGTCTAGAACCA	Hsp40 RACE
Hsp40-3′2	TGAGGGTATGCCAATG	Hsp40 RACE
Hsp60F	TTYGAYCGHGGMTAYATYTCNCC	Hsp60 amplification
Hsp60R	TCHACYTCRCTKGADCCRCCDAC	Hsp60 amplification
Hsp60-5′1	TTACGTTGAGCATTGG	Hsp60 RACE
Hsp60-5′2	TGGCTAATTCTAAAGCTGGT	Hsp60 RACE
Hsp60-5′3	CTCTGAGATTAAGACAAAAGC	Hsp60 RACE
Hsp60-3′1	GGAGCTACTGTATTCGGCGATGAAGCT	Hsp60 RACE
Hsp60-3′2	GGTGTAGCCGTTTTGAAAGTCGGTGGTT	Hsp60 RACE
Hsp70F	GTCGANCCGCCNACCANNACAAT	Hsp70 amplification
Hsp70R	TGGGNGGNGGNACNTTYGACGT	Hsp70 amplification
Hsp70-5′1	TTCTGATGTCTTTACCA	Hsp70 RACE
Hsp70-5′2	TGTTGTCAAAATCTTCACCACC	Hsp70 RACE
Hsp70-5′3	CACCATTTGTGGCTACTACTTCA	Hsp70 RACE
Hsp70-3′1	ATTTGGGTGGTGAAGATTTTGACAACAGAG	Hsp70 RACE
Hsp70-3′2	AAACCAGTTCAAAAGGTCTTGGAAGATGCT	Hsp70 RACE
Hsp70-3′3	TCCACCAGCCCCAAGAGGTGTACCAC	Hsp70 RACE
Hsp70-3′4	CCGCTGAAGACAAAGGTACTGGTAACAAA	Hsp70 RACE
Hsp90F	TTKGTNGARTCYTCRTGDATNGC	Hsp90 amplification
Hsp90R	TCHGGMACBAARGCNTTYATGGA	Hsp90 amplification
Hsp90-5′1	CAACCGTATTGTGAAG	Hsp90 RACE
Hsp90-5′2	CCAAACGAGTTGAAACAGTGAC	Hsp90 RACE
Hsp90-5′3	CGTATTTTTCAGCATCGGATTC	Hsp90 RACE
Hsp90-3′1	GTCACTGTTTCAACTCGTTTGGTCTCATC	Hsp90 RACE
Hsp90-3′2	CACAATACGGTTGGTCCGCCAATATGG	Hsp90 RACE
Hsp40RTF	AATGGATATTTTCGAGATG	Real-time PCR
Hsp40RTR	TGCCTTGACAAGTTTTAC	Real-time PCR
Hsp60RTF	CTACTGTATTCGGCGATGAA	Real-time PCR
Hsp60RTR	CGGCTACACCATTACTCAAT	Real-time PCR
Hsp70RTF	GCCACAAATGGTGATACTCAT	Real-time PCR
Hsp70RTR	TGGAAGATGCTGGTTTGA	Real-time PCR
Hsp90RTF	CTGCTTACTTAGTCGCTGAT	Real-time PCR
Hsp90RTR	CTTCTTCTTCTTGTCCTTATCG	Real-time PCR
β-actinRTF	GAAATTGTGCGCGACATCAAGGA	Real-time PCR
β-actinRTR	GCAATGCCCGGGTACATGGTGGT	Real-time PCR

Sequence analysis of Bchsps

Nucleotide and deduced amino acid sequences of hsps cDNA were analyzed using the software Vector NTI Advance 11. HSPs sequences from different organisms were obtained using the NCBI BLAST search program. The cDNA sequence and deduced amino acid sequence from B. calyciflorus were analyzed using the BLAST algorithm (http://www.ncbi.nlm.nih.gov/blast). Translation and protein analyses were performed using ExPASy tools (http://us.expasy.org/tools/). A multiple sequence alignment was created with ClustalW (http://www.ebi.ac.uk/clustalw/). The calculated molecular mass and the theoretical isoelectric point were predicted using the Protein Mol Wt and AA Composition Calculator (http://www.proteomics.com.cn/proteomics/pi_tool.asp). An unrooted phylogenetic tree based on the amino acid sequence alignment was constructed using the Bayesian method. A total of 39 sequences were retrieved from the GenBank databases. Multiple sequence alignment results were first converted to Nexus format and analyzed using MrBayes v3.1.2 for Windows (Huelsenbeck and Ronquist 2001). Four parallel Monte Carlo Markov chains were run for 100,000 generations to approximate the posterior probabilities, and trees were sampled every 100 generations (Rhee et al. 2011). The analysis results were visualized using the Fig Tree v1.3.1 software.

