Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Oct 1.
Published in final edited form as: Br J Dermatol. 2013 Oct;169(4):10.1111/bjd.12418. doi: 10.1111/bjd.12418

Distribution of MC1R variants among melanoma subtypes: p.R163Q is associated with Lentigo Maligna Melanoma in a Mediterranean population

JA Puig-Butillé 1,2, C Carrera 1,3, R Kumar 4, Z Garcia-Casado 5, C Badenas 1,2, P Aguilera 1,3, J Malvehy 1,3, E Nagore 6, S Puig 1,3
PMCID: PMC3863403  NIHMSID: NIHMS476552  PMID: 23647022

Abstract

Background

Cutaneous melanoma tumour is classified into clinico-histopathological subtypes which may be associated with different genetic and host factors. Variation in the MC1R gene is one of the main factors of risk variation in sporadic melanoma. The relationship between MC1R variants and the risk of developing a specific subtype of melanoma has not been previously explored.

Objective

to analyze whether certain MC1R variants are associated with particular melanoma subtypes with specific clinico-histopathological features.

Methods

An association study between MC1R gene variants and clinico-pathological subtypes of primary melanoma derived from 1679 patients was performed.

Results

We detected 53 MC1R variants (11 synonymous and 43 non-synonymous). Recurrent non-synonymous variants were p.V60L (29.9%), p.V92M (11.7%), p.D294H (9.4%), p.R151C (8.8%), p.R160W (6.2%), p.R163Q (4.2%) p.R142H (3.3%), p.I155T (3.8%), p.V122M (1.5%) and p.D84E (1%). Melanoma subtypes showed differences in total number of MC1R variants (P-value=0.028) and number of Red hair colour variants (P-value=0.035). Furthermore, an association between the p.R163Q variant and lentigo maligna melanoma subtype was detected under a dominant model of heritance (OR: 2.16 95% CI: 1.07–4.37; P-value=0.044). No association was found between p.R163Q and skin Fitzpatrick’s phototype, eye colour or skin colour indicating that the association was independent of the role of MC1R in pigmentation. No association was observed between MC1R polymorphisms and other melanoma subtypes.

Conclusion

Our findings suggest that certain MC1R variants could increase melanoma risk due to their impact on pathways other than pigmentation and therefore be linked to specific melanoma subtypes.

INTRODUCTION

Cutaneous melanoma (MM) has been classically classified into distinct subtypes based on histological appearance, biological behaviour and epidemiological features1, 2. Later on, this classification lost relevance because there was often a significant overlap between types and as it lacked prognostic value. Nevertheless, some of these variants show characteristic clinical features and may be associated with different risk factors. Differences according to anatomical location of primary tumour, UV pattern of exposure and somatic genetic alterations have also been identified3,4. Overall, superficial spreading melanomas (SSM) develop mostly on trunk and extremities associated with acute-intermittent sun-exposure patterns. In contrast, lentigo malignant melanomas (LMM) usually originate on the face or chronically exposed areas. The incidence of both subtypes of melanoma increase continuously over time in populations from European origin5. Acral lentiginous melanomas (ALM), located on palms, soles, and subungual sites are not associated with sun exposure, its incidence being similar in dark and fair skin populations. The epidemiology of nodular melanomas (NM) is not clearly associated with sun exposure maintaining a stable incidence and mortality6. These associations may explain the epidemiological differences detected in different populations/studies. Whilst in most studies intermittent/recreational sun exposure and sunburns are consistently associated with melanoma risk (probably associated with SSM), in a few studies melanoma is also associated with occupational sun exposure, cumulative lifetime sun exposure or markers of such an exposure7,8. This risk seems to be mostly associated with LMM as, in areas with high levels of sun exposure, LMM becomes the more frequent subtype of melanoma5.

Risk factors for melanoma development also include genetic and host characteristics such as fair skin, family history of melanoma, eye and hair pigmentation9–11.

The pigmentation-related melanocortin receptor 1 (MC1R), which is the major contributor to pigmentation diversity in humans, is also a risk factor for melanoma12. The gene is highly polymorphic, with more than 100 variants, many being non synonymous13. A meta-analysis identified five MC1R variants (p.D84E, p.R142H, p.R151C, p.R160W, p.D294H) associated with the red hair colour phenotype (R) which is characterized by fair pigmentation (fair skin, red hair and freckles), and by sun sensitivity (poor tanning response and solar lentigines)14. Functional studies have revealed the complexity of MC1R genomic variation. Allelic variants show differences in loss of function among R and non-red hair colour variants (r)13. Furthermore, distribution of the allelic frequency of recurrent variants differs significantly across populations. Such differences are not only exclusively detected when comparing dark versus fair-pigmented populations. Allelic frequencies of p.V60L and p.D294H variants are different even when comparing different dark-pigmented populations15.

Few studies have focused on the role of MC1R variants in melanoma beyond the study of melanoma risk in individuals. An association between germline MC1R status and presence of somatic BRAF mutation in melanoma was found16, 17. However, these findings have not been confirmed by other studies18–20, illustrating the complexity of cross-talk between MC1R variants, UV exposure pattern, melanoma subtype and somatic alterations which can be over-represented in certain combinations.

The aim of this study was to analyze whether some MC1R variants are associated to particular clinico-histopathological melanoma subtype.

MATERIAL AND METHODS

Samples

An observational retrospective study including a series of 1679 melanoma patients from two hospital-based series was designed. Inclusion criteria were patients with confirmed histopathological information of the tumour. In the patients with multiple primary melanomas (MPM), only patients with histopathological subtype information for all tumours and information available on the time of occurrence for each were included. All patients were treated and controlled at the Melanoma Unit in the Hospital Clinic of Barcelona (Barcelona, Spain) and in the Instituto Valenciano de Oncologia (Valencia, Spain).

The study of MC1R variants was approved by the institutional review board of both Hospitals and informed consent from all study participants was obtained.

The outcome variable of the study was the histopathological melanoma subtype. For the purpose of the study only the following subtypes were considered: lentigo maligna melanoma (LMM), superficial spreading melanoma (SSM), nodular melanoma (NM) and acral lentiginous melanoma (ALM). Patients with other unknown or unclassified tumours were excluded from the study.

