Paneth cells as a site of origin for intestinal inflammation

Abstract

Autophagy related 16-like 1 (ATG16L1) as a genetic risk factor has exposed the critical role of autophagy in Crohn’s disease (CD)¹. Homozygosity for the highly prevalent ATG16L1 risk allele, or murine hypomorphic (HM) activity causes Paneth cell dysfunction^2,3. As Atg16l1^HM mice do not develop spontaneous intestinal inflammation, the mechanism(s) by which ATG16L1 contributes to disease remains obscure. Deletion of the unfolded protein response (UPR) transcription factor X-box binding protein-1 (Xbp1) in intestinal epithelial cells (IECs), whose human orthologue harbors rare inflammatory bowel disease (IBD) risk variants, results in endoplasmic reticulum (ER) stress, Paneth cell impairment and spontaneous enteritis⁴. Unresolved ER stress is a common feature of IBD epithelium^4,5, and several genetic risk factors of CD affect Paneth cells^2,4,6-9. Here we show that impairment in either UPR (Xbp1^ΔIEC) or autophagy function (Atg16l1^ΔIEC or Atg7^ΔIEC) in IECs results in each other’s compensatory engagement, and severe spontaneous CD-like transmural ileitis if both mechanisms are compromised. Xbp1^ΔIEC mice exhibit autophagosome formation in hypomorphic Paneth cells, which is linked to ER stress via protein kinase RNA-like endoplasmic reticulum kinase (PERK), elongation initiation factor 2α (eIF2α) and activating transcription factor 4 (ATF4). Ileitis is dependent on commensal microbiota and derives from increased IEC death, inositol requiring enzyme 1α (IRE1α)-regulated NFκB activation and tumor necrosis factor signaling which are synergistically increased when autophagy is deficient. ATG16L1 restrains IRE1α activity and augmentation of autophagy in IECs ameliorates ER stress-induced intestinal inflammation and eases NFκB overactivation and IEC death. ER stress, autophagy induction and spontaneous ileitis emerge from Paneth cell-specific deletion of Xbp1. Genetically and environmentally controlled UPR function within Paneth cells may therefore set the threshold for the development of intestinal inflammation upon hypomorphic ATG16L1 function and implicate ileal CD as a specific disorder of Paneth cells.

The UPR and autophagy are integrally linked pathways¹⁰. To investigate their relationship in the intestinal epithelium, we stably transduced the small IEC line MODE-K with a short hairpin Xbp1 (shXbp1) lentiviral vector (Extended Data Fig. 1a)⁴. We observed increased levels of ATG7, Beclin1 (Extended Data Fig. 1b) and phosphatidylethanolamine (PE)-conjugated microtubule-associated protein 1 light chain 3 β (LC3-II) relative to LC3-I compared to control-silenced (shCtrl) cells (Extended Data Fig. 1c). Increased autophagic flux accounted for this given increased levels of LC3-II relative to LC3-I observed after inhibition of autophagosome-lysosome fusion by bafilomycin¹¹ (Extended Data Fig. 1d). Increased GFP-LC3 punctae were seen in shXbp1 compared to shCtrl MODE-K cells transfected with a green fluorescent protein (GFP)-LC3-expressing vector¹² (Extended Data Fig. 1e, f), and increased numbers of autophagic vacuoles in shXbp1 compared to shCtrl cells (Extended Data Fig.1g, h). Accordingly, isolated primary IECs from the small intestine of Villin (V)-Cre⁺;Xbp1^fl/fl (‘Xbp1^ΔIEC’)⁴ mice backcrossed onto C57BL/6 (B6) exhibited nearly complete consumption of LC3-I and a relative increase in LC3-II (Fig. 1a and Extended Data Fig.1i), stable amounts of ATG7 presumably reflecting a combination of increased production and consumption, elevated levels of ATG16L1 and Beclin1 (Fig. 1b and Extended Data Fig. 1j) and autophagosomes and degradative autophagic vacuoles consistent with autophagy induction in hypomorphic⁴ Paneth cells, and to a lesser extent goblet cells (data not shown), compared to V-Cre⁻;Xbp1^fl/fl (Wt) mice (Fig. 1c and Extended Data Fig. 1k). To gain temporal control of Xbp1 deletion and ability to monitor autophagy in situ and exclude the role of chronic inflammation⁴ in this induction, we generated V-CreER^T2;Xbp1^fl/fl (‘Xbp1^T-ΔIEC’) mice on a B6 background crossed to GFP-LC3 transgenic mice¹². Three days after tamoxifen-induced Xbp1 deletion (Extended Data Fig.2a), although mature Paneth cells remained present with little detectable inflammation (data not shown), punctate GFP signal accumulation was greatest at the bottom of the crypts of Lieberkühn (Fig. 1d, e), and co-localized with lysozyme-positive Paneth cells (Extended Data Fig. 2b). Purified crypts of Xbp1^T-ΔIEC mice revealed increased LC3-I/II conversion and reduced p62 compared to Wt mice (Extended Data Fig.2c). Thus, Xbp1 loss in IECs induced autophagy most notably in Paneth cells.

Figure 1. PERK/eIF2α signaling induces autophagy in Xbp1-deficient intestinal epithelial cells.

a, b, Immunoblot for LC3 conversion in isolated primary IECs (a) (n=5/4) and for autophagy proteins in primary IEC scrapings (b) (n=3). c, Transmission electron microscopy (TEM) of crypts. Note autophagic vacuoles in various stages of evolution in Xbp1^ΔIEC hypomorphic Paneth cells. d, e, Crypt showing GFP-LC3 punctae (d), quantified in (e) (n=10; unpaired Student’s t-test). Bar, 5 μm. f, g, Immunoblot of silenced MODE-K cells (f) and primary IEC scrapings (g) for the PERK/eIF2α branch (n=3). h, i, Promoter sequence qPCR for Map1lc3b (LC3b) (h) and Atg7 (i) after anti-ATF4 ChIP (unpaired Student’s t-test). j, GFP-LC3 punctae per crypt after treatment with tamoxifen for 3 days and vehicle or salubrinal (n=10; one-way ANOVA with post-hoc Bonferroni). (k) Enteritis histology score after salubrinal and tamoxifen co-treatment (n=12/14/13; median shown; Kruskal-Wallis with post-hoc Holm’s-corrected Mann-Whitney U). Results represent three (a, f, g) or two (c, e, h, i) independent experiments. *P < 0.05, ***P < 0.001.

Although Xbp1-deficient IECs exhibited broad evidence of ER stress⁴ (Extended Data Fig. 2d-j), an examination of shXbp1, relative to shCtrl, MODE-K cells demonstrated a particularly significant increase in phosphorylated (p)-PERK and its substrate p-eIF2α (Fig. 1f) with the latter reversed by Perk-silencing identifying it as the factor responsible for p-eIF2α formation (Extended Data Fig. 3a). Increased p-eIF2α was also detected in primary IECs of Xbp1^ΔIEC (Fig. 1g and Extended Data Fig. 3b) and Xbp1^T-ΔIEC mice (Extended Data Fig. 3c). Consistent with PERK-eIF2α involvement in autophagy induction, ATF4, a transcriptional effector of this pathway, and its transcriptional target, C/EBP-homologous protein (CHOP; encoded by Ddit3), were increased in primary IECs of Xbp1^ΔIEC mice (Fig. 1g and Extended Data Fig. 3b), and chromatin-immunoprecipitation (ChIP) with anti-ATF4 demonstrated increased binding to the Map1lc3b (LC3b) (Fig. 1h) and Atg7 (Fig. 1i) promoters, both of which contain ATF4 binding sites¹³, in shXbp1 relative to shCtrl MODE-K cells. ATG7 is essential for the formation of the ATG12-ATG5 conjugate during autophagy^10,14. shXbp1 MODE-K cells exhibited increased LC3b and Atg7 expression compared to shCtrl MODE-K cells (Extended Data Fig. 3d), and Perk co-silencing abrogated ATG7 induction observed in shXbp1 compared to shCtrl MODE-K cells (Extended Data Fig. 3a). Salubrinal, a selective inhibitor of eIF2α dephosphorylation¹⁵ (Extended Data Fig.2a), increased the accumulation of GFP-LC3 punctae primarily in Paneth cells, in both Xbp1-sufficient and –deficient IECs (Fig. 1j and Extended Data Fig. 2b and 3e), and provoked increased levels of LC3-II relative to LC3-I (Extended Data Fig. 3f) and CHOP (Extended Data Fig. 3f) in Xbp1^T-ΔIEC mice, along with, importantly, an amelioration of the acute enteritis (Fig. 1k and Extended Data Fig. 3g). Similarly, silencing of growth arrest and DNA damage-inducible protein 34 (Gadd34; encoded by Ppp1r15a), part of the protein phosphatase 1 complex that dephosphorylates eIF2α¹⁶, led to increased eIF2α phosphorylation and ATG7 expression in shXbp1 compared to shCtrl MODE-K cells (Extended Data Fig. 3h, i). Xbp1^ΔIEC;Gadd34^+/− mice with hypomorphic GADD34 function exhibited increased p-eIF2α and ATG7 in purified crypt epithelial cells compared to Xbp1^ΔIEC;Gadd34^+/+ mice (Extended Data Fig. 3j). Thus, PERK-p-eIF2α is a critical mediator of UPR-induced autophagy primarily in Paneth cells consequent to XBP1-deficiency.