Experimental design

The effects of temperature, vitamin E and H₂O₂ on hsps expression

Experiments were conducted to test the effects of temperature, H₂O₂, and vitamin E on the expression of hsps in B. calyciflorus. In the temperature test, 100 rotifers were cultured in 50 mL EPA medium at 15, 25 (control), 30, and 37 °C for 0, 0.5, 1, 2, 3, and 6 h, respectively. The rotifers were then collected and total RNA was extracted. Three replicates were prepared for each treatment. In the H₂O₂ test, 100 rotifers were placed into 50 mL H₂O₂ (H₂O₂ concentration was 0.1 and 0.2 mM) medium and cultured for 0, 1, 2, 4, 6, and 12 h, respectively. The rotifers were then collected and total RNA was extracted. Three replicates were prepared for each treatment. In the vitamin E test (vitamin E concentration was 40 μM), rotifers were treated using the same procedure as in the H₂O₂ test described above. Vitamin E was obtained from the Sigma Chemical Company (St. Louis, MO), dissolved in DMSO and stored at −20 °C.

Age-related changes in hsps gene expression

In total, 600 neonates (0–2 h old) were collected and divided into six groups of 100 individuals, which were then cultured in 50 mL of prepared media and maintained at 25 °C for 0.5, 1, 2, 3, 4, and 5 days. Three replicates were prepared for each treatment. Rotifers were transferred into new medium every 24 h and checked every 12 h to record the number of neonates, and the neonates were removed each day. Any surviving rotifers were then collected after 0.5, 1, 2, 3, 4, and 5 days. The total RNA was then extracted and reverse transcribed into cDNA. Real-time PCR (RT-PCR) was carried out to measure the mRNA expression levels of hsps at the different time points described above. The real-time PCR method was as described below.

The effects of DR on lifespan and reproduction

Six rotifers (0–2 h old) were transferred into 12-well culture plates, which contained 3 mL culture media under different feeding regimes (AL, DR12, DR24, and DR36). In the AL group, rotifers were transferred to a newly prepared culture medium containing microalgae every 12 h. In the DR group, rotifers were alternately placed in a culture medium with and without microalgae (alternated 12, 24, and 36 h in DR12, DR24, and DR36, respectively). Six replicates were prepared for each treatment. The rotifers were checked every 12 h to record the number of neonates and remove the neonates until all the experimental animals had died.

The effects of DR on hsps expression

Rotifers hatched from resting eggs were cultured using different feeding regimes (AL, DR12, DR24, and DR36) as previously mentioned. Each treatment contained 100 rotifers in 50 mL medium. Three replicates were prepared for each treatment. Rotifers were transferred into newly prepared culture media every 12 h and checked every 12 h to remove neonates, which were then collected and the total RNA extracted and reverse transcribed into cDNA after 3 days.

The effects of vitamin E on lifespan and reproduction

Six rotifers (0–2 h old) were transferred into 24-well culture plates, which contained 3 mL of test solution and C. pyrenoidosa at 3 × 10⁶cells/mL. The concentration of vitamin E was 40 μM. Rotifers cultured in normal medium acted as controls. Six replicates were prepared for each treatment. The rotifers were checked every 12 h to record the number of neonates and remove the neonates until all the experimental animals had died.

Survival test

One hundred twenty individuals were collected and divided into three groups, AL, DR12, and DR24. The AL group was transferred to a newly prepared culture media containing the feeding alga every 12 h, whereas the DR12 and DR24 groups were alternately placed in a culture media with and without the feeding alga every 12 and 24 h, respectively. After 2 days, 30 rotifers were transferred from each of the AL, DR12, and DR24 groups to the culture medium containing paraquat at a concentration of 15.25 mg/L. The number of surviving rotifers was recorded every 12 h after exposure. Three replicates were prepared for each treatment. Paraquat (DMSO stock) was obtained from the Jiangsu Academy of Agricultural Sciences (Nanjing, China).

Quantitative analysis of hsps gene transcription

Total RNA was extracted using the procedures described above. Total RNA was reverse transcribed into cDNA using the PrimeScript RT Reagent Kit (TaKaRa, Japan). Real-time PCR was performed on a Mastercyclereprealplex (Eppendorf, Germany) to study gene expression. The PCR reaction was performed in a 25 μL volume with a SYBR Premix Ex Taq™Kit (TaKaRa, Japan), 2 μM of each specific primer, and 1 μL of cDNA using the following procedure: initial denaturation at 95 °C for 2 min followed by 40 cycles of amplification (95 °C for 10 s and 55 °C for 30 s). Table 1 shows the primers used in quantitative real-time PCR. Β-actin was used as the internal control for quantitative real-time PCR. The relative expression levels of different genes were calculated using the 2−ΔΔCT method (Kenneth and Thomas 2001).

Statistical analysis

All the statistical analyses were carried out using the SPSS 16.0 analytic package. Results from the lifespan experiments were analyzed using survival analysis (Kaplan–Meier log-rank test); results from the DR and vitamin E reproduction experiments were analyzed using one-way analysis of variance (ANOVA), Duncan test, and Student’s t test, respectively. The mRNA expression level was determined by one-way ANOVA with the Tukey test. Differences were considered significant when P value was <0.05. All figures were produced using Sigma Plot version 11.0.