In the analysis of MC1R variants and histopathological subtypes, the MPM patients were included only once in each analysis: a) in the analysis of the total number and type of variants, patients were included based on the histopathological subtype of the first developed melanoma; b) in the analyses of each of the 10 more frequent variants and melanoma subtype (LMM, SSM or NM), MPM patients were re-classified according to whether they had had, or not, the specific melanoma subtype at any time. Such a strategy avoids the inclusion of the same patient more than once in the analysis (consequently we did not increase the frequency of MC1R variants).

As potential confounders, the following variables were considered: sex information, age of onset, hair colour (red, blonde or brown/black), skin phototype according to the classification by Fitzpatrick (I–II vs. III–V)21 and eye colour (dark/brown vs. green/blue).

MC1R molecular screening

Samples from Melanoma unit-Hospital Clinic of Barcelona were amplified using primers described by Chaudru et al.22. PCRs conditions were: initial denaturizing step at 95°C for 5 min, followed by 35 cycles (95°C for 1 min, 55°C for 1 min, 72°C for 1 min), and a final extension at 72°C for 10 min and maintaining at 4°C. Specific internal MC1R primers were designed to analyze the entire coding sequence (INT-F: TACATCTCCATCTTCTACGC and INT-R: GTGCTGAAGACGACACTG). Samples from Instituto Valenciano de Oncologia-Valencia were genotyped as described in Scherer D et al.23.

Statistical analysis

MC1R variants were classified as red hair colour (R) or non-red hair colour (r) according to previously reported criteria14. Therefore, MC1R variants classified as R were p.D84E, p.R142H, p.R151C, p.R160W and p.D294H. All other non-synonymous MC1R variants were classified as r. Synonymous variants were considered as wild-type MC1R alleles. For the purpose of this study, only variants with an observed frequency of at least 1% were analysed. In-silico analysis of each variant to predict the effect of the amino acid change in both protein structure and MC1R function was carried out using PolyPhen-2 version 2.2.224. Correlation between the number of MC1R variants and confounding variables was calculated by cross-tabulations and Pearson’s χ2 using IBM SPSS Statistics 20. Genetic data was analyzed using SNPStats software25. Multiple logistic regression models [Codominant, Dominant, Recessive, Overdominant and log-additive] were performed for odds ratio (OR), 95% confidence interval (CI), and P-value. Both Akaike information (AIC) and Bayesian Information Criterion (BIC) were used to choose the model of inheritance that best fit the data. In some analyses, the model was adjusted by confounding variables that are associated with the MC1R variant of interest. P-values less than 0.05 were considered as statistically significant. All tests were two-sided and Bonferroni correction for multiple comparisons was applied in all P-values.

RESULTS

MC1R genotyping was carried out in 1679 patients that met the selection criteria, 1428 (85%) were single primary (SPM) cases and 251 (15%) were MPM cases (mean number of tumours=2.34). The SPM subgroup included 979 SSM patients (68.6%), 249 NM patients (17.4%), 118 LMM patients (8.3%) and 82 ALM patients (5.7%).

The MPM subset included 198 (78.9%) patients who developed 2 MMs, 36 (14.3%) patients who developed 3 MMs and 8 (3.2%) and 9 (3.6%) patients who developed 4 and ≥5 MMs, respectively. MPM patients displayed a total of 588 MMs, 83.5% of them were SSM (491/588), 8.2% of them were LMM (48/588), 6.8% of them were NM (40/588,) and 1.5% of them ALM (9/588,). The frequencies for each subtype in the subset of first MMs in MPM patients (N=251; LMM 6.8%, SSM 82.9%, NM 8.3% and ALM 2%) were statistically not different to those observed in the subset of subsequent MMs diagnosed in MPM patients (N=337; LMM 9.2%, SSM 84%, NM 5.6% and ALM 1.4%).

The rate of the histopathology subtype concordance was evaluated in MPM patients. The rate of concordance was 85.5% in SSM patients (178/208), 35.3% in LMM patients (6/17) and 4.8% in NM patients (1/21). No patients with a firstly ALM (5) develop other ALMs.

The study identified 53 MC1R variants (11 synonymous and 43 non-synonymous) most being detected in a small number of patients or restricted to one (Table 1). Thirteen MC1R variants had not been identified in previous studies. Among synonymous variants, the highest frequency was observed for p.T314T (17.6% of patients). Recurrent non-synonymous variants in the set of 1679 melanoma patients with a frequency of at least a frequency of 1% were p.V60L (29.9%), p.V92M (11.7%), p.D294H (9.4%), p.R151C (8.8%), p.R160W (6.2%), p.R163Q (4.2%) p.R142H (3.3%), p.I155T (3.8%), p.V122M (1.5%) and p.D84E (1%). Analyses of MC1R variants and phenotypical features and histopathological subtype of tumour were carried out only in those 10 variants.

Table 1.

Frequency of MC1R variants detected in Melanoma patients.