These studies let us hypothesize that autophagy may function as a compensatory mechanism in IECs upon sustained ER stress. We therefore generated V-Cre⁺;Atg7^fl/fl;Xbp1^fl/fl (‘Atg7/Xbp1^ΔIEC’) mice¹⁴. IECs from Atg7^ΔIEC mice lacked LC3-II formation and the ATG5-ATG12;ATG16L1 complex (Extended Data Fig. 4a). Atg7/Xbp1^ΔIEC mice demonstrated a complete absence of UPR-induced autophagy (Fig. 2a and Extended Data Fig. 4a-c), and a remarkable worsening of ileitis compared to Xbp1^ΔIEC mice. In notable contrast to Xbp1^ΔIEC mice, where inflammation was limited to the mucosa, >70% of Atg7/Xbp1^ΔIEC mice developed discontinuous submucosal or transmural inflammation, characterized by acute and chronic inflammation extending in an abrupt knife-like fashion to muscularis propria and serosa, closely resembling the early fissuring ulcerations and fistulous tracts observed in human CD (Fig. 2b, c and Extended Data Fig. 4d). In contrast to Xbp1^ΔIEC mice, enteritis in Atg7/Xbp1^ΔIEC mice progressed over the 18 week observation period such that at this time point all animals exhibited submucosal or transmural disease (Extended Data Fig. 4e, f).

Figure 2. Impairment of ER stress-induced compensatory autophagy results in severe transmural inflammation.

a, TEM of crypts of Lieberkühn (n=2). Bar, 2 μm. b, Representative H&E stainings. Note transmural inflammation extending through muscularis propria (white arrow) into serosa (black arrow) in Atg7/Xbp1^ΔIEC and Atg16l1/Xbp1^ΔIEC mice scored in (c) and (e). Bar, 50 and 10 μm, respectively. c, Enteritis histology score (n=26/12/18/27; 10-18 weeks; median shown; Kruskal-Wallis with post-hoc Holm’s-corrected Mann-Whitney U). d, Crypt TEM in indicated genotypes (n=2). Bar, 2 μm. e, Enteritis histology score (n=11; 18 weeks; median shown; Kruskal-Wallis with post-hoc Holm’s-corrected Mann-Whitney U). f, Xbp1 mRNA splicing (Xbp1u, unspliced; Xbp1s, spliced) of crypts, densitometry in (g) (n=7; unpaired Student’s t-test). h, GRP78 (green) immunofluorescence, white arrows indicate GRP78⁺ crypts (DAPI, blue; n=5). Bar, 10 μm. *P < 0.05, **P < 0.01, ***P < 0.001.

ATG16L1 is a major genetic risk factor for CD^1,17, especially ileal CD¹⁸. Complex formation of ATG16L1 protein with ATG12-ATG5 defines the site of LC3 PE conjugation during autophagosome formation^19,20. ATG16L1 protein expression was markedly increased in Xbp1^ΔIEC compared to Wt primary IECs (Fig. 1b and Extended Data Fig. 1j), presumably consequent to PERK/eIF2α/ATF4-dependent transactivation of Atg7 and LC3b promoters and stabilization by the ATG7-induced ATG12-ATG5 complex²¹. We therefore developed mice with a floxed Atg16l1 allele that would allow for IEC-specific deletion via V-Cre (‘Atg16l1^ΔIEC’; Extended Data Fig. 4g-i). Paneth cells in Atg16l1^ΔIEC mice demonstrated a reduction in their overall size and number of granules, similar to gene-trap-targeted Atg16l1^HM mice^2,3 (Extended Data Fig. 4j-n). IECs from Atg16l1^ΔIEC, compared to Wt mice, exhibited reduced expression of ATG7 and the ATG12-ATG5 conjugate (Extended Data Fig. 5a), along with disruption of the secretory pathway with a distended ER, reduced size and number of secretory granules, a loss of homeostatic autophagy (Fig. 2d and Extended Data Fig.5b, c) and increased p62 immunoreactivity in crypts (Extended Data Fig. 5d). To address the role of ATG16L1 under ER stress conditions, we generated V-Cre⁺;Atg16l1^fl/fl;Xbp1^fl/fl (‘Atg16l1/Xbp1^ΔIEC’) mice. Atg16l1/Xbp1^ΔIEC mice, which lacked UPR-induced autophagy (Extended Data Fig. 5b, c), developed severe spontaneous ileitis compared to Xbp1^ΔIEC or Atg16l1^ΔIEC mice, with discontinuous submucosal or transmural inflammation in >70% of 18-week old animals (Fig. 2b, e and Extended Data Fig. 5e, f) with features similar to those observed in Atg7/Xbp1^ΔIEC mice, and present in two distinct animal facilities (Fig. 2b, e and Extended Data Fig. 5g). This phenotype highlights the important compensatory role played by autophagy and in particular ATG16L1 in defending against inflammation arising from unabated ER stress precisely in the small intestinal epithelium as a consequence of XBP1-deficiency.

ATG7 hypofunction in hepatocytes can induce ER stress²², raising the possibility that cross-talk between the UPR and autophagy may be bi-directional in IECs. Isolated Atg16l1^ΔIEC crypts exhibited increased Xbp1 splicing compared to Wt (Fig. 2f, g) and increased grp78 expression (Extended Data Fig. 5h) localized to the crypt bottom (Fig. 2h). Dextran sodium sulfate, a colitis model involving ER stress in IECs that can be treated with ER stress-relieving chaperones^23,24, induced more inflammation in Atg16l1^ΔIEC compared to Wt mice (Extended Data Fig. 5i-l), similar to Atg16l1^HM mice³. Thus, disturbances in autophagy within IECs also affect the UPR, and autophagy-associated factors such as ATG16L1 endow IECs with the ability to mitigate ER stressors that are commonplace at the mucosal surface²⁵.

We next turned our attention to mechanisms by which autophagy counteracts ER stress and synergistic increase in intestinal inflammation when absent. Increased numbers of terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL)⁺ cells in Atg16l1/Xbp1^ΔIEC and Atg7/Xbp1^ΔIEC mice (Extended Data Fig. 6a, b) correlated with enteritis severity in double-mutant, in contrast to Xbp1^ΔIEC mice (Extended Data Fig. 6b), and, as demonstrated for Atg16l1/Xbp1^ΔIEC mice, concomitantly with increasing age (Extended Data Fig. 6c and Video 1). Silencing of Atg16l1 in shXbp1 MODE-K cells significantly increased the proportion of apoptotic cells in vitro (Fig. 3a and Extended Data Fig. 6d), indicating that increased apoptosis could function as an initial event in intestinal inflammation. Further, IEC-associated NFκB activation, a critical player in intestinal inflammation²⁶, was absent in primary IECs from Wt mice and gradually increased in Atg16l1^ΔIEC, Xbp1^ΔIEC, and Atg16l1/Xbp1^ΔIEC mice (Fig. 3b and Extended Data Fig. 6e, f). shXbp1 MODE-K cells exhibited increased NFκB activation when stimulated with tumor necrosis factor (TNF) (Fig. 3c and Extended Data Fig. 6g, h) or Toll-like receptor ligands (data not shown) relative to shCtrl MODE-K cells, demonstrating increased sensitivity of XBP1-deficient IECs to inflammatory and environmental stimuli. Inhibition of NFκB by treatment with BAY11-7082 decreased IEC death in Xbp1^T-ΔIEC mice (Fig. 3d and Extended Data Fig. 6i) and protected from enteritis in both Xbp1^T-ΔIEC and Xbp1^ΔIEC mice (Fig. 3e and Extended Data Fig. 6j) relative to vehicle treated mice. A progressive increase in IECs of total and phosphorylated IRE1α (encoded by Ern1), the sensor of ER stress upstream of XBP1 and known to control NFκB²⁷ was observed in Atg16l1^ΔIEC, Xbp1^ΔIEC and Atg16l1/Xbp1^ΔIEC in comparison to Wt mice (Fig. 3f) and mirrored the escalating elevations in NFκB (Fig. 3b and Extended Data Fig. 6e, f). Indeed, increased NFκB activity and ileitis were governed by IRE1α as the increased epithelial NFκB phosphorylation observed in Xbp1^ΔIEC mice was abrogated in Ern1/Xbp1^ΔIEC mice (Fig 3g), Ern1 co-silencing of shXbp1 MODE-K cells abolished increased expression of the NFκB target gene Nfkbia in response to TNF stimulation relative to shCtrl MODE-K cells (Extended Data Fig. 6k), and enteritis was diminished in Ern1/Xbp1^ΔIEC compared to Xbp1^ΔIEC mice (Fig. 3h). Enteritis was also reversed by germline deletion of Tnfrsf1a in Xbp1^ΔIEC mice (Fig. 3i), and re-derivation of Xbp1^ΔIEC mice into a germ-free environment (Fig. 3j), which was associated with reduced p-IκBα immunoreactivity in Xbp1-deficient IECs compared to mice housed under SPF conditions (Fig. 3k). These studies together demonstrate that enteritis in this model is driven by TNF, the cytokine targeted by the most potent therapeutics of human CD²⁵, and microbes in a pathway that derives from IEC death and IRE1α-dependent activation of NFκB with ATG16L1-dependent autophagy serving to restrain the inflammatory nature of the latter likely through its removal.