Results

Characterization of Bchsp40, Bchsp60, Bchsp70, and Bchsp90 genes in B. calyciflorus

Bchsp40

The full-length hsp40 cDNA of B. calyciflorus (Bchsp40) was 1,496 bp long, and contained 128 bp in the 5′ untranslated region (UTR), an open reading frame (ORF) of 1,212 bp that encoded 403 amino acids, and 156 bp in the 3′ UTR with a poly A signal (ATTAAA; data not shown). In a GenBank Blastx search, the cDNA sequence of BcHSP40 showed three DnaJ domains. The calculated molecular mass of the deduced mature BcHSP40 was 45.1005 kDa, and the theoretical isoelectric point was 7.09. The deduced amino acid sequence of Bchsp40 contained an N-terminal conserved domain (J domain, aa7–67), a central domain containing four highly conserved cysteine-rich repeats with a consensus sequence of CxxCxGxG where x is any amino acid (CRR domain, aa139–205), and a C-terminal domain (C domain, aa262–341) (Fig. 1a). The primary structure of BcHSP40 showed high levels of similarity to HSP40s in four other animals. It showed 80.15, 62.62, 60.11, and 58.66 % identity with orthologs of the marine rotifer B. plicatilis (GenBank accession number ADR79278), Mus musculus (NP_032324), Dugesia japonica (AES12470), and Xenopus laevis (NP_001079772), respectively. Furthermore, there were eight cysteine residues (cys-140, 142, 155, 158, 182, 185, 198, and 201) that are essential for BcHSP40 binding to zinc.

Fig. 1.

Alignment of deduced amino acid sequences of the selected HSPs. Identities are shaded yellow and similarities are shaded blue and green. Gaps (solid line) were introduced to maximize the alignment. a HSP40, three DnaJ domains are shown above the alignment. HPD motif is boxed with a dotted line. Eight cysteine residues that are essential for BcHSP40 binding to zinc are indicated with asterisks. b HSP60, the ATP-binding motif is boxed and the classical HSP60 signature motif is boxed with a dotted line. Underlined amino acids indicate the estimated transit peptides. The sequence of the GGM repeat motif conserved in mitochondrial HSP60 is indicated with asterisks. c HSP70, three HSP70 signatures and one ATP binding site are boxed. The signal peptide (position, 1–21) is underlined, and consensus signature of endoplasmic reticulum form is boxed with a dotted line. d HSP90, HSP90 family signature motifs and cytosolic signature of cytosolic form are boxed. A typical histidine kinase-like ATPases domain is boxed with a dotted line and the leucine zipper-like motifs are indicated by asterisk

Bchsp60

Full-length Bchsp60 cDNA consisted of 1940 nucleotides with a 1,740-bp ORF encoding 579 amino acids. The calculated molecular mass of the deduced mature BcHSP40 was 61.7469 kDa, and the theoretical isoelectric point was 6.66. The deduced sequence contained a presequence of 26 amino acids at the N terminus that is required for import into the mitochondria. BcHSP60 has a conserved ATP-binding/Mg²⁺ binding site, a hinge region, and stacking interaction sites(Marchler-Bauer et al. 2007) (Fig. 1b). BcHSP60 displayed very high homology with shrimp HSP60s from B. ibericus (ADR79280, 90.78 %), D. melanogaster (NP_511115, 70.06 %), Daphnia pulex (EFX84424, 72.09 %), and X. laevis (NP_001083970, 71.11 %).

Bchsp70

Full-length Bchsp70 cDNA consisted of 2,155 nucleotides with a 1,971-bp ORF encoding 656 amino acids. The calculated molecular mass of the deduced mature BcHSP70 was 72.3939 kDa, and the theoretical isoelectric point was 5.23. The deduced amino acid sequence of Bchsp70 also contained HSP70 family motifs and signatures, including an adenosine triphosphate/guanosine triphosphate (ATP/GTP)-binding site, signal peptide (position, 1–21), and a consensus signature of endoplasmic reticulum (ER) form KDEL motif (Fig. 1c). BcHSP70 displayed very high homology with shrimp HSP70s from Ascaris suum (ADY43887, 76.17 %), B. ibericus (ADR79282, 88.65 %), M. musculus (ABF20530, 78.10 %), and Xenopus tropicalis (XP_002941690, 78.82 %). The N-terminal two thirds of hsp70s were more conserved than the C-terminal third.

Bchsp90

The Bchsp90 cDNA contained a 2,166-bp ORF that encoded 721 amino acids with a calculated molecular weight of 82.7858 kDa and a theoretical isoelectric point of 5.07. The deduced amino acid sequence of Bchsp90 also contained HSP90 family motifs and signatures, including five signatures, a typical histidine kinase-like ATPase (HATPase) domain, and a conserved MEEVD motif (Caplan 1999; Gupta 1995). BcHSP90 exhibited high homology with HSP90s in other animals: B. ibericus (ADR79283, 93.48 %), Philodina roseola (ACC43981, 80.11 %), Harpegnathos saltator (EFN88374, 79.23 %), and Tigriopus japonicas (ACA03524, 77.32 %) (Fig. 1d). The Bchsp40, Bchsp60, Bchsp70, and Bchsp90 cDNA sequences and their deduced amino acid sequence were submitted to the NCBI GenBank under accession numbers KC176712, KC176713, KC176714, and KC176715, respectively.