Total patients (N=1679)
Nucleotide change AA change Score Polyphen2A Genomic status N (%)
c.5C>T p.A2V 0.000 Het. 1 (0.1)
Hom. -
c.112G>A p.V38M 0.006 Het. 1 (0.1)
Hom. -
c.121T> p.S41C 0.067 Het. 1 (0.1)
Hom. -
c.175C>T p.V59M 1.00 Het. 1 (0.1)
Hom. -
c.178T>G p.V60L 0.988 Het. 459 (27.3)
Hom. 44 (2.6)
c.190G>A p.A64T 0.988 Het. 1 (0.1)
Hom. -
c.248C>T p.S83L 0.998 Het. 3 (0.2)
Hom. -
c.247T>C p.S83P 0.998 Het. 5 (0.3)
Hom. -
c.252C>A p.D84ERHC 0.999 Het. 17 (1.0)
Hom. -
c.251C>C p.D84H 1.00 Het. 4 (0.2)
Hom. -
c.265G>A p.G89R 0.737 Het. 1 (0.1)
Hom. -
c.274G>A p.V92M 0.015 Het. 195 (11.6)
Hom. 2 (0.1)
c.284C>T p.T95M 0.889 Het. 3 (0.2)
Hom. -
c.357C>A p.V119V - Het. 2 (0.1)
Hom. -
c.364G>A p.V122M 0.126 Het. 25 (1.5)
Hom. -
c.383T4C p.M128T 0.235 Het. 3 (0.2)
Hom. -
c.425G>A p.R142HRHC 1.000 Het. 54 (3.2)
Hom. 1 (0.1)
c.424C>A p.R142S 1.000 Het. 1 (0.1)
Hom. -
c.424C>T p.R142C 1.000 Het. 1 (0.1)
Hom. -
c.434C>T p.S145F 0.989 Het. 1 (0.1)
Hom. -
c.438C>T p.A146A - Het. 1 (0.1)
Hom. -
c.445G>A p.A149T 1.000 Het. 2 (0.1)
Hom. -
c.446C>T p.A149V 1.00 Het. 1 (0.1)
Hom. -
c.451C>T p.R151CRHC 1.000 Het. 139 (8.3)
Hom. 9 (0.5)
c.464T>C p.I155T 0.986 Het. 60 (3.6)
Hom. 4 (0.2)
c.466C>G p.V156L 0.567 Het. 1 (0.1)
Hom. 0 (0)
c.467T>C p.V156A 0.784 Het. 1 (0.1)
Hom. -
c.478C>T p.R160WRHC 0.861 Het. 103 (6.1)
Hom. 1 (0.1)
c.488G>A p.R163Q 0.004 Het. 69 (4.1)
Hom. 1 (0.1)
c.504C>T p.I168I - Het. 5 (0.3)
Hom. -
c.546C>T p.Y182Y - Het. 2 (0.1)
Hom. -
c.550G>A p.D184N 0.001 Het. 1 (0.1)
Hom. -
c.586T>C p.F196L 0.997 Het. 1 (0.1)
Hom. -
c.637C>T p.R213W 0.019 Het. 1 (0.1)
Hom. -
c.699G>A p.Q233Q - Het. 30 (1.8)
Hom. -
c.741G>A p.L247L - Het. 1 (0.1)
Hom. -
c.766C>T p.P256S 1.000 Het. 1 (0.1)
Hom. -
c.788T>C p.L263P 1.00 Het. 1 (0.1)
Hom. -
c.792C>T p.I264I - Het. 1 (0.1)
Hom. -
c.793G>A p.V265I 0.067 Het. 1 (0.1)
Hom. -
c.813C>T p.P271P - Het. 1 (0.1)
Hom. -
c.814A>G p.T272A 0.006 Het. 2 (0.1)
Hom. -
c.815C>T p.T272M 0.974 Het. 1(0.1)
Hom. -
c.815C>A p.T272K 0.944 Het. 2 (0.1)
Hom. -
c.835A>G p.N279D 0.979 Het. 1 (0.1)
Hom. -
c.850C>T p.L284F 0.965 Het. 1 (0.1)
Hom. -
g.860T>G p.I287S 0.996 het. 1 (0.1)
hom. -
c.861C>G p.I287M 0.999 het. 1 (0.1)
hom. -
g.880G>C p.D294HRHC 1.000 het. 151 (9.0)
hom. 7 (0.4)
c.892 C>T p.R298R het. 1 (0.1)
hom. -
c.923C>T p.T308M 0.979 het. 1 (0.1)
hom. -
g.942A>G p.T314T - het. 287 (17.1)
hom. 8 (0.5)
g.948C>T p.S316S - het. 2 (0.1)
hom. -

Novel variants are indicated in bold.

A

In-silico impact prediction of each non-synonymous variants on the structure and MC1R function (values close to 0.000: benign; values close to 1.00: damaging).

RHC

Variant associated to Red hair colour phenotype. Het: variant in heterozygosis. Hom: Variant in homozygosis.

Overall, skin phototype information was available in 94.8% of cases, eyes and hair colour in 90.5% and 93.4%, respectively. The p.R142H, p.R151C, p.R160W and p.D294H variants were statistically significant associated to red hair colour and fair skin (phototype I or II) under a co-dominant model of heritance (Table 2). The association of MC1R variants and eye colour was restricted to p.R142H which was associated to fair eye colour (green or blue) under a dominant model of heritance (OR= 2.07: 95%CI=1.18-3-65; p=0.011).

Table 2.

Analysis of MC1R and phenotypical traits.

