Skip to main content
PLOS One logoLink to PLOS One
. 2013 Dec 19;8(12):e83963. doi: 10.1371/journal.pone.0083963

Characterization of a Pathogen Induced Thaumatin-Like Protein Gene AdTLP from Arachis diogoi, a Wild Peanut

Naveen Kumar Singh 1,*, Koppolu Raja Rajesh Kumar 1,¤, Dilip Kumar 1, Pawan Shukla 1, P B Kirti 1
Editor: Ji-Hong Liu2
PMCID: PMC3868660  PMID: 24367621

Abstract

Peanut (Arachis hypogaea L) is one of the widely cultivated and leading oilseed crops of the world and its yields are greatly affected by various biotic and abiotic stresses. Arachis diogoi, a wild relative of peanut, is an important source of genes for resistance against various stresses that affect peanut. In our previous study a thaumatin-like protein gene was found to be upregulated in a differential expression reverse transcription PCR (DDRT-PCR) study using the conidial spray of the late leaf spot pathogen, Phaeoisariopsis personata. In the present study, the corresponding full length cDNA was cloned using RACE-PCR and has been designated as AdTLP. It carried an open reading frame of 726 bp potentially capable of encoding a polypeptide of 241 amino acids with 16 conserved cysteine residues. The semi-quantitative RT-PCR analysis showed that the transcript level of AdTLP increased upon treatment with the late leaf spot pathogen of peanut, P. personata and various hormone treatments indicating its involvement in both, biotic and abiotic stresses. The antifungal activity of the purified recombinant protein was checked against different fungal pathogens, which showed enhanced anti-fungal activity compared to many other reported TLP proteins. The recombinant AdTLP-GFP fusion protein was found to be predominantly localized to extracellular spaces. Transgenic tobacco plants ectopically expressing AdTLP showed enhanced resistance to fungal pathogen, Rhizoctonia solani. The seedling assays showed enhanced tolerance of AdTLP transgenic plants against salt and oxidative stress. The transcript analysis of various defense related genes highlighted constitutively higher level expression of PR1a, PI-I and PI-II genes in transgenic plants. These results suggest that the AdTLP is a good candidate gene for enhancing stress resistance in crop plants.

Introduction

In nature, plants are exposed to different kinds of environmental and biotic stresses such as attack by plant pathogens and insect predators. To defend themselves against these attacks, they have evolved various well established defense mechanisms. Induction of these mechanisms results in the activation of different stress related genes ultimately leading to the production of reactive oxygen species (ROS), accumulation of phytoalexins, hypersensitive response and synthesis of pathogenesis related (PR) proteins [1,2]. Van Loon et al. classified these PR proteins into 17 different families based on their structure, amino acid sequences and mode of action [3].

Members of PR-5 class proteins are also called thaumatin-like proteins (TLPs) because of their sequence similarity with the sweet tasting protein thaumatin from Thaumatococcus danielli [4]. TLPs are reported to be widely distributed PR proteins across kingdoms including gymnosperm, angiosperm, animal and fungal systems [5]. Molecular mass of TLPs ranges between 21 to 26 kDa with a thaumatin family signature G-X- [GF]-X-C-X-T- [GA]-D-C-X- (1,2)-G-X-(2,3)-C [6]. In general, TLPs have 16 conserved cysteine residues that are involved in the formation of eight disulfide linkages, which impart stability to the protein under varied thermal and pH conditions [7,8].

In vitro antifungal activity of TLPs has been reported against a variety of filamentous fungal pathogen such as Botrytis cinerea, Fusarium oxysporum, Mycosphaerella arachidicola, Trichoderma viride [9–11]. Osmotin like protein from black nightshade, Solanum nigrum also showed inhibitory effect on the growth of Rhizoctonia batiticola and Sclerotinia sclerotiorum [12]. TLPs possess the capacity to rupture the fungal membrane by pore formation [13]. In addition, they can also affect the fungus growth with β-glucanase and xylanase inhibitor activities [14,15]. Transgenic plants overexpressing TLP genes have shown enhanced resistance and protection against different fungal pathogens [16,17]. Some TLPs have also been reported to be involved in anti-freeze activity [18] and developmental processes like fruit ripening [19].

Peanut (Arachis hypogaea L), is an important legume/ oilseed crop cultivated worldwide and is very much susceptible to various biotic stresses caused by pathogens and insect pests resulting in huge losses in plant productivity. The germplasm belonging to the genus Arachis consists of 69 species with more than 40 wild relatives [20]. It has also been shown that these wild relatives exhibit high level of resistance/tolerance to the various stresses compared to the highly susceptible cultivated peanuts [20,21]. Hence, they are assumed to be an important source of genes for resistance to the stresses for peanut improvement. The leaf spots, collectively termed as ‘Tikka’ disease is a very serious disease affecting the cultivated peanuts. One of the pathogens responsible for Tikka disease is Phaeoisariopsis personata that causes late leaf spot; and early leaf spot is caused by Cercospora arachidicola. Wild peanut, Arachis diogoi exhibits very high levels of resistance to these and other diseases that seriously affect the cultivated peanuts. Through a differential display approach, we have earlier identified several genes that get significantly upregulated in Arachis diogoi upon treatment with Phaeoisariopsis personata [22]. One of the upregulate genes designated as AdDR-11 in the wild peanut was identified to encode a putative thaumatin-like protein [22].

In the present study, using the available partial cDNA sequence of AdDR-11, full length cDNA was amplified and cloned from Arachis diogoi and it was named as AdTLP. We analyzed its transcriptional regulation in response to various treatments and its subcellular localization by translational fusion with GFP. In vitro and in vivo antifungal activity of AdTLP protein was analyzed against different fungal pathogens, Botrytis cinerea, Fusarium oxysporum, Fusarium solani and Rhizoctonia solani. Abiotic stress assays were also carried out to observe the efficacy of AdTLP in alleviating stress caused high NaCl and H2O2 conditions. In addition to this, transcript levels of various defense responsive genes were checked in transgenic plants and our results are reported in this communication.

Materials and Methods

Plant materials and treatments

Wild peanut (Arachis diogoi) and tobacco (Nicotiana tabacum var Xanthi) plants were maintained in the green house. For different treatments, detached leaves of A. diogoi were utilized and the experiments were performed essentially as described earlier [22]. In brief, 105 conidia per milliliter of the peanut late leaf spot pathogen, Phaeoisariopsis personata were used for pathogen treatment. For hormone treatments, concentrations of 500 μM salicylic acid (SA), 100 μM methyl jasmonate (MeJA), 100 μM abscisic acid (ABA), and 250 μM ethephon were utilized. Samples were collected at regular intervals, quick-frozen in liquid nitrogen, and stored at -80° C till further use.

5′ RACE, Isolation of Full Length cDNA and Genomic Sequence of AdTLP

RNA was isolated from frozen samples using RNeasy Plant Mini Kit (Qiagen, Germany). Isolated RNA was quantified and the quality was evaluated through formaldehyde gel electrophoresis. Rapid amplification of cDNA ends (RACE) was performed using 5′/3′ RACE kit (Roche Applied Sciences, Germany) following the manufacturer’s instructions. In brief, two micrograms of total RNA was reverse transcribed with gene specific primer AdDR11-146R using Transcriptor reverse transcriptase provided in the kit. The dA-tail was added to the synthesized first strand cDNA at the 5′ end using terminal transferase. The dA-tailed cDNA was used as template in subsequent PCR reactions. Gene specific primers AdDR11-117R and AdDR11-64R were designed based on the available partial sequence (AdDR-11) [22]. It was used in combination with Oligo-dT anchor primer and PCR anchor primer in the PCR reactions respectively. RACE-PCR reactions were performed using Taq DNA polymerase (Sigma-Aldrich). Genomic DNA served as templates for the amplification of genomic sequences. All PCR products described in the study were cloned in to pTZ57R vector (Fermentas, Germany) and sequenced commercially for sequence confirmation. All the primer details were provided in Table 1.