An unrooted phylogenetic tree based on the amino acid sequence alignment was constructed using the Bayesian method (Fig. 2). A total of 39 sequences were retrieved from the GenBank databases (Table 2). All HSPs can be classified into four distinct clusters: HSP40 family, HSP60 family, HSP70 family, and HSP90 family. HSP40, HSP60, HSP70, and HSP90 from B. calyciflorus clustered together with other HSP40s, HSP60s, HSP70s, and HSP90s as a subgroup, respectively.

Fig. 2.

Phylogenetic analysis of HSPs constructed by Bayesian method. The abbreviation of HSPs and the GenBank accession No. used to construct phylogenetic tree are given in Table 2. Numbers at branch nodes represent the confidence level of posterior probability

Table 2.

Species and GenBank accession numbers of HSPs sequences used for phylogenetic analysis

Species	GenBank No.	Abbreviation type	Size (aa)
Alligator mississippiensis	BAF94139	A. mississippiensis Hsp40	398
Brachionus ibericus	ADR79278	B. ibericus Hsp40	368
Dugesia japonica	AES12470	D. japonica Hsp40	411
Anolis carolinensis	XP_003224682	A. carolinensis Hsp40	396
Ictalurus punctatus	NP_001187713	I. punctatus Hsp40	408
Monodelphis domestica	XP_001362945	M. domestica Hsp40	423
Xenopus laevis	NP_001079772	X. laevis Hsp40	397
Paralichthys olivaceus	ABA54277	P. olivaceus Hsp40	395
Brachionus calyciflorus	KC176712	B. calyciflorus Hsp40	403
B. ibericus	ADR79280	B. ibericus Hsp60	581
Cricetulus griseus	XP_003504389	C. griseus Hsp60	573
Danio rerio	NP_851847	D. rerio Hsp60	575
Daphnia pulex	EFX84424	D. pulex Hsp60	576
Drosophila melanogaster	NP_511115	D. melanogaster Hsp60	573
Gallus gallus	NP_001012934	G. gallus Hsp60	573
Harpegnathos saltator	EFN79769	H. saltator Hsp60	608
Oreochromis niloticus	XP_003456322	O. niloticus Hsp60	575
X. laevis	NP_001083970	X. laevis Hsp60	579
B. calyciflorus	KC176713	B. calyciflorus Hsp60	579
Ascaris suum	ADY43887	A. suum Hsp70	655
B. ibericus	ADR79282	B. ibericus Hsp70	653
Coturnix japonica	BAF38391	C. japonica Hsp70	652
C. griseus	NP_001233668	C. griseus Hsp70	654
Homo sapiens	NP_005338	H. sapiens Hsp70	654
Mus musculus	NP_071705	M. musculus Hsp70	655
P. olivaceus	ABG56392	P. olivaceus Hsp70	654
Salmo salar	NP_001135114	S. salar Hsp70	657
Xenopus tropicalis	XP_002941690	X. tropicalis Hsp70	655
B. calyciflorus	KC176714	B. calyciflorus Hsp70	656
B. calyciflorus	KC176715	B. calyciflorus Hsp90	721
Apis florea	XP_003694932	A. florea Hsp90	717
B. ibericus	ADR79283	B. ibericus Hsp90	720
D. rerio	AAC21566	D. rerio Hsp90	724
Eriocheir sinensis	ADE60732	E. sinensis Hsp90	718
H. saltator	EFN88374	H. saltator Hsp90	723
Philodina roseola	ACC43981	P. roseola Hsp90	739
Portunus trituberculatus	ACQ90225	P. trituberculatus Hsp90	721
Quadrastichus erythrinae	AFC76152	Q. erythrinae Hsp90	721
Tigriopus japonicus	ACA03524	T. japonicus Hsp90	721

Time course of hsps expression following exposure to different temperatures

To study the modulatory effect of different temperatures on the expression of hsps, we measured expression at 15, 30, and 37 °C relative to the control (25 °C) over 6 h (Fig. 3). High temperature (37 °C) significantly increased the expression of Bchsp40, Bchsp60, and Bchsp70 at 0.5 h after exposure and showed a steady upregulation over time. However, the expression of Bchsp90 was temporarily increased after exposure to 37 °C, and then returned to normal levels (Fig. 3d). At 30 °C, the expression of Bchsp40 increased immediately (P < 0.05) (Fig. 3a). The expression of Bchsp90 increased when exposed to 30 °C for 1 h and showed a steady upregulation over time (Fig. 3d). The expression of Bchsp60 and Bchsp70 steadily increased after exposure to 30 °C. At low temperature (15 °C), the expression of Bchsp40, Bchsp60, and Bchsp70 increased significantly after 1 h of exposure, and the expression level returned to normal after 6 h of exposure. The expression of Bchsp90 was not significantly different after exposure to 15 °C (Fig. 3d).

Fig. 3.