Figure 3. Autophagy restrains IRE1α-mediated NFκB activation in Xbp1-deficient epithelium.

a, shCtrl or shXbp1 MODE-K cells were co-silenced for Atg16l1 (siAtg16l1) or with scrambled siRNA (siCtrl), and analyzed by flow cytometry for annexin V and propidium iodide (PI; one-way ANOVA with post-hoc Bonferroni). b, Immunoblot of primary IEC scrapings (n=3). c, Immunoblot of cytoplasmic extracts from shCtrl or shXbp1 MODE-K cells after TNF stimulation. d, TUNEL⁺ IECs per 100 crypts after BAY11-7082 or vehicle treatment (n=3/4/4; one-way ANOVA with post-hoc Holm’s-corrected unpaired Student’s t-test). e, Enteritis histology score of mice treated with BAY11-7082 or vehicle (n=10/10/9; median shown; Kruskal-Wallis with post-hoc Holm’s-corrected Mann-Whitney U). f, Immunoblot of IEC scrapings for (p-)IRE1α after IRE1α immunoprecipitation (IP). β-actin, loading control of whole lysates. g, Immunoblot of primary IEC scrapings (n=4). h, i, Enteritis histology score of indicated genotypes (h, n=15/16/14/15; i, n=5/10/12; median shown; Kruskal-Wallis with post-hoc Holm’s-corrected Mann-Whitney U). j, Enteritis histology score of specific pathogen free (SPF) and germ free (GF) housed mice (n=10/9/7/7; median shown; Kruskal-Wallis with post-hoc Holm’s-corrected Mann-Whitney U). (k) Representative images of p-IκBα immunoreactivity under conditions as in (j) (n=4). Bar, 20 μm. Results represent four (f), three (c) or two (a, b) independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001.

Accordingly, treatment of Xbp1^T-ΔIEC mice with the mTOR inhibitor rapamycin¹⁰ induced autophagy primarily in crypts (Extended Data Fig. 7a, b), diminished IEC-associated NFκB activation and number of TUNEL⁺ IECs in Xbp1^ΔIEC mice (Fig. 4a and Extended Data Fig. 7c-e), and markedly reduced the severity of enteritis (Fig. 4b). These beneficial consequences of rapamycin in the setting of unabated ER stress in IECs were not observed in Atg7/Xbp1^ΔIEC and Atg16l1/Xbp1^ΔIEC mice (Extended Data Fig. 7e-i), demonstrating that these effects required intact autophagy within IECs.

Figure 4. ER stress-induced enteritis originates from Paneth cells and is alleviated through autophagy induction.

a, Immunoblot of primary IEC scrapings from mice treated with or without rapamycin for 14 consecutive days (n=3). b, Enteritis histology score for experiment as in (a) (n=4; median shown; Mann-Whitney U). c, Representative images of EYFP-Rosa26/D6-Cre^+/− reporter mice and EYFP-Rosa26 (controls). Co-localization of Defa6 Cre-driven EYFP expression (yellow) with lysozyme expressing Paneth cells (red; n=3). DAPI, blue; bar, 50 μm. d, Immunoblots of crypt IECs from Xbp1^ΔPC and Wt controls (n=2). e, f, Representative confocal images of lysozyme (green) expressing Paneth cells (e) with quantification of crypts with indicated number of lysozyme⁺ granulated dots in (f) (n=5; unpaired Student’s t-test). DAPI, blue; bar, 10 μm. g, Immunohistochemistry for p-eIF2α (n=3). Bar, 20 μm. h, Representative H&E images of Xbp1^ΔPC and Wt mice scored in (i). Bar, 50 μm. (i) Enteritis scoring in Xbp1^fl/fl (Wt^fl), Defa6 Cre⁺ (Wt^Cre) and Defa6 Cre⁺;Xbp1^fl/fl (Xbp1^ΔPC) mice (n=21/26/29; median shown; Kruskal-Wallis with post-hoc Holm’s-corrected Mann-Whitney U). Results represent two (b, d) independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001.

The spatial convergence of the consequences of hypomorphic UPR and autophagy function in Paneth cells prompted us to test the hypothesis that these pathways were interdependent in this cell type. We developed a defensin 6 alpha promoter²⁸-driven Cre transgenic line (D6-Cre), and confirmed the exclusive activity of Cre recombinase in lysozyme⁺ Paneth cells (Fig. 4c). Paneth cell-specific deletion of Xbp1 in D6-Cre;Xbp1^fl/fl (‘Xbp1^ΔPC’) mice resulted in autophagy activation (Fig. 4d and Extended Data Fig. 8a, b) and structural defects in granule morphology in Paneth cells (Fig. 4e, f). Crypts of Xbp1^ΔPC compared to Wt mice exhibited increased GRP78 expression (Fig. 4d and Extended Data Fig. 8b) and p-eIF2α immunoreactivity (Fig. 4g), accompanied by increased conversion of LC3-I/II and reduced p62 levels (Fig. 4d and Extended Data Fig. 8b), demonstrating ER stress and autophagy induction. Strikingly, 75% of these mice developed spontaneous enteritis (Fig. 4h, i) that shared the characteristics with Xbp1^ΔIEC mice (Fig. 2b). Xbp1^ΔPC mice exhibited increased cell death in crypts (Extended Data Fig. 9a, b) and IEC turnover (Extended Data Fig. 9c-f), while goblet cells remained unaffected (Extended Data Fig. 9g, h). Notably, Atg7/Xbp1^ΔPC mice exhibited transmural disease as early as 8 weeks of age (Extended Data Fig.9i). We conclude that deletion of Xbp1 specifically in Paneth cells results in unresolved ER stress, UPR activation and induction of autophagy which can serve as a nidus for the emergence of spontaneous intestinal inflammation that evolves into transmural disease in the absence of the compensation provided by autophagy.

Our studies thus support a mechanistic model (Extended Data Fig. 10a-c) for how ATG16L1-associated genetic risk may convert into a disease phenotype. The competence of the UPR likely sets the threshold for susceptibility of the host with hypofunctional autophagy to interacting genetic and environmental factors capable of inducing inflammation. Consistent with our model, patients with CD carrying the ATG16L1^T300A risk variant, which impairs autophagosome formation²⁹, frequently exhibit ER stress in their Paneth cells, in contrast to those harbouring the normal variant³⁰. Finally, our studies also unequivocally establish that these inflammatory susceptibilities can emerge directly from highly secretory Paneth cells and suggest that small intestinal CD may be a specific disorder of this cell type.