A. Association of recurrent MC1R with phenotypical traitsB
Hair colour Brown/Black Red
MC1R Variant Genotype N (%) N (%) OR ( 95% CI)A P-value
p.R142H
G/G 1168 (97.9) 58 (78.4) 1.00
G/A 25 (2.1) 15 (20.3) 12.40 (6.18–24.89) <0.0001C
A/A 0 (0) 1 (1.4) NA
p.R151C
C/C 1118 (93.7) 41 (55.4) 1.00
C/T 75 (6.3) 28 (37.8) 10.27 (6.01–17.56) <0.0001C
T/T 0 (0) 5 (6.8) NA
p.R160W
C/C 1132 (94.9) 58 (78.4) 1.00
C/T 61 (5.1) 16 (21.6) 5.2 (2.7–9.4) <0.0001C
T/T 0 (0) 0 (0) NA
p.D294H
G/G 1102 (92.4) 43 (58.1) 1.00
G/C 91 (7.6) 25 (33.8) 6.96 (4.06–11.93) <0.0001C
C/C 0 (0) 6 (8.1) NA
Skin phototype III–IV I–II
 MC1R Variant Genotype N (%) N (%) OR ( 95% CI)A P-value
p.R142H
G/G 930 (97.6) 608 (95.3) 1.00
G/A 23 (2.4) 29 (4.5) 1.95 (1.12–3.41) 0.027C
A/A 0 (0) 1 (0.2) NA
p.R151C
C/C 897 (94.1) 552 (86.5) 1.00
C/T 55 (5.8) 79 (12.4) 2.36 (1.65–3.39) <0.0001C
T/T 1 (0.1) 7 (1.1) 10.71 (1.31–87.42)
p.R160W
C/C 906 (95.1) 584 (91.5) 1.00
C/T 47 (4.9) 53 (8.3) 1.73 (1.15–2.60) 0.0018C
T/T 0 (0) 1 (0.2) NA
p.D294H
G/G 883 (92.7) 553 (86.7) 1.00
G/C 70 (7.3) 78 (12.2) 1.76 (1.25–2.48) <0.0001C
C/C 0 (0) 7 (1.1) NA
  Eye colour Dark Green/Blue
 MC1R Variant Genotype N (%) N (%) OR ( 95% CI)A P-value
p.R142H
G/G 896 (97.6) 571 (95.2) 1.00
G/A-A/A 22 (2.4) 29 (4.8) 2.07 (1.18-3-65) 0.011D
B. Association of number of MC1R variants with phenotypical traits
Total number of variants
0 Var (%)X 1 Var (%)X ≥2 Var (%)X TOTAL (%) P-value
Hair colour
 black/brown 565 (47.4) 439 (36.8) 189 (15.8) 1193 (100)
 red 4 (5.4) 12 (16.2) 58 (78.4) 74 (100) <0.0000
Total number of variants
0 Var (%)X 1 Var (%)X ≥2 Var (%)X TOTAL (%)
Photoype
 I–II 219 (34.3) 235 (36.8) 184 (28.8) 638 (100)
 III–IV 472 (49.5) 338 (35.5) 143 (15.0) 953 (100) <0.0000
Eye colour
 fair 268 (44.7) 207 (34.5) 125 (20.8) 600 (100)
 dark 392 (42.7) 336 (36.6) 190 (20.7) 918 (100) n.s
Number of non Red hair colour ( r ) variants
0 Var (%)X 1 Var (%)X ≥2 Var (%)X TOTAL (%) P-value
Hair colour
 black/brown 716 (60) 392 (32.9) 85 (7.1) 1193 (100)
 red 53 (71.6) 19 (25.7) 2 (2.7) 74 (100) n.s
Photoype
 I–II 354 (55.5) 231 (36.2) 53 (8.3) 638 (100)
 III–IV 596 (62.5) 293 (30.7) 64 (6.7) 953 (100) 0.041
Eye colour
 fair 361 (60.2) 199 (33.2) 40 (6.7) 600 (100)
 dark 544 (59.3) 299 (32.6) 75 (8.2) 918 (100) n.s
Number of Red hair colour ( R ) variants
0 Var (%)X 1 Var (%)X ≥2 Var (%)X TOTAL (%) P-value
Hair colour
 black/brown 939 (78.7) 249 (20.9) 5 (0.4) 1193 (100)
 red 8 (10.8) 26 (35.1) 40 (54.1) 74 (100) <0.0000
Photoype
 I–II 417 (65.4) 174 (27.3) 47 (7.4) 638 (100)
 III–IV 756 (79.3) 188 (19.7) 9 (0.9) 953 (100) <0.0000
Eye colour
 fair 442 (73.7) 137 (22.8) 21 (3.5) 600 (100)
 dark 680 (74.1) 205 (22.3) 33 (3.6) 918 (100) n.s
B

Analysis was performed for each recurrent variant (p.V60L, p.V92M, p.D294H, p.R151C, p.R160W, p.R163Q, p.R142H, p.I155T, p.V122M and p.D84E): Only MC1R variants with statistically significant P-values are shown.

A

ORs are adjusted by age of onset, gender and hospital of recruitment. Model of heritance was chosen according to the AIC and BIC values:

C

:Codominant model;

D

:Dominant model.

X

Number and frequency of patients. NA: not analyzed. n.s: P-values not statistically significant

Differences in terms of number and type of MC1R variant (r or R) were analyzed. Skin phototype and hair colour showed differences in the total number of variants (P-value<0.001). When the analysis was focused on the number of r variants, there was no statistically significant association with phenotypic characteristics. However, a trend was observed between fair skin and presence of ≥2 variants (p =0.041). In contrast, number of R variants was associated to both hair colour and skin phototype (P-value<0.001). Overall, 89.2% of red hair patients carried at least one R variant and 54.1% of them carried ≥2 R variants.

According to the number of MC1R variants and histopathological melanoma subtype (Table 3) differences were observed in total number of MC1R variants (P-value =0.028), mainly due to the low frequency of MC1R variants in patients with ALM subtype. Also, differences in number of R variants was observed (P-value=0.035), showing a lower number of variants in both ALM and NM subtypes.

Table 3.

Number of variants and histopathological subtype of melanoma.

Analysis was performed separately by MM patient subtype. In the MPM subgroup only the first tumours were included in the analysis.

Total MC1R Variants
0 (%) 1 (%) ≥2 (%) Total (%) P-value
LMM 57 (41.9) 53 (39.0) 26 (19.1) 136 (100) 0.028
SSM 503 (42.4) 433 (35.5) 251(21.1) 1187 (100) n.s.
NM 122 (45.4) 96 (35.7) 51 (19) 269 (100) n.s.
ALM 54 (62.1) 23 (26.4) 10 (11.5) 87 (100) n.s.

Number or non Red hair colour variants
0 (%) 1 (%) ≥2 (%) Total (%) P-value

LMM 82 (60.3) 47 (34.6) 7 (5.1) 136 (100) 0.382
SSM 698 (58.8) 401 (33.8) 88 (7.4) 1187 (100) n.s.
NM 163 (60.0) 87 (32.3) 19(7.1) 269 (100) n.s.
ALM 61 (70.1) 19 (21.8) 7 (8.0) 87 (100) n.s.

Number Red hair colour variants
0 (%) 1 (%) ≥2 (%) Total (%) P-value

LMM 98 (72.1) 32 (23.5) 6 (.4.4) 136 (100) 0.035
SSM 875 (73.7) 264 (22.2) 48 (4.0) 1187 (100) n.s.
NM 199 (74.0) 67 (24.9) 3 (1.1) 269 (100) n.s.
ALM 75 (86.2) 11 (12.6) 1 (1.1) 87(100) n.s.