Hsps mRNA expression of B. calyciflorus at different temperature exposures of 10, 30, and 37 °C with control (25 °C). The expression levels of hsps mRNA was statistically analyzed by one-way ANOVA with the Tukey test (*p < 0.05; **p < 0.01; ***p < 0.001): a hsp40, b hsp60, c hsp70, and d hsp90

Effect of H₂O₂ on hsps mRNA expression

Figures 4 and 5 illustrate the effect of H₂O₂ on the expression of hsps mRNA. Following H₂O₂ (0.1 or 0.2 mM) exposure, the mRNA expression of the four hsps was upregulated to different degrees. In both the 0.1 and 0.2 mM groups, the expression of the four hsps significantly increased (30- to 90-fold) immediately after exposure to H₂O₂ for 1 h, and even though expression decreased slightly after 2 h, the mRNA expression levels were still significantly higher (5- to 10-fold) than the normal level (P < 0.05).

Fig. 4.

Relative mRNA levels of hsps of B. calyciflorus treated under H₂O₂ (0.1 mM) stress condition. The expression levels of hsps mRNA were statistically analyzed by one-way ANOVA with the Tukey test. The different letters indicate a significant difference for each time point with control (p < 0.05): a hsp40, b hsp60, c hsp70, and d hsp90

Fig. 5.

Relative mRNA levels of hsps of B. calyciflorus treated under H₂O₂ (0.2 mM) stress condition. The expression levels of hsps mRNA was statistically analyzed by one-way ANOVA with the Tukey test. The different letters indicate a significant difference for each time point with control (p < 0.05): a hsp40, b hsp60, c hsp70, and d hsp90

Effect of DR and vitamin E on rotifer lifespan and reproduction

Figure 6 illustrates the effect of DR on the lifespan of B. calyciflorus. The average lifespan in the DR12 group was 120.4 ± 4.3 h, which was significantly longer (log-rank test, P < 0.0001) than that in the control group (95.0 ± 3.7 h) (Fig. 6c). However, the average lifespan in the DR24 and DR36 groups was 61.9 ± 2.3 and 66.0 ± 1.4 h, respectively and were significantly less (P < 0.05) than that in the control group (Fig. 6c). Figure 7a illustrates the fecundity of rotifers in the AL and DR groups at each time point. The average number of offspring produced per rotifer in the DR12, DR24 and DR36 groups was 5.9 ± 2.4, 2.9 ± 0.4, and 5.4 ± 0.3, respectively, significantly less (P < 0.05) than that in the control group 13.6 ± 5.5 (Fig. 7b). Figure 7c illustrates the number of egg carried by rotifers in the AL and DR groups at each time point. We also studied the effect of vitamin E on the lifespan and reproduction of B. calyciflorus and found that vitamin E had no effect on lifespan or reproduction (Fig. 8).

Fig. 6.

Effect of DR on rotifer lifespan. a Feeding regimes. b Survival rate of B. calyciflorus cultured in different feeding regimes. c Mean lifespan of B. calyciflorus cultured in different feeding regimes

Fig. 7.

Effect of DR on rotifer reproduction. a The fecundity of B. calyciflorus in the AL and DR groups at each time point. b Absolute fecundity B. calyciflorus cultured in different feeding regimes. c The number of egg carried by B. calyciflorus in the AL and DR groups at each time point

Fig. 8.

Lifespan and fecundity of B. calyciflorus cultured in vitamin E. y-axis (left) is the survival rate. y-axis (right) is the number of daughters. x-axis is survival (in hours)

Age-related changes in hsps mRNA expression

Figure 9 shows Bchsps mRNA expression in B. calyciflorus at different ages. The expression level of Bchsp70 mRNA significantly decreased with age (P < 0.05) (Fig. 9c), whereas a small but significant (P < 0.05) increase in the mRNA levels of Bchsp40 was only observed in 4-day-old individuals (Fig. 9a). The expression of Bchsp60 mRNA significantly decreased (P < 0.05) in 1-, 2-, and 3-day-old individuals and significant decreases (P < 0.05) in the mRNA levels of Bchsp90 were observed in 2-, 3-, and 4-day-old individuals (Fig. 9b, d).

Fig. 9.

Hsps mRNA expression of B. calyciflorus of different age classes. The expression levels of hsps mRNA was statistically analyzed by one-way ANOVA with the Tukey test: a hsp40, b hsp60, c hsp70, and d hsp90

The effects DR on hsps mRNA expression

Qualitative real-time PCR showed that DR12 and DR24 treatment significantly improved (P < 0.05) the mRNA expression of Bchsp40, BcHsp60, BcHsp70, and BcHsp90 (Fig. 10), whereas DR36 treatment significantly improved (P < 0.05) the mRNA expression of Bchsp40, Bchsp60, and Bchsp90 but not Bchsp70 mRNA (P > 0.05) (Fig. 10c). The expression level of Bchsp60, Bchsp70, and Bchsp90 mRNA reached maximum levels in the DR12 group.

Fig. 10.