Methods

Mice

Xbp1^fl/fl mice were crossed with V-Cre-ER^T2+ (B6) mice kindly provided by Drs. Nicholas Davidson (Washington University, St. Louis) and Sylvie Robine (Institut Curie-CNRS, Paris) to generate mice with tamoxifen inducible Xbp1 deletion in the intestinal epithelium (‘Xbp1^T-ΔIEC’). V-Cre-ER^T2+ recombinase was activated by 3 or 5 daily intraperitoneal administrations of 1 mg tamoxifen (MP Biomedicals) as indicated in figure legends. V-Cre⁺;Xbp1^fl/fl (‘Xbp1^ΔIEC’) mice were crossed with Atg7^fl/fl mice¹⁴ kindly provided by Dr. Komatsu, Tokyo Metropolitan Institute of Medical Science, Tokyo, to obtain V-Cre⁺;Atg7^fl/fl;Xbp1^fl/fl (‘Atg7/Xbp1^ΔIEC’) mice. Mice with a floxed Atg16l1 allele were generated in collaboration with GenOway, France. Briefly, a proximal loxP site was introduced within the promoter region of Atg16l1 gene upstream of exon 1, a distal loxP site was introduced with an FRT flanked neomycin selection cassette within intron 1. The resultant mouse line was bred with deleter-mice constitutively expressing Flp-recombinase to remove the neomycin selection cassette, creating an Atg16l1^fl/+ mouse in which Atg16l1 exon 1 was flanked by two loxP sites (Extended Data Fig. S4g). After backcrossing onto B6, these mice were crossed with V-Cre⁺ mice³¹ resulting in V-Cre;Atg16l1^fl/fl mice with IEC-specific Atg16l1 deletion (‘Atg16l1^ΔIEC’). Atg16l1^fl/fl mice were crossed with Xbp1^ΔIEC mice to develop V-Cre⁺;Atg16l1^fl/fl;Xbp1^fl/fl (‘Atg16l1/Xbp1^ΔIEC’) mice. GFP-LC3 transgenic mice¹², generous gift of Dr. Mizushima, Tokyo Medical and Dental University, Tokyo, were crossed with V-Cre-ER^T2+;Xbp1^fl/fl to generate GFP-LC3;V-Cre-ER^T2+;Xbp1^fl/fl mice (‘GFP-LC3;Xbp1^T-ΔIEC’). For the generation of Paneth cell-specific Defa6-Cre;Xbp1^fl/fl mice, a 1.1 kb cDNA fragment encoding improved Cre (iCre)³² recombinase was subcloned downstream of nucleotides −6500 to +34 of mouse cryptdin-2 gene (Defa6) in the BamHI site of the pCR2-TAg-hGH plasmid^33,34 to replace the DNA fragment containing the simian virus 40 large antigen (SV40). A linearized 10.2 kb fragment containing the Defa6 promoter, iCre and hGH (Defa6-iCre-hGH) was removed by EcoRI digestion, agarose gel-electrophoresed and purified with QIAEX Gel Extraction Kit (Qiagen), and used for pronuclear injection of BL/6 mice. Six founders from 22 live born mice were identified by screening tail DNA using iCre-specific primers, and two lines were further characterized and crossed to Xbp1^fl/fl and EYFP-Rosa26 reporter mice³⁵, kindly provided by K. Rajewsky. Gadd34^−/− mice¹⁶ were crossed with V-Cre;Xbp1^fl/fl mice to generate V-Cre;Xbp1^fl/fl;Gadd34^+/− (‘Xbp1^ΔIEC;Gadd34^+/−’) mice. Ern1^{fl/f 36} and Tnfrsf1a^−/− (Jackson) mice were crossed with V-Cre;Xbp1^fl/fl mice to generate V-Cre;Ern1^fl/fl;Xbp1^fl/fl (‘Ern1/Xbp1^ΔIEC’) and V-Cre;Xbp1^fl/fl;Tnfrsf1a^−/− (‘Xbp1^ΔIEC;Tnfrsf1a^−/−’) mice, respectively. Cre transgenes were maintained in the hemizygous state in all experimental strains with a floxed allele to generate littermate controls. Xbp1^ΔIEC mice were re-derived in a germ-free environment and housed in sterile isolators at the Taconic Farms breeding facility (Germantown, NY, USA). Tail or ear biopsy genomic DNA was used for genotyping of respective mouse strains as described previously⁴. Primer sequences are available upon request. Mice were housed in specific pathogen free (SPF) barrier facilities at Harvard Medical School (Atg7/Xbp1^ΔIEC mice, Atg7/Xbp1^ΔPC, Xbp1^ΔPC, GFP-LC3;Xbp1^T-ΔIEC, Ern1/Xbp1^ΔIEC and their respective controls), University of Cambridge (Atg16l1/Xbp1^ΔIEC, Xbp1^ΔIEC/Gadd34^+/−, Ern1/Xbp1^ΔIEC mice and their respective controls), Innsbruck Medical University (Atg16l1/Xbp1^ΔIEC, Xbp1^ΔIEC;Tnfrsf1a^−/−, Xbp1^T-ΔIEC mice and their respective controls), and Christian-Albrechts-Universität zu Kiel (Atg16l1^ΔIEC mice and their respective controls). Colonies maintained at Boston and Innsbruck were murine norovirus (MNV) positive by Taqman qRT-PCR (Extended Data Fig. 9j). Xbp1^ΔIEC, Atg16l1^ΔIEC, Ern1^ΔIEC and their associated double-mutant strains were re-derived from the Innsbruck colony into the MNV-free enhanced barrier Cambridge facility, and colonies confirmed MNV-negative by PCR (Extended Data Fig. 9j) and serology (data not shown), as were Atg16l1^ΔIEC mice held at the Kiel facility. MNV Taqman qRT-PCR was performed as described³⁷. The phenotype of single- and double-mutant colonies that had been re-derived from the MNV⁺ Innsbruck facility into the MNV⁻ Cambridge facility were indistinguishable, in particular relating to qualitative and quantitative measures of enteritis and the reciprocal induction of autophagy and ER stress. Mice were handled and all experiments performed in accordance with institutional guidelines and with the approval of the relevant authorities. 8-10 week old mice were used for all experiments unless stated otherwise in the figure legend, and were randomly allocated into treatment groups.

Antibodies and reagents

The following antibodies and reagents were used for immunoblotting: Sigma Aldrich: anti-LC3B (L7543). Cell Signaling Technology: anti-β-actin (4970; 13E5) anti-GAPDH (2118; 14C10), anti-eIF2α (9722), anti-phospho-eIF2α (3597; 119A11), anti-PERK (3192; C33E10), anti-phospho-PERK (3179; 16F8), anti-JNK (9252), anti-phospho-JNK (4668; 81E11), anti-ATG5 (8540; D1G9), anti-Beclin-1 (3495; D40C5), anti-ATG7 (8558; D12B11), anti-CHOP (5554; D46F1), anti-ATG12 (4180; D88H11), anti-p62 (5114), anti-IKK1 (2682), anti-IKK2 (2370; 2C8), anti-phospho-IKK1/2 (2697; 16A6), anti-IRE1α (3294; 14C10), anti-phospho-NFκB p65 (33033; 93H1), anti-NFκB p65 (4764; C22B4) and anti-rabbit/mouse HRP antibodies (7074, 7076). Abcam: anti-phospho-IRE1α (48187). MBL: anti-ATG16L1 (M150-3; 1F12). Stressgen: anti-heme-oxygenase-1 (ADI-SPA-895). Novus Biologicals: anti-GRP78 (NBP1-06274). Santa Cruz Biotechnology: anti-ATF4 (sc-200; C20). Immunoprecipitation antibody: anti-IRE1α (Santa Cruz Biotechnology, 20790; H190). Immunohistochemistry antibodies: Santa Cruz Biotechnology: anti-Lysozyme (27958; C19), MBL: anti-ATG16L1 (M150-3; 1F12). Cell Signaling Technology: anti-ATG16L1 (8089; D6D5), anti-phospho-IκBα (2859; 14D4), anti-phospho-eIF2α (3597; 119A11). Abcam: anti-Ki67 (15580), anti-GRP78 (21685). Progen: anti-p62 (GP62-C). BD Bioscience: anti-BrdU (551321).

The following reagents were used: TNF (Peprotech, 315-01A), Bafilomycin A1 (Sigma Aldrich, B1793), rapamycin (LC Laboratories, R-5000), JNK inhibitor (Sigma Aldrich, SP600125), NFκB inhibitor (Calbiochem, BAY11-7082) and salubrinal (Alexis Biochemicals, ALX-270-428) were dissolved in DMSO as recommended. N-acetyl cysteine (Sigma Aldrich, A9165) and glutathione (Calbiochem, NOVG3541) were used at final concentration of 1mM. Ambion siRNA for Atg16l1 (94892, sense: GAACUGUUAGGGAAGAUCATT, antisense: UGAUCUUCCCUAACAGUUCCA), Perk (65405, sense: CCCGAUAUCUAACAGAUUUTT, antisense: AAAUCUGUUAGAUAUCGGGAT; 65406, sense: CGAAGAAUACAGUAAUGGUTT, antisense: ACCAUUACUGUAUUCUUCGTG), Gadd34 (70230, sense: CCAUAGCUCCGGGAUACAATT, antisense: UUGUAUCCCGGAGCUAUGGAA; 70231, sense: AGACAACAGCGAUUCGGAUTT, antisense: AUCCGAAUCGCUGUUGUCUTC), Ern1 (95857, sense: GUUUGACCCUGGACUCAAATT, antisense: UUUGAGUCCAGGGUCAAACTT; 95858, sense: GGAUGUAAGUGACCGAAUATT, antisense: UAUUCGGGUCACUUACAUCCTG; 95859, sense: GCUCGUGAAUUGAUAGAGATT, antisense: UCUCUAUCAAUUCACGAGCAA) and scrambled control were used at a final concentration of 10μM.