LMM: Lentigo maligna melanoma, SSM: Superficial spreading melanoma, NM: Nodular melanoma, ALM: Acral lentiginous melanoma.

n.s. not significant

Association of histopathological subtype and specific recurrent MC1R variant was restricted to those subtypes associated with a sun exposure pattern (SSM, LMM and NM). Logistic regression model was adjusted by number of primary tumours, sex, age of onset and phenotypical characteristics. No statistical significant association was found between certain MC1R variants and SSM or NM. In contrast, an association was detected between the p.R163Q variant and LMM development under a dominant model of heritance (OR: 2.16 95%CI: 1.07–4.37; P-value=0.044) (Table 4).

Table 4.

Association of p.R163Q and Lentigo Maligna Melanoma tumours (LMM).

MC1R Variant Genotype No LMM LMM
p.R163Q N (%)1 N (%)2 OR ( 95% CI)A P-value
G/G 1466 (96.1) 143 (92.9) 1.00
G/A-A/A 59 (3.9) 11 (7.1) 2.16 (1.07–4.37) 0.044 D
1

Number of patients who did not develop any LMM.

2

Number of patients who develop at least one tumour classified as LMM.

A

ORs Adjusted by age of onset, gender, number of MM, number of MC1R variants, skin phototype, hair colour and Hospital of recruitment. Model of heritance was chosen according the AIC and BIC values:

D

Dominant model.

DISCUSSION

Since Clark et al. classified melanomas into three distinct subtypes2 and thereafter, a fourth subgroup was proposed26, several studies have elucidated epidemiological and clinical features which are more associated with a particular histopathological subtype27–30. Some of these differences can be attributed to variation of UV exposure (chronic sun exposition or intermittent)4.

To date, polymorphisms in the MC1R gene are major determinants of hair and skin colour31. Furthermore, MC1R polymorphisms play a role in sun sensitivity and low tanning ability in response to UV radiation independently of skin colour32. Thus, certain MC1R variants could be related to particular histopathological group of melanomas associated to different patterns of UV radiation.

In the present study, the genomic status of MC1R gene from 1679 melanoma patients was analyzed according to their histopathological melanoma subtypes. In the study, patients with multiple primary melanomas were also included as different melanomas from the same patient may be considered as independent occurrences of the disease33. In the association studies for number of variants just the histopathological classification of the first melanoma was considered. When evaluating the association of each subtype with each prevalent MC1R variant, MPM patients were categorized according to whether they had had, or not, at least one tumour of the specified subtypes at any time (i.e., if a patient had developed two LMMs, in the LMM analysis the patient was recorded once). The systematic exclusion of 15% of patients with MPM in genetic studies could occult important data concerning differences in genetic background, more present in MPM patients compared to SPM, such as the occurrence of dysplastic nevi or UV exposure34, 35.

Analysis of MC1R variants and phenotypical characteristics was carried out to find previous well-established associations14 and to consider them in the posterior analysis. Variants p.R142H, p.R151C, R160W and p.D294H variants associated with red hair and fair skin. The p.R142H variant was also associated with patients with green/blue eyes. Previous studies have found no effect of MC1R genotype on eye colour. However, an epistatic interaction between MC1R and the OCA2 gene, which is a significant determinant of eye colour, has been postulated36, 37. Our study adds further evidence to the modifier effect of MC1R alleles on eye colour.

In the present study, the total number of MC1R variants and number of RHC variants were higher in both LMM and SMM subtypes. An increased prevalence of MC1R variants in tumours on intermittently exposed sites has been frequently observed. Unfortunately, the MC1R distribution according to anatomic site was not addressed in our study.

The most relevant finding was the association between p.R163Q and LMM; independent of phenotype features (it was not associated with Fitzpatrick skin photoype, eye or hair colour) which suggests that certain variants could be linked to specific melanoma subtypes. Different functional influence among MC1R variants has been shown in terms of cell surface expression, functional ability or dominant negative activity of pigment related pathway13, 38–40.

In addition to adenylate cyclase signalling, stimulation of MC1R also activates the mitogen-activated protein kinase (MAPK) pathway41 and regulates target genes involved in inflammation through the NF-Kb pathway42. Thus, interpretation of the effect of MC1R alleles in melanoma beyond its role in pigmentation, such as the relation between p.R163Q and LMM subtype, is complex. Furthermore, differences in frequency and type of variants between populations could result in variations in genotype-phenotype correlation23. The frequency of the p.R163Q variant is highly variable among populations, being higher in Asian compared to European origin populations, but also there are differences among European populations15. In the Japanese population, p.R163Q and p.V92M have been related to skin lesions associated with UV damage such as freckles and solar lentigines43. Previous studies have suggested a relation between these variants and chronic UV radiation in populations of European origin. The p.V92M variant has been associated with severe photoaging of facial skin, independent of the presence of other minor and major variants, in European women44. Furthermore, variant p.R163Q has been related to non-melanoma skin cancer development in Europeans, underlying its possible role in tumours related to chronic sun exposure45. Thus, our finding that p.R163Q is related to LMM susceptibility in our population may be a consequence of the role of this variant in skin photodamage and photoaging since a propensity to solar lentigines is a strong predictor of LMM and it is not associated to another subtype of melanoma46. Interestingly, both p.R163Q and V92M presented a benign score in the in-silico analysis (Table 1) and are considered “pseudo-alleles” with no significant effect on eumelanin synthesis47. Thus, the biological relevance of these variants could be related with a non canonical MC1R pathway. Although, variant p.R163Q does not display changes in either surface expression or cAMP signalling, a selective decrease in MAPK activation has been recently described48. Thus, the cross-talk between specific MC1R variants and MAPK pathway activation could be responsible in part for the differing results reported for correlation between MC1R and mutant BRAF in melanoma16–20. Furthermore, the majority of studies have been conducted using a pigment related classification of MC1R variants and mostly without histopathological information of the tumour subtype. As a previous study suggested49, our data supports that these differences could be due to unique effects of specific MC1R variants, the frequencies of which differ somewhat among populations.

In conclusion, the MC1R variant p.R163Q showed differences among histopathological melanoma subtypes, showing a positive association with LMM. Moreover, these findings suggest that differences exist beyond the role of MC1R variants in the pigment synthesis process. Thus, common variants could be responsible in part for the risk of LMM in non-fair skin population. Further studies should be directed to elucidate the mechanisms by which MC1R variants play a role in susceptibility to melanoma independent to its relationship with phenotypic traits.