Table 1. Sequences of the oligonucleotides used in the study (see text for details).

Name of the primers Primer sequences (5’-3’)
AdDR11-64R CATTAGGGCACTGGTTGCTA
AdDR11-117R GCCTCCTGAACAAGTGAAAG
AdDR11-146R CATGGACAGAAGTTGATAGC
TLP ORF-F GGGATCCATGGCGATTACTCGTGTTGT
TLP ORF-R CCTCGAGTCATGGACAGAAGTTGATAGC
TLP ORF-F1 GGGGCCCATGGCGATTACTCGTGTTGT
TLP ORF-R1 GGGATCCTCATGGACAGAAGTTGATAGC
TLP ORF-F2 GGGGCCCATGGCGATTACTCGTGTTGT
TLP ORF-R2 CCCCGGGTCATGGACAGAAGTTGATAGC
PCR anchor primer GACCACGCGTATCGATGTCGAC
Oligo dT-anchor primer GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV
Actin-F TGGCATCACACTTTCTACAA
Actin-R CAACGGAATCTCTCAGCTCC

Analysis of cDNA and protein sequence

The cDNA sequence data were analyzed using BLASTn and BLASTp at NCBI website (http://www.ncbi.nlm.nih.gov). The theoretical isoelectric point and molecular mass were computed using COMPUE pI/Mw tool (http://web.expasy.org/compute_pi/). Nucleotide translations were performed using translate tool at ExPASy (http://www.expasy.ch/). Signal peptides were predicted using SignalP 4.1 (http://www.cbs.dtu.dk/services/SignalP/). Multiple sequence alignment and phylogenetic tree were done using ClustalW (www.ebi.ac.uk) and MEGA 4.0.2 software respectively.

Semi-quantitative RT-PCR

First strand cDNA was synthesized by reverse transcribing RNA (500ng) using MMLV reverse transcriptase (Sigma-Aldrich). Subsequent PCR reactions were performed using the first strand cDNA as template in the presence of gene specific primers ORF-F and ORF-R. PCR reactions were standardized empirically to keep the amplification in linear range. For all PCR reactions Taq DNA polymerase (Sigma-Aldrich) was used.

AdTLP subcellular localization

The ORF of AdTLP was amplified using gene specific primers ORF-F1 and ORF-F2 harboring ApaI and BamHI restriction sites respectively with a proofreading polymerase. The amplification product was digested with ApaI and BamHI and cloned into pRT-GFP vector [22] using the same set of enzymes to generate 35S:AdTLP:GFP. The AdTLP:GFP expression cassette was released using SphI and further sub-cloned into HindIII site of binary vector pCAMBIA1300 after end filling both the sites, which resulted in AdTLP:GFP:1300. The recombinant binary vector was mobilized into Agrobacterium strain LBA4404 using freeze thaw method. Similarly empty vector pEGAD for the expression of free GFP was also mobilized into the Agrobacterium strain.

Agroinfiltration and microscopy

Agroinfiltration was performed essentially as described earlier [22]. In brief, agrobacterial strains harboring the free GFP and recombinant AdTLP-GFP vectors were grown in LB medium in the presence of appropriate antibiotics. The agrobacterial cultures were pelleted and resuspended in the infiltration medium (10mM MES, 10mM MgCl2 and 200µM acetosyringone) adjusted to an OD600 of 0.8. Agrobacterial suspensions were then infiltrated into the adaxial side of the tobacco leaves using a needless syringe. GFP expression was visualized in infiltrated leaves 48-96 hours post infiltration (hpi) at different time intervals with laser scanning confocal microscopy (Leica TCS SP2 with Leica DM6000 microscope).

Expression and purification of AdTLP protein

The 726 bp open reading frame was amplified using ORF-F and ORF-R primers with BamHI and XhoI sites, digested and cloned into the corresponding sites of pET32a(+) expression vector (Novagen Corporation, USA). The cloned vector was transformed into cells of E.coli Rosetta gami-2 (DE3) strain and the transformed cells were grown at 37° C in Luria and Bertani (LB) broth (Himedia, India) with antibiotics chloramphenicol (25 µg ml-1) and ampicillin (100 µg ml-1) overnight at 200 rpm in an orbital shaker. A 10 mL aliquot from the overnight grown culture was added to 1L of fresh LB medium and grown further at 37° C until the OD600 reached 0.5-0.6. Then, these cells were induced to express recombinant protein by adding 1mM IPTG (Fermentas, Germany) for 4 h. Following the induction, the induced cells were harvested by centrifugation at 5000 rpm for 10 min at 4° C. Recombinant proteins were exclusively found in inclusion bodies, which was confirmed by resuspending 2 mL culture pellet in lysis buffer ( 200 mM Tris-cl pH 7.5, 10mM EDTA, 1% Triton X-100) followed by sonication and SDS-PAGE analysis. To purify the protein from inclusion bodies, pelleted cells from 1 L culture were resuspended in lysis buffer (8 M urea, 10mM imidazole, 0.1M NaHPO4, 0.01M Tris base pH 8) and sonicated. The lysate was centrifuged at 12,000 rpm for 20 min to remove the debris. The expression of the fusion protein with the N-terminal fusion partners, Thioredoxin-His-S-tag linked to the target peptide (AdTLP) and purification was done by IMAC (immobilized metal ion affinity chromatography) using the His-Tag of the fusion protein. Supernatant was mixed with 2 mL of equilibrated Nickel-NTA resin and added into the column. The flow through was collected and wash it with 10 volumes of wash buffer (8 M urea, 50mM imidazole, 0.1M NaHPO4, 0.01M Tris base, pH 6.3) and finally the recombinant peptide was collected with elution buffer (8 M urea, 250 mM imidazole, 0.1M NaHPO4, 0.01 M Tris base, pH 4.5). Dialysis was conducted for protein renaturation by gradually adding renaturation buffer (Urea, 0.1 M NaH2PO4, 0.01 M Tris base, pH 7.0) containing decreasing concentration of urea from 6M to 1 mM. Then Tris buffer (0.01 M) alone was used for five times with an interval of 1 h. Finally it was kept for overnight dialysis in the same buffer at 4° C. The purified protein was resolved in 12% SDS-PAGE. Protein concentration was measured using Bradford method.

Antifungal activity assay

Antifungal activity of the recombinant AdTLP (rAdTLP) protein was tested by microspectrophotometry as well as in vitro plate assay with the fungal pathogens, Fusarium oxysporum, Fusarium solani, Botrytis cinerea, Rhizoctonia solani. For microspectrometry analysis, standard method as described by Song et al. [23] and Vijayan et al. [24] was followed. Briefly, 10µl of protein, diluted to different concentrations, was pipette into the wells of a 96-well microtiter plate containing 140µl of test fungal spore suspension (~ 3.0× 104 spores/ mL) in potato dextrose broth, which was placed in an incubator at 28° C. Antifungal activity of each concentration of protein was performed in triplicates. Fungal spore germination was observed microscopically, whereas optical density at 595 nm wavelength was measured to check the spore growth after inoculation for 30 min and 48 hrs. Controls that were devoid of the test protein were tested for comparing the antifungal activity of the rAdTLP. Values of growth inhibition less than 10% were not considered as significant. Growth inhibition is defined as the ratio of the corrected absorbance at 595 nm of the control minus the corrected absorbance of the test sample, divided by the corrected absorbance of the control. The corrected absorbance is defined as the absorbance at 48 h minus that at 30 min. IC50 is defined as the protein concentration at which 50% inhibition was reached [24].