Chromatin Immunoprecipitation (ChIP)

ChIP with anti-ATF4 and control IgG rabbit antibody was performed in Xbp1 and control silenced MODE-K cells according to ChIP protocol by Agilent. To determine the presence of ATF4 binding sites in the Atg7 promoter, a 4-kb region proximal to transcription start site identified with the Eukaryotic Promoter Database Primers was analyzed using MatInspector (Genomatix). Immunoprecipitated DNA was subject to quantitative PCR (qPCR) to determine enrichment of ATF4 binding to respective promoters and results were normalized to input chromatin DNA. Primers used for qPCR were as follows for Map1LC3b¹³, for Atg7 F 5’-GCGCTTCCGCGTTTGTGTGG and R 5’CTGCTCCGCAACCACGGCTT.

Salubrinal, rapamycin and BAY11-7082 treatment in vivo

Salubrinal [1mg/kg/d], rapamycin [1.5mg/kg/d] or vehicle (DMSO) was administered intraperitoneally (i.p.) 24h prior to the first tamoxifen administration to GFP-LC3;V-CreER^T2;Xbp1^fl/fl (GFP-LC3;Wt) and GFP-LC3;Xbp1^T-ΔIEC mice. 3-day treatment was used for evaluation of accumulation of GFP-LC3 punctae in the intestinal epithelium, while a 5-day combined tamoxifen and salubrinal treatment followed by two daily salubrinal injections was used in experiments with enteritis assessment as an end point (Extended Data Fig. 2a and 3g). To assess the effects of rapamycin on ER stress-induced intestinal inflammation in XBP1 deficiency, V-Cre;Xbp1^fl/fl (Xbp1^ΔIEC), V-Cre;Atg16l1^fl/fl;Xbp1^fl/fl or V-Cre;Atg7^fl/fl;Xbp1^fl/fl and the respective control mice were treated with rapamycin or vehicle for 14 consecutive days i.p. and inflammation was evaluated. BAY11-7082³⁸ or vehicle (DMSO) was administered intraperitoneally (i.p.) every other day at 5mg/kg for 14 consecutive days in Xbp1^ΔIEC mice, or for 5 consecutive days at 20mg/kg in Xbp1^T-ΔIEC mice concomitant with i.p. tamoxifen.

Transmission electron microscopy

Small intestinal tissue from mice was handled by standard methods to be fixed with 1.25% glutaraldehyde, 4% formaldehyde in 0.1 M cacodylate buffer at pH 7.4 at room temperature for electron microscopy. The detailed procedures for electron microscopy was previously described³⁹ and the tissue was observed with a JEOL 1400 transmission electron microscope at 120 kV operating voltage. For quantification of autophagy, number of autophagic vacuoles was manually counted by TEM expert (J.H.) blinded to sample identity in 10 consecutive Paneth cells per sample. ImageJ software was used to measure average size of autophagic vacuoles.

Histology

Formalin-fixed and paraffin-embedded intestinal tissue was sectioned and stained with hematoxylin and eosin (H&E) as previously described⁴. A semi-quantitative composite scoring system was used for the assessment of spontaneous intestinal inflammation, computed as a sum of five histological subscores, multiplied by a factor based on the extent of the inflammation. Histological subscores (for each parameter: 0, absent; 1, mild; 2, moderate; 3, severe): mononuclear cell infiltrate (0-3), crypt hyperplasia (0-3), epithelial injury/erosion (0-3), polymorphonuclear cell infiltrates (0-3) and transmural inflammation (0, absent; 1, submucosal; 2, one focus extending into muscularis and serosa; 3 up to five foci extending into muscularis and serosa; 4, diffuse). Extent factor was derived according to the fraction of bowel length involved by inflammation: 1, < 10%, 2, 10-25%, 3, 25-50% and 4, >50%. Ileal inflammation was assessed by an expert gastrointestinal pathologist (J.N.G.) who was blinded to the genotype and experimental conditions of the samples. No spontaneous colonic inflammation was detected in any of the reported genotypes.

Reactive oxygen species (ROS), cell death detection by flow cytometry and NFκB activity assays

To evaluate oxidative stress, Xbp1- and control-silenced MODE-K cells⁴⁰ were incubated with 5 μM 5-(and-6)-chloromethyl-2’,7’-dichlorodihydrofluorescein diacetate, acetyl ester (CM-H2DCFDA) (Molecular Probes) for 30 min⁴¹. After washing with PBS, cells were further incubated with complete medium for 2 hours. ROS generation was determined using flow cytometry. To evaluate cell death, shXbp1 and shCtrl cells were co-silenced for Atg16l1 using siRNA or scrambled control (Ambion). After 4 days, cells were harvested and stained for Annexin V (Biolegend, UK) in staining buffer (Biolegend, UK) and mode of cell death was determined by flow cytometry after addition of propidium iodide (PI). To assess NFκB signaling pathway activation, Xbp1- or control-silenced MODE-K cells were stimulated with 50ng/ml TNF for indicated periods of time, followed by immunoblotting (using NE-PER [Thermo Scientific] isolated cytoplasmic extracts), qRT-PCR, and chemiluminescent detection of NFκB consensus sequence binding activity with the NFκB p65 transcription factor assay kit (Thermo Scientific). Ern1 or scrambled siRNA (Ambion) was used for co-silencing as indicated.

Immunohistochemistry, bromodeoxyuridine (BrdU) and terminal deoxinucleotidyl transferase (TUNEL) labeling

Formalin fixed paraffin embedded sections were stained according to standard immunohistochemistry protocols and manufacturer’s recommendations as described previously⁴. Cell death was assessed by TUNEL labeling of formalin fixed paraffin embedded slides of the respective genotypes using the TUNEL cell death detection kit (Roche). Entire slides were analyzed for TUNEL⁺ cells and numbers normalized to intestinal length on the slide. Proliferation of the intestinal epithelium was assessed after a 24h pulse with BrdU (BD Pharmingen) and incorporated BrdU was detected by the BrdU in situ detection kit (BD Pharmingen). BrdU⁺ nuclei per total IECs along the crypt villus axis are shown. Toluidine blue staining and Periodic acid-Schiff (PAS) reaction was performed according to standard protocols.

Confocal microscopy for detection of GFP-LC3 and EYFP

For detection of GFP-LC3 or EYFP, mice were euthanized, followed by transcardiac perfusion with PBS (2-3 minutes) and 3.7 % formaldehyde (3-4 minutes). Small intestine was dissected and promptly washed with PBS. The tissue was fixed in formalin for an additional 12-18 hours. Fixed tissue was embedded in OCT and sectioned on a cryotome into 5μm sections. Slides were washed with PBS and Prolong Gold Antifade reagent with DAPI (Invitrogen) with application of an attached coverglass. Images of the sections were collected using Olympus semi-confocal system. MetaMorph software was used for image analysis. For the detection of autophagosome formation in vitro, Xbp1 and control silenced MODE-K cells were transfected with a GFP-LC3 plasmid¹² (a kind gift of Dr. Noboru Mizushima, Tokyo Medical and Dental University) with use of Lipofectamine LTX (Invitrogen) following the manufacturer’s instructions. Accumulation of GFP-LC3 punctae or EYFP signal was assessed using LSM510 META Confocal Microscopy (Carl Zeiss).

Intestinal epithelial cell purification and crypt isolation

Mice were euthanized and the intestine was washed with ice-cold PBS after being cut open longitudinally. Peyer’s patches were removed and the intestine was cut into small pieces. Mucus was removed by shaking the intestine in 1x HBSS containing 1mM DTT for 10 min at RT. After washing with PBS, pieces were digested with Dispase (1U/ml in RPMI with 2% FCS) for 30 min at 37 degree with shaking (250 rpm). Cells were collected and debris removed with a 100μm cell strainer, and centrifuged for 5 min at 1500rpm. IECs were collected in the top layer after 40% - 100% Percoll gradient centrifugation. Purity of the population was determined by staining with anti-EpCAM antibody and flow cytometry analysis. IECs were lysed with RIPA buffer and equal amounts of protein were used for western blot analysis as indicated in figure legends. To isolate small intestinal crypts, the intestine was flushed, cut open longitudinally and incubated on ice for 30 minutes in 2mM EDTA/PBS. Two sedimentation steps and application of a cell strainer separated crypts from villi⁴², which were then used for RNA isolation (Qiagen), Xbp1 splicing assay, and for protein lysis with RIPA buffer and subsequent immunoblotting.