Supplementary Material

Supp Material S1

What’s already known about this topic?

  • The MC1R gene plays a role in pigmentation synthesis, in inflammatory process and activates the mitogen-activated protein kinase pathway.

  • MC1R variants associated with pigmentation increase the risk of developing melanoma and non melanoma skin cancer.

  • The p.R163Q variant, not associated with pigmentation, is associated with non melanoma skin cancer in Europeans.

What does this study add?

  • The p.R163Q variant which is not directly associated to phenotype variation is associated for the first time with the risk of developing lentigo maligna melanoma.

Acknowledgments

Funding /Support: The research at the Melanoma Unit in Barcelona was partially funded by Grants 03/0019, 05/0302 06/0265 and 09/01393 from Fondo de Investigaciones Sanitarias, Spain; by the CIBER de Enfermedades Raras of the Instituto de Salud Carlos III, Spain; by the AGAUR 2009 SGR 1337 of the Catalan Government, Spain; by the European Commission under the 6th Framework Programme, Contract nr: LSHC-CT-2006-018702 (GenoMEL) and by the National Cancer Institute (NCI) of the US National Institute of Health (NIH) (CA83115). The work was carried out at the Esther Koplowitz Centre, Barcelona (Spain). The samples from the Instituto Valenciano de Oncología were collected from the Biobanco del Instituto Valenciano de Oncología.

This work is dedicated to all our patients and their families who have always collaborated with us and who are the aim of our work. We are indebted to our colleagues, to our nurses Pablo Iglesias, Daniel Gabriel and Mª Eugenia Moliner and our technicians Estefania Martinez and Laura Martín, who work together on a daily basis and whose effort is not always reflected in investigative papers. We also thank Helena Kruyer for her help with the text edition.

Footnotes

Conflict of interest: The authors state no conflict of interest.

Contributor Information

J.A. Puig-Butillé, Email: jantonpuig@gmail.com.