For the in vitro plate assay, fungal discs of uniform size were inoculated at the centre of the Potato Dextrose agar media and incubated at 28° C. When the mycelial spread reached 4 cm in diameter, four sterile Whatman no.1 filter paper discs of equal size were placed at equal distance from centre. Purified protein was added at various concentrations (ranging from 10-50 µg/ mL) at the centre of disc on the plate. The elution buffer served as control and the plates were incubated at 28° C. Growth of mycelia was observed periodically till they covered the control discs. A graph was plotted showing percentage inhibition of fungal growth against the concentration of protein to determine the IC50 for Rhizoctonia solani.

β-1, 3 Glucanase assay

β-1, 3 Glucanase assay was done using the method of Looze et al. [25] with some modifications. The activity of rAdTLP proteins was analyzed by mixing 50 µg of protein sample with 100 µL of 50 mM acetate buffer (pH 5.0) containing 1% Laminarin (Sigma). The mixture was incubated at 37° C for different time periods ranging from 30 min to 3 days. Absorbance was measured at 595 nm. Increase in absorbance indicates β-1, 3 glucanase activity.

Agrobacterium mediated Tobacco transformation with 35s-AdTLP construct

The AdTLP ORF was reamplified using ORF-F2 and ORF-R2 primers having ApaI and SmaI sites respectively, digested and cloned in pRT100 vector. Due to presence of internal sites, partial digestion was performed with HindIII enzyme for releasing ~1.5 Kb cassette containing the CaMV35S promoter and polyadenylation signal from pRT100 vector along with the AdTLP. The AdTLP expression cassette was further cloned in the binary vector pCAMBIA2300 at the HindIII site in the multiple cloning sites. Tobacco (Nicotiana tabacum cv Xanthi) was transformed through leaf disc transformation using Agrobacterium tumefaciens strain EHA105 carrying the binary vector pCAMBIA2300-AdTLP and the transformants were selected on 125mgL-1 kanamycin [26]. T0 putative transgenic were analyzed by polymerase chain reaction (PCR) and reverse transcriptase polymerase chain reaction (RT-PCR) for the target gene. Among seven different transgenic plants analyzed, progenies of the primary transgenic plants 4 (low expression AdTLP plant) and #7 (high expression AdTLP plant) were taken for further analysis T1 and T2 seeds were raised via self-pollination and T2 seeds were used in functional characterization.

Evaluation of transgenic plants for resistance against fungal pathogen

Root bioassay, using the fungal pathogen, Rhizoctonia solani, was carried out to check the resistance in the transgenic plants expressing AdTLP constitutively against the root rot causing fungal pathogen. At maturity, seeds from transgenic plants were collected and germinated for T2 generation analysis. Seeds from line 4 and 7 were surface sterilized and grown on half strength MS medium (MSH). After germination, they were transferred to the cups filled with sterilized vermiculite and soil in 3:1 ratio. Four seedlings were transferred to each cup and allowed to grow further for another 25 days. Control seedlings were transferred simultaneously. Ten sclerotia of equal size were added to each cup and they were maintained under humid condition by covering with polyethylene covers in the growth room. Symptoms started appearing after 5 days and observations were taken after 8 days and 10 days of post infection (dpi).

Abiotic stress assays

Seedlings of transgenic and wild plants (WT) were selected to analyse the salt (sodium chloride) and oxidative stress tolerance. T2 transgenic seedlings were grown on half MSH medium (without organics) containing 125mgL-1 kanamycin and simultaneously, the WT plants were grown on MSH medium without kanamycin. Twenty seedlings each of WT and kanamycin resistant seedling in T2 generation (plants 4 and 7) were transferred to different stress treatment plates for each experiment. For salt stress seedlings were transferred to 100 mM, 200 mM and 300 mM NaCl in MSH. For oxidative stress treatment 2% H2O2 in MSH medium was used. Total chlorophyll content was measured spectrophotometrically as described by Arnon [27]. Lipid peroxidation was assessed by measuring thiobarbituric acid reactive substances (TBARS) as described by Heath and Packer [28]. In the case of NaCl treatment, both the chlorophyll and TBARS estimation were done after 12 days of treatment and for H2O2, after 10 days of treatment.

Expression analysis of other stress related genes

Transcript accumulation for some defense responsive genes was monitored in WT and transgenic plants, using semi quantitative RT-PCR. Leaf samples were collected from two months old plants, quick frozen and stored in -80° C. Primer sequences used in this study were provided in Table S1.

Results

Isolation of full length cDNA, genomic sequence of AdTLP and their analysis

A partial cDNA clone of 369bp designated as AdDR-11 encoding a putative thaumatin-like protein was isolated in a previous study [22]. Using 5' RACE-PCR approach, a 686bp product was obtained using gene specific primer AdDR11-64R and PCR anchor primer. Full length cDNA sequence was deduced based on the overlapping sequence of the obtained RACE product with existing partial cDNA sequence. The full length cDNA was amplified and confirmed after sequencing. It showed homology with thaumatin-like proteins and was hence, designated as AdTLP, and the sequence was deposited in the NCBI Genbank under the accession number FJ481982. The cDNA was 988 bp in length with an open reading frame of 726 bp potentially encoding a polypeptide of 241 amino acids (Figure 1A). The theoritical pI and the molecular mass of AdTLP were 4.71 and 25005.63 Da respectively including the signal peptide. An N-terminal signal peptide of 21 amino acids was present suggesting it to be a secretory protein (Figure 1A). The amplification of corresponding genomic sequence revealed that AdTLP gene did not harbor any introns (Figure 1B).

Figure 1. The nucleotide, deduced amino acid sequence and gene structure of AdTLP.

Figure 1

Deduced amino acid sequence of the protein is shown under the nucleic acid sequence (A). Nucleotides are numbered. (*) indicates a stop codon. A 21 amino acid N-terminal signal peptide is underlined. The gene structure of AdTLP is shown in Figure (B). Exon is represented by closed box and dark lines represent 5′ and 3′ UTRs. Their respective lengths were given in bp.

Sequence alignment of deduced amino acid AdTLP with TLPs from other plants showed that there were sixteen cysteine residues involved in formation of eight disulfide bridges and are conserved across the species. The AdTLP protein exhibited 68% sequence similarity with MtTLP from Medicago trancatula, 66% to GmTLP from Glycine max, and 62% to PpTLP from Pyrus pyrifolia resepectively. Among well characterized TLPs, Arabidopsis thaliana TLP (AtTLP) and Nicotiana tabacum TLP (NtTLP) shared 50% and 47% similarity with AdTLP respectively (Figure 2). Phylogenetic analysis (Figure 3) showed that the AdTLP was closely related to a non-leguminous MdTLP (Malus domestica), as well as leguminous MtTLP (Medicago trancatula) and GmTLP (Glycine max).

Figure 2. Multiple sequence alignment of AdTLP with TLPs from other plant species.

Figure 2

The sixteen cysteine residues required for the formation of eight disulfide bridges are conserved in AdTLP also and are indicated by asterisk (*). Mt: Medicago truncatula, Gm: Gycine max, Pp: Pyrus pyrifolia, At: Arabidopsis thaliana, Nt: Nicotiana tabacum.

Figure 3. Phylogenetic analysis of AdTLP with other TLPs.