Hsps mRNA expression of B. calyciflorus of different feeding regimes. The expression levels of hsps mRNA was statistically analyzed by one-way ANOVA with the Tukey test. The different letters indicate a significant difference for each time point with control (p < 0.05): a hsp40, b hsp60, c hsp70, and d hsp90

Effect of vitamin E on hsps mRNA expression

Real-time quantitative RT-PCR demonstrated that vitamin E (40 μM) significantly decreased the expression of Bchsp40 (Fig. 11a). However, the expression of Bchsp70 and Bchsp90 was temporarily increased after exposure to vitamin E for 1 h, and after exposure for 4 h, the expression levels of Bchsp70 and Bchsp90 were significantly decreased compared with the control (Fig. 11c, d). The expression of Bchsp60 was significantly increased after exposure to vitamin E, and the expression level was maximal after 4 h of exposure (Fig. 11b).

Fig. 11.

Relative mRNA levels of hsps of B. calyciflorus treated with vitamin E (40 μM). The expression levels of hsps mRNA was statistically analyzed by one-way ANOVA with the Tukey test. The different letters indicate a significant difference for each time point with control (p < 0.05): a hsp40, b hsp60, c hsp70, and d hsp90

Effect of DR pretreatment on oxidative stress resistance

Figure 12 illustrates the effects of DR pretreatment on the survival rate of rotifers under oxidative stress conditions. After exposure to oxidative stress for 12 h, survival rate in the DR12 pretreatment group was 0.78 ± 0.02 which was significantly higher (P < 0.05) than that in the control group (0.60 ± 0.25). In the 24-h-exposed group, the survival rates in the DR12 pretreatment groups and control groups were 0.55 ± 0.02 and 0.38 ± 0.02, respectively (P < 0.05). However, the survival rate in the DR24 pretreatment groups were 0.39 ± 0.04 which was significantly lower (P < 0.05) than that in the control groups (0.60 ± 0.25). These results indicate that DR12 pretreatment increased rotifer survival rate under paraquat-induced oxidative stress.

Fig. 12.

Effects of DR pretreatments on the B. calyciflorus survival rate under oxidative stress conditions (paraquat). a Experimental designs. b The survival rate of B. calyciflorus in the AL and DR pretreatment groups at each time point. The survival rate was statistically analyzed by one-way ANOVA with the Duncan test

Discussion

HSPs are a highly conserved, ubiquitously expressed family of stress response proteins which are expressed at low levels under normal physiological conditions (Hartl 1996). In the present study, we cloned cDNAs encoding four typical hsp genes (Bchsp40, Bchsp60, Bchsp70, and Bchsp90) from the rotifer B. calyciflorus. Multiple sequence alignment revealed that HSPs from B. calyciflorus were highly homologous with the HSPs from other animals, which indicated that they may have a similar function to the HSPs in other species. HSPs can be induced by a variety of stressful stimuli, such as temperature, cellular energy depletion, physical injury, and various toxic substances (Feder and Hofmann 1999; Ritossa 1962), therefore, HSPs are also called “stress proteins” (Kalmar and Greensmith 2009; Wheelock et al. 2002).

In general, coordinated activation of HSP expression, called the heat shock response (HSR), is a ubiquitous adaptation mechanism in organisms ranging from bacteria to mammals, which helps them to survive and adapt to a wide range of environmental challenges (Lindquist and Craig 1988). To study the modulatory effect of different temperatures on the expression of Bchsps genes, we measured expression at 15, 30, and 37 °C relative to the control (25 °C) over 6 h and found that temperature stress (15 and 37 °C) significantly induced the expression of Bchsp40, Bchsp60, and Bchsp70 genes, indicating that Bchsp40, Bchsp60, and Bchsp70 genes were involved in the chaperoning process to protect proteins under temperature stress in rotifers. However, temperature stress (15 and 37 °C) had no effect on the expression of Bchsp90. Our findings are in accordance with previous studies where hsp40, hsp60, and hsp70 were required for rotifer thermotolerance; however, hsp90 was not essential (Smith et al. 2012). Increased hsps expression under high and low temperatures can protect cells from temperature stress (Dangi et al. 2012).

In addition to typical heat stress, oxidative stress can also induce the expression of HSPs. H₂O₂ is the most stable intermediate that generates intracellular nonradical ROS (Rosa et al. 2008). It can easily diffuse through cellular membranes into the cell, react with transition metals, and generate hydroxyl radicals (HO·) (Abele-Oeschger et al. 1997). As an oxidant, H₂O₂ can regulate the expression of many genes, for example superoxide dismutase (SOD) and the hsp20 gene in the rotifer Brachionus sp. (Rhee et al. 2011). In the present study, to analyze the modulatory effect of oxidative stress on Bchsps genes, we initially exposed rotifers to H₂O₂ for various time periods and found that H₂O₂ significantly increased the mRNA expression of these four Bchsps. The high expression levels of Bchsps contributed to activation of the HSR, and protected cells from oxidative stress. Previous studies have also shown that environmental stress (i.e., heavy metals, osmotic stress, and various chemicals) increased the expression of hsps (Rios-Arana et al. 2005; Seo et al. 2006; Ventura et al. 2007; Wheelock et al. 1999). The expression of hsps was significantly induced by typical temperature pressure and oxidative stress and reflected the characteristics of the hsps as “stress proteins.”