Intestinal epithelial scrapings

Mice were euthanized, intestines collected and longitudinally opened, and immediately washed with ice-cold PBS. Intestinal epithelium was collected by scraping with glass slides and snap frozen into liquid nitrogen for further analysis. For protein analysis, intestinal epithelial scrapings were homogenized in RIPA buffer using a 25G needle with a syringe. Lysates were cleared by centrifugation and aliquots of protein were used for protein assessment using standard western blot or immunoprecipitation protocols as indicated. Isolation of mRNA from intestinal epithelial scrapings or MODE-K lysates and RT-qPCR was performed as described⁴ using following pairs of primers. grp78 5-ACTTGGGGACCACCTATTCCT and 5-ATCGCCAATCAGACGCTCC; Gadd34 5-CCCGAGATTCCTCTAAAAGC and 5-CCAGACAGCAAGGAAATGG; LC3b 5-GCGCCATGCCGTCCGAGAAG and 5-GCTCCCGGATGAGCCGGACA; Xbp1 5-ACACGCTTGGGAATGGACAC and 5-CCATGGGAAGATGTTCTGGG; Atg7 5-CCTTCGCGGACCTAAAGAAGT and 5-CCCGGATTAGAGGGATGCTC; Nfkbia 5-TGAAGGACGAGGAGTACGAGC and 5-TTCGTGGATGATTGCCAAGTG.

Dextran Sodium Sulfate induced colitis

Acute colitis was induced by adding 4% DSS (TdB Consultancy) to drinking water ad libitum for 5 consecutive days. Daily disease activity index (DAI) was assessed evaluating weight loss, stool consistency and rectal bleeding according to Table S1. A high resolution mouse endoscopic system (Hopkins, Germany) was used. Colitis severity was assessed by a semiquantitative score consisting of two subscores;endoscopic tissue damage (0-3, where 0 - no damage, 1 – lymphoepithelial lesions, 2- surface mucosal erosion or focal ulceration and 3 - extensive mucosal damage with expansion into deeper structures of the bowel wall) and inflammatory infiltration (0-3, where 0 – occasional inflammatory cells in the lamina propria, 1 – increased numbers on inflammatory cells in lamina propria, 2 – confluence of inflammatory cells extending into the submucosa and 3 – transmural extension of the infiltrate).

Xbp1 splicing assay and densitometric quantification

Xbp1 splicing was assessed as described⁴. Briefly, RNA was isolated, reverse transcribed and amplified by RT-PCR with the following primers: Xbp1 sp F: ACACGCTTGGGAATGGACAC; Xbp1 sp R: CCATGGGAAGATGTTCTGGG. The PCR product of 171 (unspliced) and 145 (spliced) bp were resolved on a 2% agarose gel. Densitometric analysis for splicing assay and immunoblots was performed with ImageJ.

Statistical methods

Statistical significance was calculated as appropriate using an unpaired two-tailed Student’s t-test or a Mann-Whitney U test and considered significant at p < 0.05. In experiments where more than two groups were compared, Kruskal-Wallis test followed by Mann-Whitney U and post-hoc Bonferroni Holm’s correction or one-way ANOVA/Bonferroni was performed. Grubb’s test was used as appropriate to identify outliers. Data was analyzed using GraphPad Prism software. Experimental group sizes were based upon the goal of achieving desired effect sizes typically of ≤2.0 standard deviations and a power of 0.9 on the assumption of a normal distribution, and therefore typically involved n=6-10.

Supplementary Material

1. Extended Data Figure 1. Autophagy induction in Xbp1-deficient IECs.

a, Xbp1 expression in shCtrl and shXbp1 MODE-K cells (n=7/6; unpaired Student’s t-test). b, c, Immunoblot of shCtrl and shXbp1 MODE-K cells. d, Immunoblot after autophagosome-lysosome fusion inhibition via bafilomycin in silenced MODE-K IECs. e, Silenced MODE-K IECs after GFP-LC3 reporter transfection (bar, 5μm) with green punctae per cell quantification in (f; n=14; unpaired Student’s t-test). g, TEM of shCtrl and shXbp1 cells. Note double-membraned structure with engulfed contents characteristic of autophagosomes (white arrows; n=10). Bar, 0.5 μm. h, Quantification of occupied area and average size of autophagic vacuoles from (g) (n=10; unpaired Student’s t-test). i, j, Densitometry of Fig. 1a (i; n=5/4; unpaired Student’s t-test) and Fig. 1b (j; n=3; unpaired Student’s t-test). k, Low magnification (1380×, original magnification here and in the remainder of this legend) TEM image of Paneth cells from Wt mice (1), demonstrating the abundant endoplasmic reticulum (ER) and characteristic secretory granules at the apical, lumenally (‘L’) oriented side. (2) Higher magnification (5520×) of inset ‘2’ in (1) demonstrating typical secretory granules in Paneth cells from Wt mice. (3) High magnification (20700×) of inset ‘3’ in (1) illustrating a double membrane structure characteristic of an autophagosome (white arrow) in close proximity to the ER and a mitochondrion. (4) Low magnification (2160×) TEM image of Paneth cell remnants present in Xbp1^ΔIEC small intestinal crypts, which lack expansion of the ER and exhibit only minuscule granule remnants. (5) Higher magnification (9000×) of inset ‘5’ in (4), demonstrating degradative autophagic vacuoles (black arrows), in close proximity to mitochondria, and the virtual absence of ER membranes. (6) High-power (14400×) magnification of inset ‘6’ in (4), illustrating a double-membrane structure (white arrow) characteristic of autophagosomes, and a degradative autophagic vacuole (black arrow). L, lumen; M, mitochondrion; ER, endoplasmic reticulum; N nucleus; as indicated, bar represents 2μm, 0.5μm and 200nm, respectively. Results represent three (b, c) or two (d, k) independent experiments. *P< 0.05, ***P< 0.001.

10. Extended Data Figure 10. Model of the interplay between UPR-induced autophagy, NFκB signaling and inflammation.

a, Deletion of Xbp1 in the intestinal epithelium, specifically in Paneth cells, leads to ER stress and activation of the PERK/eIF2α branch of the UPR. ATF4, a transcriptional mediator of this pathway, transactivates genes essential for autophagosome formation, such as Map1lc3b (LC3b) and Atg7 which catalyzes the creation of the ATG12-ATG5 conjugate that stabilizes ATG16L1 through complex formation²¹. UPR-induced autophagy in the intestinal epithelium is essential for restoration of homeostasis and restraint of ER-stress induced intestinal inflammation due to XBP1-deficiency. Activation of the UPR in the setting of XBP1-deficiency results in activation of IRE1α, resulting in the recruitment of TRAF2 and activation of IKK2 leading to IκBα degradation ^4,27,45,46. As shown here, UPR-mediated autophagy however serves an important role in restraining NFκB activation, conceivably by removing hyperinflammatory ER membranes containing activated IRE1α. Pharmacological augmentation of this compensatory autophagy-dependent mechanism via inhibition of eIF2α dephosphorylation through salubrinal, or via the mTOR inhibitor rapamycin results in amelioration of UPR-induced enteritis, which is driven by the commensal microbiota, NFκB, and TNF-RI signaling in IECs and myeloid cells, whereby the ligand TNF can originate from XBP1- deficient IECs⁴. b, ATG16L1-deficiency in IECs leads to ER stress as revealed through upregulation of the chaperone GRP78 in IECs, increased expression of GRP78 protein in Paneth cells, increased IRE1α expression and increased splicing of Xbp1 mRNA in intestinal crypts as well as increased IEC death. This leads to increased sensitivity of the epithelium to environmental triggers (e.g. dextran sodium sulfate) that further challenge the UPR and its compensatory pathways. c, Deficiency of ATG16L1 or ATG7 in the intestinal epithelium results in abrogation of the compensatory autophagic mechanism that restrains IRE1α activity, conceivably via removal of hyperinflammatory ER membranes, and further fosters IEC death in the context of ER stress due to Xbp1 deficiency, resulting in spontaneous transmural small intestinal inflammation that is associated with further increases in NFκB activation and cell death via the mechanisms described in (a). The UPR allows for responses to a variety of signals that impact on protein folding, including genetic (e.g. rare XBP1 variants, ORMDL3 as risk factor of IBD^4,47), environmental (e.g. low O₂ tension in the intestinal tract) and microbial factors (e.g. microbial toxins such as trierixin⁴⁸) which determines the level of ER stress in the intestinal epithelium. UPR-induced autophagy function provides a buffer to cope with different levels of ER stress and vice-versa. However, in the presence of genetic risk variants, such as ATG16L1^17,49,50 or IRGM⁵¹, which are relatively prevalent in the general population, this compensatory mechanism is impaired, resulting in development and/or exacerbation of intestinal inflammation in the setting of unabated ER stress.