Figure 3

A phylogenetic tree based on genetic distance of the protein sequences was constructed using MEGA 4.0.2 software. Bootstrap values are indicated at the branches. The TLP members used for construction of the tree are listed in the GenBank database under the following accession numbers: AtTLP (AAD02499.1); BhOLP (AAD53089.1); BkTLP (CBJ55937.1); BrTLP (ABV89616.1); CjTLP (BAD90814.1); CmTLP (ADN33945.1); CtjTLP (BAI63297.1); DcTLP (AAL47574.1); FpTLP (ABB86299.1); GbTLP (ABL86687.1); GmTLP1a (XP_003535214.1); HvTLP (BAJ96850.1); LjTLP (AFK33451.1); MdTLP (AAC36740.1); MtTLP (AFK34461.1); NtTLP (BAA74546.2); OsTLP (BAD34224.1); PhpTLP (XP_001784610.1); PpTLP (BAC78212.1); PmTLP (ADB97928.1); PrpTLP (AEV57470.1); PtTLP (XP_002330973.1); RcTLP (XP_002519620.1); SbTLP (XP_002465570.1); TaTLP (AAM15877.1); ThTLP (BAJ34394.1); TpTLP (BAE71242.1); VvPR5 (XP_002277548.1); ZmTLP (NP_001142502.1); At Arabidopsis thaliana, Bh Benincasa hispida, Bk Bupleurum kaoi, Br Brassica rapa, Cj Cryptomeria japonica, Cm Cucumis melo, Ctj Citrus jambhiri, Dc Daucus carota, Fp Ficus pumila, Gb Gossypium barbadense, Gm Glycine max, Hv Hordeum vulgare, Lj Lotus japonicas, Md Malus domestica, Mt Medicago truncatula, Nt Nicotiana tabacum, Os Oryza sativa, Php Physcomitrella patens, Pp Pyrus pyrifolia, Pm Pinus monticola, Prp Prunus persica, Pt Populus trichocarp, Rc Ricinus communis, Sb Sorghum bicolor, Ta Triticum aestivum, Th Thellungiella halophile, Tp Trifolium pratense, Vv Vitis vinifera, Zm Zea mays.

Transcript Expression Analysis

Transcript levels of AdTLP were analyzed using semi-quantitative RT-PCR in response to pathogen infections and different stress hormones. AdTLP ORF-F and ORF-R primers were used to amplify AdTLP. During the pathogen infection, upregulation of AdTLP was observed as early as 24 hpi, which gradually reached the basal level by 48 hpi and again rebounding to a very high level by 72 hpi (Figure 4A). Early upregulation of transcripts were observed during SA treatment, which was persistent till 12 hpi whereas they got upregulated at later stages during JA and ABA treatment (Figure 4B).

Figure 4. Transcript level analysis of AdTLP in A. diogoi.

Figure 4

Transcript level of AdTLP in A. diogoi was analyzed using semi-quantitative RT-PCR, during P. personata (A) and various hormones treatments (B).

Localization of AdTLP

To study the subcellular distribution of AdTLP, a C-terminal translational fusion with GFP was constructed. When expressed transiently in the epidermal cells of tobacco leaves, the free GFP was found to be accumulated in both cytosol and nucleus (Figure 5A). The recombinant AdTLP-GFP protein exhibited predominant localization in extracellular spaces with some presence in nuclear boundaries as well (Figure 5D). When the AdTLP-GFP expression cells were visualised at different planes, the distribution of AdTLP-GFP was also observed in subcellular structures, possibly endoplasmic reticulum (Figure 5G).

Figure 5. Subcellular localization of AdTLP by transient expression in tobacco leaves using agroinfiltration.

Figure 5

Empty vector pEGAD expressing free GFP (A, B, C). AdTLP:GFP:1300 expressing translationally fused AdTLP-GFP and cells were visualized at different planes (D-I). Expression of free GFP and AdTLP-GFP in epidermal cells (A, D, G), corresponding bright field image (B, E, H), and overlay of GFP signal onto bright field image (C, F, I).

Prokaryotic expression and purification

The AdTLP is supposed to code for a protein with 241 amino acids with a protein mass of ~25 kDa. The recombinant protein of 41 kDa, including 16 kDa tag region of pET32a vector, was expressed upon induction with 1mM IPTG (Figure S1). The protein was exclusively found in insoluble fraction in the inclusion bodies. Low temperature treatment and various concentration of IPTG did not show any effect on protein solubility. The recombinant protein was isolated from the inclusion bodies and solubilised using a buffer containing urea. Further it was refolded by using dialysis. This purified protein was used for in vitro fungal assay against different fungal pathogens (Figure 6).

Figure 6. SDS-PAGE analysis of purified protein.

Figure 6

12% SDS-PAGE analysis showing the purified protein. (M) Protein marker, (P) purified recombinant AdTLP protein.

In vitro antifungal activity and endo β-1, 3 Glucanase assay

Antifungal activity of AdTLP protein was investigated using spore germination and plate assays. During spore germination assays with F. oxysporum, F. solani and B. cinerea, drastic decrease in hyphal growth was observed even in protein concentration as low as 1 µg/ mL of the recombinant protein (Figure 7). For these three fungal species, the calculated IC50 values were less than 1 µg/ mL. Hyperbranching of mycelium was also observed, which was very much distinct in the case of B. cinerea. A 5µg/ mL concentration of proteins was sufficient to stop the fungal spore germination completely.

Figure 7. Fungal spore germination assay in the presence of different concentrations of AdTLP protein.

Figure 7

A. Fusarium oxysporum B. Fusarium solani C. Botrytis cinerea.

Plate assay of protein was also performed with Rhizoctonia solani. There were varied zones of inhibition in the test fungus depending on the protein concentration applied. A graph was plotted between percentage growth inhibition and protein concentration (data not shown) and the IC50 value was calculated to be 38 µg/ mL for this pathogen (Figure 8).

Figure 8. Effect of recombinant AdTLP protein on the growth of Rhizoctonia solani.

Figure 8

C, 1, 2 & 3 represents control, 10µg/ mL, 25µg/ mL, and 50µg/ mL, respectively. Photographs were taken after 24 and 36 hrs of fungal growth (A and B).

To observe whether AdTLP exhibits any β-1, 3 glucanase activity, 50 µg of recombinant protein was incubated with Laminarin for 30 min to 3 d. No detectable absorbance was observed at 595nm indicating that AdTLP did not possess any identifiable glucanase activity.

Genomic DNA PCR and RT-PCR analysis on putative transgenic plants

To identify the primary transgenic plants with high and low level expression of the target gene, AdTLP, RT-PCR analysis was performed. Genomic DNA was isolated from ten different kanamycin positive plants and PCR reaction was performed by using primers for the marker genes, nptII marker and AdTLP. Out of ten plants analyzed, seven plants gave expected amplification of 700 bp and 726 bp fragments respectively for nptII and AdTLP sequences. This was followed by RNA isolation and semi-quantitative RT-PCR analysis for determining the expression of AdTLP gene in transgenic plants (Figure 9A). Actin amplification served as internal control. This analysis showed that the putative transgenic plants 7 and 4 were conferring highest and lowest level of expression respectively. The primary transgenic plants of #4 and #7 were selfed to obtain seeds for subsequent generations of the plants after reconfirmation using PCR and RT-PCR (Figure 9B).

Figure 9. Semi-quantitative RT-PCR analysis of transgenic plants.

Figure 9

Transcript levels of AdTLP were checked in T0 (A) and T2 (B) transgenic plants. Line 7 is high expression line and line 4 represents low expression line. Actin served as control to demonstrate equal loading.