Aging is likely regulated by low affinity, low specificity interactions, and mediated through a complex network of overlapping pathways (Snell et al. 2012). The quality of proteins declines during the aging process, for example, in 80-year-old humans, half of all proteins may become oxidized (Stadtman and Berlett 1998). Due to these degradation defects, damaged proteins accumulate in the cells of aging organisms, and this may cause a variety of protein folding diseases (Söti and Csermely 2002). HSPs are present in the cells of all living organisms; they act as molecular chaperones and can facilitate protein folding, prevent protein aggregation, and target improperly folded proteins to specific degradation pathways (Kalmar and Greensmith 2009). For example, HSP40s are important for protein homeostasis because they stimulate the ATPase activity of the HSP70 proteins that are involved in protein translation, folding, unfolding, translocation, and degradation (Qiu et al. 2006). HSP60s is a mitochondrial chaperonin that is typically held responsible for the transportation and refolding of proteins from the cytoplasm into the mitochondrial matrix (Koll et al. 1992). HSP70s play a role in protein synthesis under normal cellular conditions, fixing denatured proteins and preventing the misfolding or aggregation of proteins (Danwattananusorn et al. 2011). HSP90 participates in the folding, maintenance of structural integrity, and the proper regulation of a subset of cytosolic proteins (Picard 2002). HSPs contribute to protein quality control and are related to aging owing to their functions mentioned above (Becker and CRAIG 1994; Calderwood et al. 2009; Nardai et al. 2002; Soti and Csermely 2003). The induced expression of HSPs in response to various stresses is dependent on the activation of specific members of a family of transcription factors, the heat shock factors (HSFs), which bind to the heat shock elements in the promoters of the genes encoding HSPs (Åkerfelt et al. 2010). Previous research has recently shown that increased protein damage during aging may be exacerbated by reduced levels of HSPs, and the resultant loss of protein quality control (Calderwood et al. 2009). In this study, we examined the effects of aging on the gene expression of four rotifer Bchsps genes to determine the relationship between aging and these four Bchsps genes. We found that Bchsp70 mRNA expression was significantly decreased with aging. HSP70 is mostly found in the cytosol and nucleus and is used for protein folding and cytoprotection as well as a molecular chaperone (Becker and CRAIG 1994). The cloned BcHSP70 contains a highly conserved typical C-terminal retention sequence (HDEL in mammalian and KDEL in yeast cells) that is common for soluble ER-localized proteins and inhibits its exit from the ER (MUNRO and PELHAM 1987). This ER-localized HSP70 protein, initially described as the mammalian glucose-regulated protein GRP78 (Lee et al. 1981; Munro and Pelham 1986) is induced by the accumulation of misfolded proteins inside the ER (Kozutsumi et al. 1988; Rose et al. 1989). Evidence has indicated that HSP70s in the ER not only aid protein folding and assembly but also may be directly involved in the import of secretory proteins (Vogel et al. 1990). Thus, the decrease in expression of Bchsp70 mRNA means that accumulation of damaged proteins is accelerated. In other organisms, the increased expression of hsp70 gene can extend the lifespan of S. cerevisiae and D. melanogaster (Shama et al. 1998; Tatar et al. 1997). On the other hand, the presence of misfolded proteins (damaged proteins) can induce activation of the HSR by activating the transcription factors, HSFs (Abravaya et al. 1992; Morimoto 1992). Age-dependent waning of the HSR is a general effect found in neuronal tissues (Hands et al. 2008; Sherman and Goldberg 2001; Winklhofer et al. 2008), skeletal muscle, cardiac muscle (Kayani et al. 2008), and liver (Gagliano et al. 2007). The decline in HSR in aging cells indicated that the capacity of the organism to resist stress diminished. The decline in the HSR may be one of the factors which cause aging.

As a natural stress, moderate starvation has been reported to enhance the expression of many genes, including SOD (Kaneko et al. 2005; Kaneko et al. 2011), catalase (CAT) (Kaneko et al. 2011), hsp70, and GRP94 (Kaneko et al. 2002). DR is the most common starvation method for prolonging life in the laboratory, and it has been reported to extend the lifespan of different organisms (Fanestil and Barrows 1965; Klass 1977; Lin et al. 2002; Walker et al. 2005). In rotifers, previous studies have also suggested that DR can extend the lifespan of different types of rotifers (Ozdemir 2009; Weithoff 2007; Yoshinaga et al. 2000). Interestingly, DR-induced longevity and other beneficial effects can be transmitted to subsequent generations in B. plicatilis (Kaneko et al. 2011). In the present study, we found that DR significantly extended the lifespan of the rotifer, B. calyciflorus, and reduced fecundity. Our findings are in accordance with previous studies where DR extended the lifespan accompanied by a reduction of infertility in D. melanogaster (Chapman and Partridge 1996; Chippindale et al. 1993; Partridge et al. 2005) and in rotifers (Ozdemir 2009; Yoshinaga et al. 2000). We also found that DR significantly increased the expression of Bchsp40, Bchsp60, Bchsp70, and Bchsp90 mRNA. The expression of HSPs is not only induced by heat stressors but also by other stressors (Feder and Hofmann 1999), and upregulated HSPs are generally described as part of the cellular stress response (Roberts et al. 2010). The increased expression of HSPs may contribute to diminish the accumulation of damaged proteins and extend the lifespan (Tatar et al. 1997). These examples confirm the hypothesis that HSPs have a better adaptation capacity to various stresses which greatly increases the chances of longevity.