2. Extended Data Figure 2. Autophagy in Xbp1-deficient IECs is induced by eIF2α phosphorylation but independent of JNK or oxidative stress pathways.

a, Timeline for salubrinal experiment shown in Fig. 1j. b, Representative indirect immunofluorescence images of GFP-LC3 punctae accumulation (green) in small intestinal sections co-stained with antilysozyme antibody (red) treated as in (a) (n=3). DAPI, blue. Bar, 10 μm. c, Immunoblot of crypt lysates after 3 days of tamoxifen or vehicle administration (n=3). d, e, Immunoblot of primary IEC scrapings (d), densitometry in (e) (n=3; unpaired Student’s t-test). f, g, Immunoblot of shXbp1 and shCtrl MODE-K cells. ER stress-induced Jun N-terminal kinase-1 (JNK1) has previously been connected in other cellular model systems to autophagy activation through phosphorylation of B cell leukemia 2 (Bcl-2) and its dissociation from Beclin-1⁴³, as have oxidative stress/free radicals and heme oxygenase-1 (HO-1) activation⁴⁴. h, Intracellular reactive oxygen species (ROS) determined by dichlorofluorescein assay and mean fluorescent intensity (MFI) after vehicle or dichlorofluorescein diacetate (DCF-DA) treatment. i, Immunoblot of shXbp1 and shCtrl MODE-K cells after administration of the JNK inhibitor SP600125 (0, 5 or 25 μM) for 4h. Note the absence of an effect of SP600125 treatment on the conversion of LC3-I to LC3-II or the levels of p-eIF2α, thereby excluding a major contribution of the JNK pathway to autophagy induction in the presence of IEC-associated XBP1-deficiency. j, Immunoblot of shXbp1 and shCtrl MODE-K cells after N-acetylcysteine (NAC), glutathione (GSH) or vehicle for 16h. Note the absence of an effect of the free radical scavengers on either of these markers of UPR-induced autophagy (LC3-II or p-eIF2α). Results represent three (f-j) independent experiments. *P < 0.05.

3. Extended Data Figure 3. ER-stress induced activation of PERK/eIF2α induces autophagy in Xbp1-deficiency.

a, Immunoblot of shXbp1 and shCtrl MODE-K cells co-silenced with Perk (siPerk) or scrambled siRNA. b, Cumulative densitometry of the immunoblot in Fig. 1g and two additional experiments (not shown, n=10; unpaired Student’s t-test). c, p-eIF2α immunohistochemistry of small intestinal epithelium. Bar, 50 μm. d, mRNA expression levels of Map1lc3b (LC3b) and Atg7 relative to Gapdh in shCtrl and shXbp1 MODE-K cells (n=3; unpaired Student’s t-test). e, Accumulation of GFP-LC3 punctae after salubrinal and 3-day tamoxifen treatment according to timeline in Extended Data Fig. 2a (n=5). Bar, 5 μm. f, Immunoblot of primary epithelial scrapings from small intestine upon vehicle or salubrinal (Salu) treatment according to the timeline (g) (n=2). Note the increased relative levels of LC3 conversion and CHOP, a transcriptional target of ATF4, in salubrinal treated mice. g, Timeline of salubrinal experiment. Results are reported in (f) and Fig. 1k. h, Gadd34 expression in shCtrl and shXbp1 MODE-K cells co-silenced for Gadd34 (siGadd34) and control (siCtr) (one-way ANOVA with post-hoc Holm’s corrected unpaired Student’s t-test). i, Cells as in (h) were immunoblotted. j, Immunoblot of crypt lysates (n=2/4/2). Results represent three (a, h, i) independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001.

4. Extended Data Figure 4. Absence of Atg7 in intestinal epithelium disrupts autophagy and exacerbates spontaneous enteritis of Xbp1-deficiency and development of conditional Atg16l1 knockout mouse.

a, Immunoblot of primary IEC scrapings (n=4/3/3/3). Note the loss of ATG5, 12 and 16 proteins in ATG7-deficient mice. b, Representative high magnification TEM images (n=2). Note intact ER in Wt mice; severe distortion of ER in Atg7^ΔIEC mice; autophagic vacuoles with the characteristic double membrane (white arrow) in Xbp1^ΔIEC mice; and the absence of ER and autophagic vacuoles in Atg7/Xbp1^ΔIEC mice. Bar, 200nm. ER, endoplasmic reticulum. c, Quantification of autophagic vacuoles (n=10; unpaired Student’s t-test). d, High magnification (400x) H&E images. Note knifelike extension of inflammation along blood vessels through whole thickness of muscularis propria into the serosa in the Atg7/Xbp1^ΔIEC mice. Bar, 10 μm. e, Linear regression analysis for the correlation of inflammation with age. Each dot represents a single animal. (R² and P value for deviation from 0 are shown). f, Deep inflammation score (as described in materials and methods) in Atg7/Xbp1^ΔIEC mice plotted at indicated ages in weeks. (n=13/17/9; Kruskal-Wallis with post-hoc Holm’s-corrected Mann-Whitney U). g, Atg16l1 IEC specific knockout design. Exon 1 of Atg16l1 gene was flanked by two loxP sites and Atg16l1 deletion was mediated by Cre recombinase (Cre) under the control of Villin (V-) promoter (V-Cre⁺;Atg16l1^fl/fl or ‘Atg16l1^ΔIEC’). Detailed description in the methods section. h, Immunohistochemical staining (brown) with anti-ATG16L1 antibody (MBL) (n=2). Note cytoplasmic IEC specific ATG16L1 immunostaining in Wt but not Atg16l1^ΔIEC mice with retained ATG16L1 expression in lamina propria mononuclear cells in Atg16l1^ΔIEC mice. Bar, 50μm. i, Indirect immunofluorescence microscopy (green) with anti-ATG16L1 antibody (Cell Signaling Technology) (n=2). Note the similar staining pattern as in (h) with cytoplasmic IEC-specific ATG16L1 immunoreactivity in Wt but not Atg16l1^ΔIEC mice and retained ATG16L1 expression in lamina propria mononuclear cells in Atg16l1^ΔIEC mice. Dashed line denotes crypt unit. Bar, 20μm. j, Schematic representation of lysozyme⁺ granule allocation patterns (green): normal (D0), disordered (D1), depleted (D2), and diffuse (D3)². k, l, Lysozyme immunofluorescence (green) in crypts of Atg16l1^ΔIEC and Wt mice (k), quantified in (l; n=3; unpaired Student’s t-test) according to granule allocation patterns shown in (j). Dashed line denotes crypt unit. DAPI, blue. Bar, 5μm. m, n, Quantification of Paneth cells based on the number of granular vesicles stained with Toluidine blue (m) as shown in (n) (n=4; unpaired Student’s t-test). Bar, 5μm. *P< 0.05, **P< 0.01, ***P< 0.001.

5. Extended Data Figure 5. Atg16l1 IEC-specific deletion abrogates UPR-induced autophagy and exacerbates ER-stress induced spontaneous intestinal inflammation due to Xbp1-deficiency.

a, Immunoblot of primary IEC scrapings. Note identical GAPDH loading control as in figure 3b (n=3). b, Representative high magnification TEM images (n=2). Note intact ER in Wt mice; severe distortion of ER in Atg16l1^ΔIEC mice; autophagic vacuoles with the characteristic double membrane (arrow) in Xbp1^ΔIEC mice; and absence of ER and autophagic vacuoles in Atg16l1/Xbp1^ΔIEC mice. Bar, 200 nm. ER, endoplasmic reticulum. c, Quantification of autophagic vacuoles (n=10 unpaired Student’s t-test). d, Representative images of p62 immunostaining on small intestinal sections (n=3). Brown staining indicates p62 with maximal signal intensity in the region of Paneth cells. Bar, 20 μm. e, High resolution H&E images. Note the extension of the inflammation into muscularis propria (arrow) in Atg16l1/Xbp1^ΔIEC mice. Bar, 20μm. f, Deep inflammation score (as described in materials and methods) in mice assessed at 18 weeks of age (n=11; Kruskal-Wallis with post-hoc Dunn’s correction). g, Enteritis histology score (n=14; 7-10 weeks old mice housed in Innsbruck; median shown; Kruskal-Wallis with post-hoc Holm’s-corrected Mann-Whitney U). h, qRT-PCR of grp78 in primary IEC scrapings (n=7; unpaired Student’s t-test). i, Disease activity index during DSS colitis (n=7/4, two-way ANOVA with post-hoc Bonferroni). j, Representative endoscopic images from the colon at day 5 of DSS treatment (n=3). k, Representative H&E staining of colonic sections from 5-day DSS- treated and untreated mice (n=7/4). Bar, 50μm. l, Colitis score after 5 days of DSS administration (n=7/4, Mann-Whitney U). *P < 0.05, **P < 0.01, ***P < 0.001.