Rhizoctonia root rot assay

Antifungal resistance in transgenic plants was checked using the broad host range fungal pathogen, Rhizoctonia solani that causes seedling rot disease in several crop plants. T2 generation progeny of the low expression AdTLP plant, # 4 and the high expression plant, #7 were tested for fungal resistance along with control non-transformed plants in the assay. After 2 days of treatment using the sclerotia of the pathogen, fungal mycelia grew and covered the complete upper soil layer in the cups. The symptoms of infection started appearing in the wild type (WT) after 5 dpi. Fungal infection was severe on the control WT plants compared with the transgenic plantlets. After 10 dpi, WT plants became completely wilted and turned brownish black (Figure 10). Infection symptoms were also prominent in the progeny of the low expression plant 4, but the progeny plants of the high expression transgenic plant 7 were completely healthy. To check and compare the infection at root shoot junction, plants were uprooted from the cups and compared (Figure 11). Root growth of WT was completely retarded and the whole plant turned brownish indicating complete necrosis. The progeny plants of the transgenic #7 did not show any symptoms of infection whereas, some symptoms of wilting, necrosis and browning were observed in root and at root-shoot junction in the progeny of the plant 4. These observations showed that the high expression transgenic plant 7 exhibited enhanced levels of resistance against the root rot pathogen R.solani and AdTLP is a good candidate gene for imparting resistance against some fungal pathogens in crop plants.

Figure 10. Rhizoctonia solani wilt bioassay with T2 transgenic and the non-transformed control.

Figure 10

Fungal resistance was checked in control and transgenic plants using phytopathogenic fungus R. solani. Control plants were seriously affected whereas high expression line appeared completely healthy. Photographs were taken after 8 (A) and 10 days (B) post inoculation of fungus.

Figure 11. Condition of root, root and shoot junction and complete plant after 10 days of post inoculation of fungus.

Figure 11

Two plants were taken from each line. Wild type plants became completely wilted. Infection symptoms also appeared in the roots of the low expression line plants whereas high expression line plants were completely healthy.

Salinity and oxidative stress tolerance

To assess the tolerance of transgenic plants to salt stress, 10 days old seedlings of T2 generation of transgenics and WT were exposed to 100-300 mM NaCl in half MS-medium without organic nutrients. The 100 mM concentration of NaCl did not show any discernible differences between WT and transgenic as all seedlings were healthy and green even after 14 d exposure (data not shown). On 200 mM NaCl medium, both the lines of transgenic did not appear to be sensitive after 14 d of exposure, whereas better growth was observed in the progeny of the plant 7 compared to the progeny plants of plant 4 (Figure 12A). At the same time, chlorosis appeared with growth inhibition in WT seedlings. On a medium containing 300 mM NaCl, high level of bleaching was observed in the WT seedlings and almost 50% seedlings of plant 4 also got bleached out (Figure 13A). Only seedlings of the transgenic plant 7 showed better growth with very little chlorosis. To check the oxidative stress tolerance, seedlings were treated with 2% H2O2 in MSH medium without organic nutrients. Some chlorosis appeared in the newly grown leaves of transgenic seedlings, whereas WT seedlings became completely bleached out after 12 d exposure (Figure 14A). Total chlorophyll content and TBARS analysis showed that both salt and oxidative stress treated transgenic seedlings exhibited significantly higher chlorophyll (Figure 15A, C) content with low TBARS value (Figure 15B, D) compared to WT.

Figure 12. Seedlings assay with 200mM NaCl.

Figure 12

Seedlings were transferred on 200mM NaCl medium for 14 days (A). Seedlings on recovery medium (B). Seedlings condition after 10 days of recovery period of line 7 (C), line 4 (D) and the wild type (E).

Figure 13. Seedlings assay with 300 mM Nacl.

Figure 13

Seedlings were transferred on to 300mM NaCl medium for14 days (A). Seedlings on recovery medium (B). Seedlings condition after 10 days of recovery period of line 7 (C), line 4 (D) and the wild type (E).

Figure 14. Seedlings assay with 2% H2O2.

Figure 14

Seedlings were transferred on 2% H2O2 medium for 12 days (A). Seedlings on recovery medium (B). Seedlings condition after 10 days of recovery period of line 7 (C), line 4 (D) and wild type (E).

Figure 15. Total chlorophyll and TBARS measurement.

Figure 15

Total chlorophyll and TBARS were measured in seedlings after 12d of NaCl treatment (A and B) and after 10d of H2O2 treatment (C and D). Note the significantly increased total chlorophyll content and reduced TRABS in the transgenic seedlings after stress treatments. Experiments were repeated three times and means ±SE were plotted (P < 0.05, n = 3).

Seedling recovery after stress treatment

To assess the recovery response of the WT and transgenic seedlings treated with various concentrations of sodium chloride and 2% H2O2, they were transferred to NaCl and H2O2 free media. Since there were no significant differences between WT and transgenic seedlings grown on 100 mM NaCl medium, only the seedlings subjected 200-300 mM NaCl medium were transferred to the recovery medium. After 10 days, progeny seedlings of the transgenic plants 7 and 4 from 200 mM NaCl medium recovered completely and manifested near normal growth in comparison to WT seedlings, which were completely bleached out and did not recover (Figure 12B). From 300 mM NaCl medium, only the progeny seedlings of the plant 7 were only able to recover properly with true leaf formation and well-developed root system. The WT seedlings never displayed any signs of recovery (Figure 13B). Similarly among the seedlings from 2% H2O2 medium, only transgenic seedlings of the high expression plant 7 were able to recover well and give healthy appearance. Only very few seedlings from the plant 4 were able to recover, while the WT seedlings remained totally bleached (Figure 14B).

Transcript level analysis of defense responsive genes in transgenic plants

Transcript level of various defense related genes were analyzed in the transgenic plants using semi-quantitative RT-PCR (Figure 16). Constitutively higher transcript level of Pathogenesis related protein 1a (PR-1a), Protease inhibitor 1 (PI-1) and Protease inhibitor 2 (PI-II) were displayed by the transgenic plants compared to the WT plants. The transcript level of ICS, Lox3 and ACS3a, which code for the key enzymes in SA, JA and Ethylene biosynthesis pathway respectively were unaffected. Transcript level of wound and Jasmonic acid responsive gene i.e. allene oxide synthase (AOS) and allene oxide cyclase (AOC) were almost similar to wild type. The Basic PR-5 (osmotin) and defensin genes that are synergistically regulated by ethylene and JA were also unaffected at the transcript level.

Figure 16. Transcript profile of defense responsive genes.

Figure 16

Semi-quantitative RT-PCR was performed for transcript profiling of defense response genes in WT and transgenic plants. PR: Pathogenesis related proteins, PI: Protease inhibitor, Lox: Lipoxygenase, AOS: allene oxide synthase, ICS: isochorismate synthase, ACS: 1-aminocyclopropane-1-carboxylic acid synthase.

Discussion

Thaumatin-like proteins have been isolated and characterized from different plants and tissues. They are classified under the PR-5 proteins and are shown to be involved effectively in alleviating both biotic and abiotic stress tolerance [29–31]. In this study, a pathogen induced, full length 726 bp cDNA encoding a thaumatin-like protein from wild peanut, Arachis diogoi was amplified and cloned using partial AdDR-11 template as reference sequence that was identified as one of the upregulated genes in the wild peanut in pathogen challenge [22]. For our study, the gene was named as AdTLP. Sequence analysis revealed that AdTLP encodes a predicted protein of 241 amino acids which exhibited a 21 amino acid long N-terminal signal peptide with 25.01 kDa molecular weight and 4.71 theoretical pI. Phylogeneitc analysis revealed that the leguminous MtTLP and GmTLP showed closest similarity to AdTLP with 68% and 66% respectively.