C. Carrera, Email: criscarrer@yahoo.es.

R. Kumar, Email: r.kumar@dkfz-heidelberg.de.

Z. Garcia-Casado, Email: zaida.garcia@hotmail.com.

C. Badenas, Email: cbadenas@clinic.ub.es.

P. Aguilera, Email: aguilisha@hotmail.com.

J. Malvehy, Email: jmalvehy@clinic.ub.es.

E. Nagore, Email: eduyame@meditex.es.

S. Puig, Email: susipuig@gmail.com, spuig@clinic.ub.es.

References

  • 1.Marks R. Epidemiology of melanoma. Clin Exp Dermatol. 2000;25:459–63. doi: 10.1046/j.1365-2230.2000.00693.x. [DOI] [PubMed] [Google Scholar]
  • 2.Clark WH, Jr, From L, Bernardino EA, Mihm MC. The histogenesis and biologic behavior of primary human malignant melanomas of the skin. Cancer Res. 1969;29:705–27. [PubMed] [Google Scholar]
  • 3.Elwood JM, Hislop TG. Solar radiation in the etiology of cutaneous malignant melanoma in Caucasians. Natl Cancer Inst Monogr. 1982;62:167–71. [PubMed] [Google Scholar]
  • 4.Holman CD, Armstrong BK. Cutaneous malignant melanoma and indicators of total accumulated exposure to the sun: an analysis separating histogenetic types. J Natl Cancer Inst. 1984;73:75–82. [PubMed] [Google Scholar]
  • 5.Forman SB, Ferringer TC, Peckham SJ, Dalton SR, Sasaki GT, Libow LF, Elston DM. Is superficial spreading melanoma still the most common form of malignant melanoma? J Am Acad Dermatol. 2008;58:1013–20. doi: 10.1016/j.jaad.2007.10.650. [DOI] [PubMed] [Google Scholar]
  • 6.Shaikh WR, Xiong M, Weinstock MA. The contribution of nodular subtype to melanoma mortality in the United States, 1978 to 2007. Arch Dermatol. 2011;148:30–6. doi: 10.1001/archdermatol.2011.264. [DOI] [PubMed] [Google Scholar]
  • 7.Rodenas JM, Delgado-Rodriguez M, Herranz MT, Tercedor J, Serrano S. Sun exposure, pigmentary traits, and risk of cutaneous malignant melanoma: a case-control study in a Mediterranean population. Cancer Causes Control. 1996;7:275–83. doi: 10.1007/BF00051303. [DOI] [PubMed] [Google Scholar]
  • 8.Ballester I, Oliver V, Banuls J, Moragon M, Valcuende F, Botella-Estrada R, Nagore E. Multicenter Case-Control Study of Risk Factors for Cutaneous Melanoma in Valencia, Spain. Actas Dermosifiliogr. 2012 doi: 10.1016/j.ad.2012.01.014. [DOI] [PubMed] [Google Scholar]
  • 9.Tucker MA, Goldstein AM. Melanoma etiology: where are we? Oncogene. 2003;22:3042–52. doi: 10.1038/sj.onc.1206444. [DOI] [PubMed] [Google Scholar]
  • 10.Gandini S, Sera F, Cattaruzza MS, Pasquini P, Picconi O, Boyle P, Melchi CF. Meta-analysis of risk factors for cutaneous melanoma: II. Sun exposure. Eur J Cancer. 2005;41:45–60. doi: 10.1016/j.ejca.2004.10.016. [DOI] [PubMed] [Google Scholar]
  • 11.Gandini S, Sera F, Cattaruzza MS, Pasquini P, Zanetti R, Masini C, Boyle P, Melchi CF. Meta-analysis of risk factors for cutaneous melanoma: III. Family history, actinic damage and phenotypic factors. Eur J Cancer. 2005;41:2040–59. doi: 10.1016/j.ejca.2005.03.034. [DOI] [PubMed] [Google Scholar]
  • 12.Rees JL. Genetics of hair and skin color. Annu Rev Genet. 2003;37:67–90. doi: 10.1146/annurev.genet.37.110801.143233. [DOI] [PubMed] [Google Scholar]
  • 13.Garcia-Borron JC, Sanchez-Laorden BL, Jimenez-Cervantes C. Melanocortin-1 receptor structure and functional regulation. Pigment Cell Res. 2005;18:393–410. doi: 10.1111/j.1600-0749.2005.00278.x. [DOI] [PubMed] [Google Scholar]
  • 14.Raimondi S, Sera F, Gandini S, Iodice S, Caini S, Maisonneuve P, Fargnoli MC. MC1R variants, melanoma and red hair color phenotype: a meta-analysis. Int J Cancer. 2008;122:2753–60. doi: 10.1002/ijc.23396. [DOI] [PubMed] [Google Scholar]
  • 15.Gerstenblith MR, Goldstein AM, Fargnoli MC, Peris K, Landi MT. Comprehensive evaluation of allele frequency differences of MC1R variants across populations. Hum Mutat. 2007;28:495–505. doi: 10.1002/humu.20476. [DOI] [PubMed] [Google Scholar]
  • 16.Landi MT, Bauer J, Pfeiffer RM, Elder DE, Hulley B, Minghetti P, Calista D, Kanetsky PA, Pinkel D, Bastian BC. MC1R germline variants confer risk for BRAF-mutant melanoma. Science. 2006;313:521–2. doi: 10.1126/science.1127515. [DOI] [PubMed] [Google Scholar]
  • 17.Fargnoli MC, Pike K, Pfeiffer RM, Tsang S, Rozenblum E, Munroe DJ, Golubeva Y, Calista D, Seidenari S, Massi D, Carli P, Bauer J, Elder DE, Bastian BC, Peris K, Landi MT. MC1R variants increase risk of melanomas harboring BRAF mutations. J Invest Dermatol. 2008;128:2485–90. doi: 10.1038/jid.2008.67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Hacker E, Hayward NK, Dumenil T, James MR, Whiteman DC. The association between MC1R genotype and BRAF mutation status in cutaneous melanoma: findings from an Australian population. J Invest Dermatol. 2010;130:241–8. doi: 10.1038/jid.2009.182. [DOI] [PubMed] [Google Scholar]
  • 19.Thomas NE, Kanetsky PA, Edmiston SN, Alexander A, Begg CB, Groben PA, Hao H, Busam K, Ollila DW, Berwick M, Conway K. Relationship between germline MC1R variants and BRAF-mutant melanoma in a North Carolina population-based study. J Invest Dermatol. 2010;130:1463–5. doi: 10.1038/jid.2009.410. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Scherer D, Rachakonda PS, Angelini S, Mehnert F, Sucker A, Egberts F, Hauschild A, Hemminki K, Schadendorf D, Kumar R. Association between the germline MC1R variants and somatic BRAF/NRAS mutations in melanoma tumors. J Invest Dermatol. 2010;130:2844–8. doi: 10.1038/jid.2010.242. [DOI] [PubMed] [Google Scholar]
  • 21.Fitzpatrick TB. The validity and practicality of sun-reactive skin types I through VI. Arch Dermatol. 1988;124:869–71. doi: 10.1001/archderm.124.6.869. [DOI] [PubMed] [Google Scholar]
  • 22.Chaudru V, Laud K, Avril MF, Miniere A, Chompret A, Bressac-de Paillerets B, Demenais F. Melanocortin-1 receptor (MC1R) gene variants and dysplastic nevi modify penetrance of CDKN2A mutations in French melanoma-prone pedigrees. Cancer Epidemiol Biomarkers Prev. 2005;14:2384–90. doi: 10.1158/1055-9965.EPI-04-0777. [DOI] [PubMed] [Google Scholar]
  • 23.Scherer D, Nagore E, Bermejo JL, Figl A, Botella-Estrada R, Thirumaran RK, Angelini S, Hemminki K, Schadendorf D, Kumar R. Melanocortin receptor 1 variants and melanoma risk: a study of 2 European populations. Int J Cancer. 2009;125:1868–75. doi: 10.1002/ijc.24548. [DOI] [PubMed] [Google Scholar]
  • 24.Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, Kondrashov AS, Sunyaev SR. A method and server for predicting damaging missense mutations. Nat Methods. 2010;7:248–9. doi: 10.1038/nmeth0410-248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Sole X, Guino E, Valls J, Iniesta R, Moreno V. SNPStats: a web tool for the analysis of association studies. Bioinformatics. 2006;22:1928–9. doi: 10.1093/bioinformatics/btl268. [DOI] [PubMed] [Google Scholar]