6. Extended Data Figure 6. ER stress-induced enteritis of Xbp1-deficiency exacerbated by autophagy impairment correlates with age and cell death in IECs and is dependent on IRE1α-mediated NFκB activation.

a, Representative images of TUNEL labeled intestinal epithelium (brown) (n=7). Bar, 50 μm. b, Correlation of TUNEL⁺ cells with the severity of inflammation. Linear regression analysis of Atg16l1/Xbp1^ΔIEC (left) and Atg7/Xbp1^ΔIEC (right) with significant R² and P value for deviation from zero shown (left panel: n=5/5/7/7; right panel: n=5). c, Linear least square regression analysis for the correlation of enteritis histology score with cell death and age of animals by genotype. Each dot represents a single animal (grey, Wt; yellow, Atg16l1^ΔIEC; blue, Xbp1^ΔIEC; red, Atg16l1/Xbp1^ΔIEC mice) and the plane represents the linear regression for the enteritis histology score as a function of age and TUNEL labeling for Atg16l1/Xbp1^ΔIEC mice (n=6/13/12/12). Note that the severity of inflammation significantly correlates with numbers of TUNEL⁺ IECs and age only in Atg16l1/Xbp1^ΔIEC mice (R²=0.602, p=0.016). The three-dimensional (3D) plot is also available online in video-format. Regression analysis was performed using the R package lessR (http://cran.r-project.org/web/packages/lessR/index.html), last accessed May 2013. d, shCtrl or shXbp1 MODE-K cells were co-silenced for Atg16l1 (siAtg16l1) or with scrambled siRNA (siCtrl), and analyzed by flow cytometry for Annexin V and propidium iodide (PI) uptake (one-way ANOVA with post-hoc Bonferroni). e, Densitometry of the immunoblot shown in Fig. 3b (n=3; one-way ANOVA with post-hoc Holm’s corrected unpaired Student’s t-test). f, Immunohistochemical staining for p-IκBα in the small intestinal epithelium (n=3). Bar, 20 μm. g, NFκB consensus sequence binding assay after stimulation of shCtrl and shXbp1 MODE-K cells for 5 and 20 minutes with indicated concentrations of TNF. h, Nfkbia expression, a prototypic NFκB-transactivated gene, after TNF stimulation of shCtrl and shXbp1 MODE-K cells. i, Representative images of TUNEL labeled sections after administration of BAY11-7082 or vehicle (n=3/4/4). Bar, 50 μm. j, Enteritis histology score of mice treated with the NFκB inhibitor BAY11-7082 or vehicle (n=7/9/8; median shown; Kruskal-Wallis with post-hoc Holm’s-corrected Mann-Whitney U). k, Expression of Nfκbia in Ern1- and control-silenced shXbp1 and control MODE-K cells after TNF stimulation. Results represent three (h, k) or two (d, g) independent experiments. *P< 0.05, **P< 0.01, ***P<0.001.

7. Extended Data Figure 7. Rapamycin induces autophagy in Paneth cells, reduces the severity of enteritis and the number of TUNEL⁺ IECs in Xbp1^ΔIEC, but not in Atg7/Xbp1^ΔIEC or Atg16l1/Xbp1^ΔIEC mice.

a, b, Quantification of GFP-LC3 punctae accumulation after 3-day tamoxifen treatment and induction by rapamycin (a; n=10; one-way ANOVA with post-hoc Bonferroni) and representative images in (b; n=3). Bar, 5 μm. c, Densitometry of the immunoblot in Fig. 4a (n=3; one-way ANOVA with post-hoc Holm’s-corrected unpaired Student’s t-test). d, Quantification of TUNEL⁺ IECs per cm of gut in mice treated with rapamycin or vehicle (n=5; unpaired Student’s t-test). e, Representative images of TUNEL labeled sections from rapamycin or vehicle treated Wt, Atg16l1^ΔIEC, Xbp1^ΔIEC, Atg16l1/Xbp1^ΔIEC mice or Wt, Atg7^ΔIEC, Xbp1^ΔIEC, Atg7/Xbp1^ΔIEC mice. Bar, 50 μm. f, g, Quantification of TUNEL labeling in Wt, Atg16l1^ΔIEC, Atg16l1/Xbp1^ΔIEC mice (f; n=4/4/5/5/5/5) or Wt, Atg7^ΔIEC, Atg7/Xbp1^ΔIEC mice (g; n=5; one-way ANOVA with post-hoc Holm’s-corrected unpaired Student’s t-test). h, i, Enteritis histology scores of rapamycin or vehicle treated mice of respective genotypes (h; n=8/9/6/9/12/13) (i; n=8/7/6/7/7/6) (median shown; Kruskal-Wallis with post-hoc Holm’s-corrected Mann-Whitney U). *P < 0.05, **P < 0.01, ***P < 0.001.

8. Extended Data Figure 8. Autophagy induction in Paneth cells of Xbp1^ΔPC mice.

a, Representative TEM images of small intestinal crypts from Defa6Cre⁺ (Wt) and Defa6Cre⁺;Xbp1^fl/fl (Xbp1^ΔPC) mice. (1) Low magnification TEM image of Paneth cells at the base of a small intestinal crypt in Wt mice, demonstrating abundant ER and characteristic secretory granules at the apical, lumenally oriented side. Bar, 5 μm. (2) Higher magnification of inset ‘2’ in (1) with numerous secretory granules. Bar, 1μm. (3) High magnification of inset ‘3’ in (1) with intact ER. Bar, 200 nm. (4) Low magnification TEM image of Paneth cells in an Xbp1^ΔPC small intestinal crypt. Note the reduced number of secretory granules, the exfoliating hypomorphic Paneth cell into crypt lumen (‘E’, black dashed outline) and a transmigrating polymorphonuclear cell through the mucosa (white dashed outline). Bar, 5μm. (5) Higher magnification of inset ‘5’ in (4), demonstrating abnormalities in secretory granule maturation with numerous hypodense granules (*) and a distorted ER. Note the accumulation of electron dense cargo indicative of degradative autophagic vacuoles (black arrow) in close proximity to the nucleus. Bar, 1μm. (6) High magnification of the inset ‘6’ in (4), demonstrating degradative autophagic vacuoles filled with electron dense material (black arrow). Note the double membrane structures characteristic for autophagosomes (white arrow heads). Bar, 200 nm. (7) Low magnification TEM image of Paneth cells in an Xbp1^ΔPC small intestinal crypt. Note the disorganized ER, hypodense secretory granules (*), empty area after exfoliation of a Paneth cell into the crypt lumen (‘E’, black dashed outline) similar to image (4). (8) High magnification of inset ‘8’ identified in (7), demonstrating an autophagic vacuole (black arrow) surrounded by a markedly distorted ER. Bar, 200 nm. (9) High magnification of the inset ‘9’ in (7), with additional examples of degradative autophagic vacuoles accompanied by a distorted ER. Representative of 2 independent experiments. Bar, 200 nm. L, lumen; M, mitochondrion; ER, endoplasmic reticulum; N nucleus. b, Densitometry of the immunoblot in Fig. 4d (n=2; unpaired Student’s t-test). *P< 0.05.

9. Extended Data Figure 9. Phenotypic consequences of Xbp1 deletion in Paneth cells and characterization of murine norovirus status.

a, b, TUNEL labeled ileal sections (a) with quantification of TUNEL⁺ cells per cm gut shown in (b; n=7/11; unpaired Student’s t-test). Bar, 50 μm. c, d, Ki67 immunohistochemical staining of ileal sections (c) with quantification of Ki67⁺ cells per total IEC count along the crypt-villus axis shown in (d; n=5; unpaired Student’s t-test). Bar, 20 μm. e, f, Bromodeoxyuridine (BrdU) labeled ileal sections (e) after a 24h with quantification of BrdU⁺ cells per total IEC count along the crypt-villus axis in (f; n=5/3; unpaired Student’s t-test). Bar, 50μm. g, h, Periodic acid-Schiff (PAS)-stained ileal sections (g) with quantification of PAS⁺ cells per total IEC count along the crypt-villus axis shown in (h; n=5; unpaired Student’s t-test). Bar, 50μm. i, Enteritis histology score of indicated genotypes (n=3; median shown; Kruskal-Wallis). j, Taqman qRT-PCR for MNV of fecal samples in three different animal facilities (n=3). Note detectable MNV genome copy numbers in Boston (Atg7/Xbp1^ΔIEC, Fig. 2c) and Innsbruck (Atg16l1/Xbp1^ΔIEC, Extended Data Fig. 5g) colonies, and absence of MNV after re-derivation of colonies into the MNV-free Cambridge facility (Atg16l1/Xbp1^ΔIEC, Fig 2e), yet similar levels of enteritis in Xbp1^ΔIEC and Atg16l1/Xbp1^ΔIEC mice maintained in Innsbruck (MNV⁺) and Cambridge (MNV⁻) (Fig. 2b, e and Extended Data Fig. 5g) and relatively more severe disease in Xbp1^ΔIEC mice from Boston (Fig. 2c). Sentinel mice from the Cambridge colony also tested negative for MNV by serological analysis (data not shown). These observations suggest that the inflammatory phenotypes observed are not necessarily dependent upon MNV. *P < 0.05.