The induction of TLP upon pathogen treatment was reported in several plant-microbe interactions [3,32]. The transcript level of AdTLP got upregulated during Phaeseoropsis personata treatment and reached to the highest level after 72 hpi possibly showing its activity during the later stages of infection. The stress hormones involved in the signalling of biotic and abiotic stress responses like SA, JA and ABA had a positive induction effect on the AdTLP transcript levels suggesting a possible role of AdTLP in different stress responses with a significant cross talk. The recombinant TLP proteins like TaPR5-GFP [33] and CkTLP-GFP [34] were mainly identified as extracellular proteins during transient expression. Other TLPs like RlemTLP and CsTL1, despite being predicted as extracellular, were found predominantly localized to both periphery of plasma membrane and cytoplasm and involved in anti-fungal activities as well [35]. The localization analysis of recombinant AdTLP-GFP protein also showed extracellular localization and the observation was consistent with the prediction of secretory signal peptide of 21 amino acids. However, the AdTLP-GFP protein expression in subcellular structures, possibly ER regions, needs further investigation for confirmation. The presence of AdTLP-GFP protein in the nuclear boundaries could be due to the extension of ER from plasma membrane to nucleus or due to the overexpression of GFP fusion protein under 35S promoter. The antifungal activity of the recombinant AdTLP that was purified after induction in the E.coli prokaryotic system was checked using spore germination and plate assays with different filamentous fungal pathogens that attack various crop plants. During spore germination assay, various concentrations of protein were used and it was observed that 5µg/ mL of recombinant protein was sufficient to inhibit spore germination completely in the case of F. oxysporum, F. solani and B. cinerea for which the calculated IC50 values were less than 1µg/ mL. These values were significantly low compared to a legume TLPs [36,37] as well as osmotins and TLPs from other plants [12,35]. Apart from growth inhibitory activity, the AdTLP also induced morphogenic changes like hyperbranching in the mycelium of fungal pathogen, B.cinerea in a way similar to the legume defensins [24] showing it to be a potent antifungal protein. The IC50 value of R. solani was 38µg/ mL. These results suggested better efficiency antimicrobial activity and broad spectrum of AdTLP protein against fungal infection.

β-1, 3 glucan is a common component of fungal cell wall. Some TLPs have been reported to display endo-β-1, 3 glucanase activity [14,38], which could be one of the possible mechanisms for their antifungal activity. However, when the recombinant AdTLP protein was incubated with laminarin as substrate, no detectable absorbance was observed even after 72 h indicating that this protein did not possess glucanase activity.

It was reported that transgenic tobacco plants overexpressing rice thaumatin-like protein showed enhanced resistance to Alternaria alternate [39]. Similarly, transgenic tobacco plants overexpressing thaumatin-like protein gene from cotton fibre showed enhanced resistance against Verticillium dahliae [40]. For this reason, the antifungal activity of AdTLP in tobacco transgenic plants was checked against a wide range of plant pathogenic fungi. Rhizoctonia solani, which infects the roots and lower parts of the stem, is a serious pathogen affecting a large number of plant species [41] and one of the test pathogens used in the present study. Our results showed that the progeny plants of the primary transgenic plant 7 exhibited superior tolerance with no signs of any infection even after 10 dpi, whereas infection symptoms developed late in progeny of the plant 4. WT plants were seriously affected and damaged completely after infection. Difference in the level of resistance between plants 7 and 4 could be correlated with expression level of AdTLP gene. The experiment showed in vivo effectiveness of AdTLP protein during fungal attack.

Earlier studies suggested the involvement of TLPs in enhancing tolerance to various abiotic stresses in plants with heterologous/ constitutive/ enhanced expression of TLPs. For instance, the transcript level of wheat TLP increased remarkably after the treatment with ABA and elicitors [42]. Similarly, Wang et al. [34] showed that the expression levels of CkTLP from Cynanchum komarovii seeds got upregulated during ABA, NaCl, drought, MeJA and SA treatments indicating that CkTLP might play an important role in response to abiotic stresses also. Transgenic approaches also confirmed their role in enhanced tolerance in transgenic plants expressing TLPs. Rajam et al. [43] reported higher percentage of transgenic seed germination and survival during salt and drought stress conditions in transgenic tobacco plants expressing Thaumatococcus daniellii TLP. A cotton fibre TLP gene, as discussed above, was also involved in tolerance during salt, drought and oxidative stress [40].

The present set of tobacco transgenic plants expressing AdTLP also exhibited tolerance to sodium chloride (osmotic/oxidative stress) and hydrogen peroxide (oxidative stress) when checked in vitro. Treatment with 200 and 300mM NaCl showed that transgenic plants 7 and 4 tolerated 200mM salt stress treatment, whereas the high expression plant 7 was better capable of tolerating 300 mM treatment.

Accumulation of reactive oxygen species occurs during the salt stress condition causing oxidative damage to the membrane proteins, lipids and nucleic acid [44]. It leads to the chloroplast damage and depletion in the chlorophyll levels. Membrane damage results in higher TBARS levels in plants under stress. In case of AdTLP, the higher chlorophyll contents and lower TBARS suggested that the transgenic lines were more salt tolerant compared to WT with significant lower membrane damage. The transgenic tobacco plants overexpressing GbTLP were able to tolerate H2O2 stress condition upto 2% and maintain higher chlorophyll content [40]. Hence, direct effect of oxidative stress was also checked by transferring WT and transgenic seedlings on 2% H2O2 media. Despite chlorosis that appeared after 12 days of treatment, transgenic seedlings showed higher chlorophyll content with low TBARS value compared to WT and indicated their higher tolerance level with less chloroplast damage and better membrane integrity. Based on the recovery results, it appears that the constitutive expression of AdTLP can partially reverse the stress induced growth inhibition.

Recent studies have shown that PR5 proteins are not the eventual component of signal transduction cascade. They might indirectly contribute to other defense regulatory mechanisms in plants. A TLP protein from Prunus domestica was involved in activating the genes of phenylpropanoid and phytoalexin pathways in Arabidopsis along with antifungal activity [45]. Similarly CsTLP from Camellia sinensis was assosiated with the activation of LOX and phenylpropanoid pathway in potato [46]. In addition, PR5 overexpression has been found to increase H+-ATPase activity, improved seed germination and involved during senescence in other species [47–49]. In order to verify the involvement of AdTLP in defense responses, we studied the transcript levels of various defense related genes in WT and transgenic tobacco plants using semi-quantitative RT-PCR. The transgenic lines showed higher transcript levels of PR1a, PI-I and PI-II genes compared to WT. PI-I and PI-II encode protease inhibitors and are believed to be the components of insect defense mechanism in plants. Various TLPs have been reported to be induced during wounding and insect attack [50–52]. Microarray analysis of maize seedling during insect attack had shown differential expression of thaumatin-like protein genes along with other genes [53]. Significant increase in TLP expression occurred in poplar phloem during wound treatment and the protein presence was confirmed by immunolocalization studies [54]. The exact reason of TLPs involvement during such stress events has not yet been clearly elucidated. Though α-amylase and protease inhibitor activities are major modes of action of plant resistance proteins to insect attack, these possibilities have been ruled out for PR5 proteins [55]. Our observation during this study indicated that AdTLP protein might play some role in plant defense during insect attack by inducing PI-I and PI-II genes in transgenic lines. However, due to lack of full understanding about the mode of action of TLPs [5,56], it is difficult at present to predict the exact mechanism behind the induction of other genes in AdTLP transgenic plants.

There are several examples suggesting that TLPs can interact with a variety of ligands and proteins including actin [57], cytokinin [58] and viral proteins [59]. The reason behind their involvement in various functions can be understood based on their ability to adopt functional diversification despite their conserved nature. Probably these became possible in TLPs through multiple functions due to the mutations in appropriate amino acid residues, which might have occurred during the course of evolution [5]. Not only TLPs but also other PR proteins like PR3 [60] and PR14 [61] have also been reported in diversified functions. Finally, our observations suggest that further in depth study is needed for AdTLP to explain the mode of action and their involvement in induction of other genes, which ultimately could help unravel a better picture in understanding the functional aspects of TLPs.