  • 26.Arrington JH, 3rd, Reed RJ, Ichinose H, Krementz ET. Plantar lentiginous melanoma: a distinctive variant of human cutaneous malignant melanoma. Am J Surg Pathol. 1977;1:131–43. [PubMed] [Google Scholar]
  • 27.Clark WH, Jr, Mihm MC., Jr Lentigo maligna and lentigo-maligna melanoma. Am J Pathol. 1969;55:39–67. [PMC free article] [PubMed] [Google Scholar]
  • 28.Clark WH, Jr, Elder DE, Van Horn M. The biologic forms of malignant melanoma. Hum Pathol. 1986;17:443–50. doi: 10.1016/s0046-8177(86)80032-6. [DOI] [PubMed] [Google Scholar]
  • 29.Porras BH, Cockerell CJ. Cutaneous malignant melanoma: classification and clinical diagnosis. Semin Cutan Med Surg. 1997;16:88–96. doi: 10.1016/s1085-5629(97)80002-8. [DOI] [PubMed] [Google Scholar]
  • 30.Berwick M, Wiggins C. The current epidemiology of cutaneous malignant melanoma. Front Biosci. 2006;11:1244–54. doi: 10.2741/1877. [DOI] [PubMed] [Google Scholar]
  • 31.Valverde P, Healy E, Jackson I, Rees JL, Thody AJ. Variants of the melanocyte-stimulating hormone receptor gene are associated with red hair and fair skin in humans. Nat Genet. 1995;11:328–30. doi: 10.1038/ng1195-328. [DOI] [PubMed] [Google Scholar]
  • 32.Healy E, Flannagan N, Ray A, Todd C, Jackson IJ, Matthews JN, Birch-Machin MA, Rees JL. Melanocortin-1-receptor gene and sun sensitivity in individuals without red hair. Lancet. 2000;355:1072–3. doi: 10.1016/S0140-6736(00)02042-0. [DOI] [PubMed] [Google Scholar]
  • 33.Orlow I, Tommasi DV, Bloom B, Ostrovnaya I, Cotignola J, Mujumdar U, Busam KJ, Jungbluth AA, Scolyer RA, Thompson JF, Armstrong BK, Berwick M, Thomas NE, Begg CB. Evaluation of the clonal origin of multiple primary melanomas using molecular profiling. J Invest Dermatol. 2009;129:1972–82. doi: 10.1038/jid.2009.4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Murali R, Goumas C, Kricker A, From L, Busam KJ, Begg CB, Dwyer T, Gruber SB, Kanetsky PA, Orlow I, Rosso S, Thomas NE, Berwick M, Scolyer RA, Armstrong BK. Clinicopathologic features of incident and subsequent tumors in patients with multiple primary cutaneous melanomas. Ann Surg Oncol. 2012;19:1024–33. doi: 10.1245/s10434-011-2058-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Titus-Ernstoff L, Perry AE, Spencer SK, Gibson J, Ding J, Cole B, Ernstoff MS. Multiple primary melanoma: two-year results from a population-based study. Arch Dermatol. 2006;142:433–8. doi: 10.1001/archderm.142.4.433. [DOI] [PubMed] [Google Scholar]
  • 36.Duffy DL, Box NF, Chen W, Palmer JS, Montgomery GW, James MR, Hayward NK, Martin NG, Sturm RA. Interactive effects of MC1R and OCA2 on melanoma risk phenotypes. Hum Mol Genet. 2004;13:447–61. doi: 10.1093/hmg/ddh043. [DOI] [PubMed] [Google Scholar]
  • 37.Akey JM, Wang H, Xiong M, Wu H, Liu W, Shriver MD, Jin L. Interaction between the melanocortin-1 receptor and P genes contributes to inter-individual variation in skin pigmentation phenotypes in a Tibetan population. Hum Genet. 2001;108:516–20. doi: 10.1007/s004390100524. [DOI] [PubMed] [Google Scholar]
  • 38.Beaumont KA, Newton RA, Smit DJ, Leonard JH, Stow JL, Sturm RA. Altered cell surface expression of human MC1R variant receptor alleles associated with red hair and skin cancer risk. Hum Mol Genet. 2005;14:2145–54. doi: 10.1093/hmg/ddi219. [DOI] [PubMed] [Google Scholar]
  • 39.Beaumont KA, Shekar SN, Newton RA, James MR, Stow JL, Duffy DL, Sturm RA. Receptor function, dominant negative activity and phenotype correlations for MC1R variant alleles. Hum Mol Genet. 2007;16:2249–60. doi: 10.1093/hmg/ddm177. [DOI] [PubMed] [Google Scholar]
  • 40.Dessinioti C, Antoniou C, Katsambas A, Stratigos AJ. Melanocortin 1 receptor variants: functional role and pigmentary associations. Photochem Photobiol. 2011;87:978–87. doi: 10.1111/j.1751-1097.2011.00970.x. [DOI] [PubMed] [Google Scholar]
  • 41.Busca R, Abbe P, Mantoux F, Aberdam E, Peyssonnaux C, Eychene A, Ortonne JP, Ballotti R. Ras mediates the cAMP-dependent activation of extracellular signal-regulated kinases (ERKs) in melanocytes. EMBO J. 2000;19:2900–10. doi: 10.1093/emboj/19.12.2900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Wikberg JE, Muceniece R, Mandrika I, Prusis P, Lindblom J, Post C, Skottner A. New aspects on the melanocortins and their receptors. Pharmacol Res. 2000;42:393–420. doi: 10.1006/phrs.2000.0725. [DOI] [PubMed] [Google Scholar]
  • 43.Motokawa T, Kato T, Hashimoto Y, Katagiri T. Effect of Val92Met and Arg163Gln variants of the MC1R gene on freckles and solar lentigines in Japanese. Pigment Cell Res. 2007;20:140–3. doi: 10.1111/j.1600-0749.2007.00364.x. [DOI] [PubMed] [Google Scholar]
  • 44.Elfakir A, Ezzedine K, Latreille J, Ambroisine L, Jdid R, Galan P, Hercberg S, Gruber F, Malvy D, Tschachler E, Guinot C. Functional MC1R-gene variants are associated with increased risk for severe photoaging of facial skin. J Invest Dermatol. 2010;130:1107–15. doi: 10.1038/jid.2009.366. [DOI] [PubMed] [Google Scholar]
  • 45.Scherer D, Bermejo JL, Rudnai P, Gurzau E, Koppova K, Hemminki K, Kumar R. MC1R variants associated susceptibility to basal cell carcinoma of skin: interaction with host factors and XRCC3 polymorphism. Int J Cancer. 2008;122:1787–93. doi: 10.1002/ijc.23257. [DOI] [PubMed] [Google Scholar]
  • 46.Kvaskoff M, Siskind V, Green AC. Risk factors for lentigo maligna melanoma compared with superficial spreading melanoma: a case-control study in Australia. Arch Dermatol. 2012;148:164–70. doi: 10.1001/archdermatol.2011.291. [DOI] [PubMed] [Google Scholar]
  • 47.Wakamatsu K, Kavanagh R, Kadekaro AL, Terzieva S, Sturm RA, Leachman S, Abdel-Malek Z, Ito S. Diversity of pigmentation in cultured human melanocytes is due to differences in the type as well as quantity of melanin. Pigment Cell Res. 2006;19:154–62. doi: 10.1111/j.1600-0749.2006.00293.x. [DOI] [PubMed] [Google Scholar]
  • 48.Doyle JR, Fortin JP, Beinborn M, Kopin AS. Selected melanocortin 1 receptor single-nucleotide polymorphisms differentially alter multiple signaling pathways. J Pharmacol Exp Ther. 2012;342:318–26. doi: 10.1124/jpet.112.194548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Thomas NE, Kanetsky PA, Begg CB, Conway K, Berwick M. Melanoma molecular subtypes: unifying and paradoxical results. J Invest Dermatol. 2010;130:12–4. doi: 10.1038/jid.2009.332. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp Material S1

RESOURCES