Vitamin E is known to function as an antioxidant, and it has long been investigated for its effects on rotifer aging. Therefore, it was necessary for us to further determine the relationship between HSPs and aging through the anti-oxidative and anti-aging effects of vitamin E. It was reported by Sawada and Enesco that when the rotifer Asplanchna brightwelli was exposed to 25 μg/mL (58 μM) of vitamin E, its lifespan was extended by 21 % due to lengthening of the pre-reproductive and reproductive periods (Sawada and Enesco 1984). Litton reported that exposure to α-tocopherol extended the lifespan of four other rotifer species by about 10 % (Litton 1987). However, in the present study, we found that vitamin E had no effects on rotifer lifespan or reproduction. These inconsistent results may be caused by the differences in rotifer species. In recent research, Snell et al found that the lifespan of the rotifer, B. manjavacas, was extended only when antioxidants were paired with trolox, N-acetyl cysteine, or l-carnosine. Trolox treatment alone did not prolong the lifespan of rotifers (Snell et al. 2012). This also suggested that antioxidant treatment could not always extend the lifespan of rotifers. Actually, the anti-aging effect of vitamin E is also controversial in worms. For example, vitamin E (α-tocopherol) increased lifespan in the first two studies (Harrington and Harley 1988; Ishii et al. 2004) but not in the third (Adachi and Ishii 2000). Likewise, trolox, an α-tocopherol derivative, increased lifespan in Benedetti’s study (Benedetti et al. 2008) but not in Schulz’s (Schulz et al. 2007). We analyzed the expression of Bchsps in rotifers after exposure to vitamin E and found that vitamin E significantly increased the mRNA expression of Bchsp60 only and not the other three hsps. This suggests that vitamin E may not improve the HSR in rotifers. To some extent, this also explains why vitamin E does not extend the lifespan of rotifers.

Aging has been associated with a loss of stress resistance, and treatments that extend lifespan are often associated with increased stress resistance (Kirkwood and Austad 2000; Vermeulen and Loeschcke 2007). Previous studies showed that there was a close correlation between stress resistance and longevity in several long-lived C. elegans and Drosophila mutants (Lithgow and Kirkwood 1996). To assess resistance to oxidative stress in rotifers, we used paraquat, a widely used compound, to generate ROS inside the cells (Kaneko et al. 2011). Under paraquat-induced oxidative stress, moderate DR pretreatment increased rotifer survival rate. Our findings are in accordance with previous studies which showed that treatments which extended lifespan increased stress resistance. Rosa damascene is a rose hybrid commonly harvested for its oil used in perfumery and for rose water used to flavor food. It was reported by Schriner et al. that R. damascena extended the lifespan of D. melanogaster through a DR-associated mechanism (Schriner et al. 2012). The authors also found that R. damascena could improve D. melanogaster resistance to paraquat and H₂O₂. The same study also showed that the natural product, black tea (Camellia sinensis), blocked the age-dependent accumulation of iron, improved iron tolerance, and extended the lifespan of D. melanogaster (MASSIE et al. 1993). Enhanced stress resistance is likely to benefit from the upregulated expression of hsps. In fact, overexpression of hsp22 has been shown to increase fly lifespan, protect flies against paraquat, and improve their locomotor ability (Morrow et al. 2004). In rotifers, DR pretreatment was reported to benefit paraquat and juglone tolerance (Kailasam et al. 2011; Ozaki et al. 2010). A previous study indicated that the beneficial effects of DR may contribute to the improvement in antioxidant gene expression (SOD and CAT) (Yang et al. 2013). In the present study, we also found that inducing the expression of hsps by DR may be helpful for DR-induced extended lifespan. DR also had other beneficial effects, such as resistance to oxidative stress.

Conclusions

In this study, we successfully cloned four typical hsp genes (hsp40, hsp60, hsp70, and hsp90) from the rotifer B. calyciflorus Pallas, analyzed the molecular characteristics, and found that Bchsps was significantly induced by temperature and H₂O₂ stress. The mRNA expression of Bchsp70 decreased with age which indicated waning of the HSR with aging in rotifers. DR extended the lifespan and improved resistance to paraquat, and these findings may have benefitted from the upregulated expression of hsps.

Abbreviations

ANOVA

Analysis of variance

bp

Base pair

DR

Dietary restriction

ATP/GTP

Adenosine triphosphate/guanosine triphosphate

EPA

Artificial freshwater medium

ER

Endoplasmic reticulum

H₂O₂

Hydrogen peroxide

HSF

Heat shock factor

HSP

Heat shock protein

HSR

Heat shock response

O₂⁻

Superoxide anion

ORF

Open reading frame

PCR

Polymerase chain reaction

RACE

Rapid amplification of cDNA ends

ROS

Reactive oxygen species

RT-PCR

Real-time PCR

SOD

Superoxide dismutase

UTR

Untranslated region