Conclusion

In summary, we have amplified full length AdTLP gene from Arachis diogoi (a wild species related to the economically important legume crop peanut), which was expressed in its interaction with the pathogen, Phaeoisariopsis personata. The in vivo and in vitro activities of a thaumatin-like protein have been analyzed. The protein has imparted significant resistance against fungal pathogens, salt and oxidative stress. Apart from this, the transgenic plants also displayed higher transcript level of PR1a, PI-I and PI-II gene compared to WT. Taken together, these observations suggest that the AdTLP can be a good candidate gene for deployment in transgenic plants for enhancing their tolerance against various biotic and abiotic stresses.

Supporting Information

Figure S1

12% SDS-PAGE analysis showing protein profiles. (M) Protein marker, (UI & I) uninduced and induced proteins respectively.

(TIF)

Table S1

Sequences of gene specific primers used in semi-quantitative RT-PCR for amplification of defence related gene transcripts.

(DOCX)

Acknowledgments

The authors are grateful to DBT-CREBB, DST-FIST, UGC-SAP, for the facilities provided to the Department of Plant Sciences, University of Hyderabad. The authors are also thankful to Dr. S. Vijayan, Pondicherry Biotech Private Limited, Puducherry, India for his suggestions during antifungal studies. The gift of the Arachis diogoi seed sample from the International Crops Research Institute for Semi-Arid Tropics, patancheru, India is also acknowledged.

Funding Statement

This work was supported by a grant from the Council of Scientific and Industrial Research (grant no. 38-1290/11/EMR-II), Government of India. KRRK was supported by Dr. D. S. Kothari postdoctoral fellowship from UGC. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Kombrink E, Somssich IE (1997) Pathogenesis-Related Proteins and Plant Defense. In: Carroll G, Tudzynski P. Plant Relationships: Springer; Berlin: Heidelberg. pp. 107-128 [Google Scholar]
  • 2. Chadha P, Das RH (2006) A pathogenesis related protein, AhPR10 from peanut: an insight of its mode of antifungal activity. Planta 225: 213-222. doi: 10.1007/s00425-006-0344-7. PubMed: 16832688. [DOI] [PubMed] [Google Scholar]
  • 3. van Loon LC, Rep M, Pieterse CM (2006) Significance of inducible defense-related proteins in infected plants. Annu Rev Phytopathol 44: 135-162. doi: 10.1146/annurev.phyto.44.070505.143425. PubMed: 16602946. [DOI] [PubMed] [Google Scholar]
  • 4. Cornelissen BJ, Hooft van Huijsduijnen RA, Bol JF (1986) A tobacco mosaic virus-induced tobacco protein is homologous to the sweet-tasting protein thaumatin. Nature 321: 531-532. doi: 10.1038/321531a0. PubMed: 3713832. [DOI] [PubMed] [Google Scholar]
  • 5. Liu JJ, Sturrock R, Ekramoddoullah AK (2010) The superfamily of thaumatin-like proteins: its origin, evolution, and expression towards biological function. Plant Cell Rep 29: 419-436. doi: 10.1007/s00299-010-0826-8. PubMed: 20204373. [DOI] [PubMed] [Google Scholar]
  • 6. Tachi H, Fukuda-Yamada K, Kojima T, Shiraiwa M, Takahara H (2009) Molecular characterization of a novel soybean gene encoding a neutral PR-5 protein induced by high-salt stress. Plant Physiol Biochem 47: 73-79. doi: 10.1016/j.plaphy.2008.09.012. PubMed: 19010689. [DOI] [PubMed] [Google Scholar]
  • 7. Velazhahan R, Datta KS, Muthukrishnan S (1999) The PR-5 family: thaumatin like protein in plants. In: Datta Sk, Muthukrishnan S, editors. Pathogenesis-related proteins in plants. CRC press; Boca Raton: . pp. 107-129 [Google Scholar]
  • 8. Fierens E, Gebruers K, Voet AR, De Maeyer M, Courtin CM et al. (2009) Biochemical and structural characterization of TLXI, the Triticum aestivum L. thaumatin-like xylanase inhibitor. J Enzyme Inhib Med Chem 24: 646-654. doi: 10.1080/14756360802321831. PubMed: 18951281. [DOI] [PubMed] [Google Scholar]
  • 9. Garcia-Casado G, Collada C, Allona I, Soto A, Casado R et al. (2000) Characterization of an apoplastic basic thaumatin-like protein from recalcitrant chestnut seeds. Physiologia Plantarum 110: 172-180. doi: 10.1034/j.1399-3054.2000.110205.x. [DOI] [Google Scholar]
  • 10. Chu KT, Ng TB (2003) Isolation of a large thaumatin-like antifungal protein from seeds of the Kweilin chestnut Castanopsis chinensis . Biochem Biophys Res Commun 301: 364-370. doi: 10.1016/S0006-291X(02)02998-4. PubMed: 12565869. [DOI] [PubMed] [Google Scholar]
  • 11. Ho VS, Wong JH, Ng TB (2007) A thaumatin-like antifungal protein from the emperor banana. Peptides 28: 760-766. doi: 10.1016/j.peptides.2007.01.005. PubMed: 17306420. [DOI] [PubMed] [Google Scholar]
  • 12. Jami SK, Swathi Anuradha T, Guruprasad L, Kirti PB (2007) Molecular, biochemical and structural characterization of osmotin-like protein from black nightshade (Solanum nigrum). J Plant Physiol 164: 238-252. doi: 10.1016/j.jplph.2006.01.006. PubMed: 16542753. [DOI] [PubMed] [Google Scholar]
  • 13. Roberts WK, Selitrennikoff CP (1990) Zeamatin, an antifungal protein from maize with membrane-permeabilizing activity. Journal of General Microbiology 136: 1771-1778. doi: 10.1099/00221287-136-9-1771. [DOI] [Google Scholar]
  • 14. Grenier J, Potvin C, Trudel J, Asselin A (1999) Some thaumatin-like proteins hydrolyse polymeric beta-1,3-glucans. Plant J 19: 473-480. doi: 10.1046/j.1365-313X.1999.00551.x. PubMed: 10504569. [DOI] [PubMed] [Google Scholar]
  • 15. Fierens E, Rombouts S, Gebruers K, Goesaert H, Brijs K et al. (2007) TLXI, a novel type of xylanase inhibitor from wheat (Triticum aestivum) belonging to the thaumatin family. Biochem J 403: 583-591. doi: 10.1042/BJ20061291. PubMed: 17269932. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Fu D, Tisserat NA, Xiao Y, Settle D, Muthukrishnan S et al. (2005) Overexpression of rice TLPD34 enhances dollar-spot resistance in transgenic bentgrass. Plant Sciences 168: 671-680. doi: 10.1016/j.plantsci.2004.09.032. [DOI] [Google Scholar]
  • 17. Mackintosh CA, Lewis J, Radmer LE, Shin S, Heinen SJ et al. (2007) Overexpression of defense response genes in transgenic wheat enhances resistance to Fusarium head blight. Plant Cell Rep 26: 479-488. doi: 10.1007/s00299-006-0265-8. PubMed: 17103001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Hon WC, Griffith M, Mlynarz A, Kwok YC, Yang DS (1995) Antifreeze proteins in winter rye are similar to pathogenesis-related proteins. Plant Physiol 109: 879-889. doi: 10.1104/pp.109.3.879. PubMed: 8552719. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Pressey R (1997) Two isoforms of NP24: a thaumatin-like protein in tomato fruit. Phytochemistry 44: 1241-1245. doi: 10.1016/S0031-9422(96)00667-X. PubMed: 9115696. [DOI] [PubMed] [Google Scholar]
  • 20. Kameswara Rao N, Reddy LJ, Bramel PJ (2003) Potential of wild species for genetic enhancement of some semi-arid food crops. Genetic Resources and Crop Evolution 50: 707-721. doi: 10.1023/A:1025055018954. [DOI] [Google Scholar]
  • 21. Pande S, Rao JN (2001) Resistance of wild Arachis species to late leaf spot and rust in greenhouse trials. Plant Disease 85: 851-855. doi: 10.1094/PDIS.2001.85.8.851. [DOI] [PubMed] [Google Scholar]
  • 22. Kumar KR, Kirti PB (2011) Differential gene expression in Arachis diogoi upon interaction with peanut late leaf spot pathogen, Phaeoisariopsis personata and characterization of a pathogen induced cyclophilin. Plant Mol Biol 75: 497-513. doi: 10.1007/s11103-011-9747-3. PubMed: 21298396. [DOI] [PubMed] [Google Scholar]
  • 23. Song X, Wang J, Wu F, Li X, Teng M et al. (2005) cDNA cloning, functional expression and antifungal activities of a dimeric plant defensin SPE10 from Pachyrrhizus erosus seeds. Plant Mol Biol 57: 13-20. doi: 10.1007/s11103-004-6637-y. PubMed: 15821865. [DOI] [PubMed] [Google Scholar]
  • 24. Vijayan S, Guruprasad L, Kirti PB (2008) Prokaryotic expression of a constitutively expressed Tephrosia villosa defensin and its potent antifungal activity. Appl Microbiol Biotechnol 80: 1023-1032. doi: 10.1007/s00253-008-1648-2. PubMed: 18726095. [DOI] [PubMed] [Google Scholar]
  • 25. Looze Y, Boussard P, Huet J, Vandenbusche G, Azarkan M et al. (2009) Purification and characterization of a wound-inducible thaumatin-like protein from the latex of Carica papaya . Phytochemistry 70: 970-978. doi: 10.1016/j.phytochem.2009.05.005. PubMed: 19527911. [DOI] [PubMed] [Google Scholar]
  • 26. Horsch RB, Fry JE, Hoffmann NL, Eichholtz D, Rogers SG et al. (1985) A simple and general method for transferring genes into plants. Science 227: 1229-1230. doi: 10.1126/science.227.4691.1229. PubMed: 17757866. [DOI] [PubMed] [Google Scholar]
  • 27. Arnon DI (1949) Copper enzymes in isolated chloroplasts: polyphenoloxidase in Beta vulgaris . Plant Physiol 24: 1-15. doi: 10.1104/pp.24.1.1. PubMed: 16654194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Heath RL, Packer L (1968) Photoperoxidation in isolated chloroplasts. I. Kinetics and stoichiometry of fatty acid peroxidation. Arch Biochem Biophys 125: 189-198. doi: 10.1016/0003-9861(68)90654-1. PubMed: 5655425. [DOI] [PubMed] [Google Scholar]
  • 29. Datta K, Velazhahan R, Oliva N, Ona I, Mew T et al. (1999) Over-expression of the cloned rice thaumatin-like protein (PR-5) gene in transgenic rice plants enhances environmental friendly resistance to Rhizoctonia solani causing sheath blight disease. Theoretical and Applied Genetics 98: 1138-1145. doi: 10.1007/s001220051178. [DOI] [Google Scholar]
  • 30. Das M, Chauhan H, Chhibbar A, Rizwanul Haq QM, Khurana P (2011) High-efficiency transformation and selective tolerance against biotic and abiotic stress in mulberry, Morus indica cv. K2, by constitutive and inducible expression of tobacco osmotin. Transgenic Res 20: 231-246. doi: 10.1007/s11248-010-9405-6. PubMed: 20549349. [DOI] [PubMed] [Google Scholar]
  • 31. Goel D, Singh AK, Yadav V, Babbar SB, Bansal KC (2010) Overexpression of osmotin gene confers tolerance to salt and drought stresses in transgenic tomato (Solanum lycopersicum L.). Protoplasma 245: 133-141 [DOI] [PubMed]
  • 32. Ferreira RB, Monteiro S, Freitas R, Santos CN, Chen Z et al. (2007) The role of plant defence proteins in fungal pathogenesis. Mol Plant Pathol 8: 677-700. doi: 10.1111/j.1364-3703.2007.00419.x. PubMed: 20507530. [DOI] [PubMed] [Google Scholar]
  • 33. Wang X, Tang C, Deng L, Cai G, Liu X et al. (2010) Characterization of a pathogenesis-related thaumatin-like protein gene TaPR5 from wheat induced by stripe rust fungus. Physiol Plant 139: 27-38. doi: 10.1111/j.1399-3054.2009.01338.x. PubMed: 20059734. [DOI] [PubMed] [Google Scholar]
  • 34. Wang Q, Li F, Zhang X, Zhang Y, Hou Y et al. (2011) Purification and characterization of a CkTLP protein from Cynanchum komarovii seeds that confers antifungal activity. PLOS ONE 6: e16930. doi: 10.1371/journal.pone.0016930. PubMed: 21364945. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Kim B-G, Fukumoto T, Tatano S, Gomi K, Ohtani K et al. (2009) Molecular cloning and characterization of a thaumatin-like protein-encoding cDNA from rough lemon. Physiological and Molecular Plant Pathology 74: 3-10. doi: 10.1016/j.pmpp.2009.07.001. [DOI] [Google Scholar]
  • 36. Ye XY, Wang HX, Ng TB (1999) First chromatographic isolation of an antifungal thaumatin-like protein from French bean legumes and demonstration of its antifungal activity. Biochem Biophys Res Commun 263: 130-134. doi: 10.1006/bbrc.1999.1166. PubMed: 10486265. [DOI] [PubMed] [Google Scholar]
  • 37. Vitali A, Pacini L, Bordi E, De Mori P, Pucillo L et al. (2006) Purification and characterization of an antifungal thaumatin-like protein from Cassia didymobotrya cell culture. Plant Physiol Biochem 44: 604-610. doi: 10.1016/j.plaphy.2006.09.008. PubMed: 17056265. [DOI] [PubMed] [Google Scholar]
  • 38. Grenier J, Potvin C, Asselin A (2000) Some Fungi Express β-1,3-Glucanases Similar to Thaumatin-like Proteins. Mycologia 92: 841-848. doi: 10.2307/3761579. [DOI] [Google Scholar]
  • 39. Velazhahan R, Muthukrishnan S (2003) Transgenic Tobacco Plants Constitutively Overexpressing a Rice Thaumatin-like Protein (PR-5) Show Enhanced Resistance to Alternaria alternata . Biologia Plantarum 47: 347-354. [Google Scholar]
  • 40. Munis MF, Tu L, Deng F, Tan J, Xu L et al. (2010) A thaumatin-like protein gene involved in cotton fiber secondary cell wall development enhances resistance against Verticillium dahliae and other stresses in transgenic tobacco. Biochem Biophys Res Commun 393: 38-44. doi: 10.1016/j.bbrc.2010.01.069. PubMed: 20097164. [DOI] [PubMed] [Google Scholar]
  • 41. Ogoshi A (1996) Introduction - the genus Rhizoctonia. In: Sneh B, Jabaji-Hare S, Neate S, Dijst G. Rhizoctonia species: taxonomy, molecular biology, ecology, pathology and disease control. Kluwer Academic, Dordrecht: pp 1-9. [Google Scholar]
  • 42. Kuwabara C, Takezawa D, Shimada T, Hamada T, Fujikawa S et al. (2002) Abscisic acid- and cold-induced thaumatin-like protein in winter wheat has an antifungal activity against snow mould, Microdochium nivale . Physiol Plant 115: 101-110. doi: 10.1034/j.1399-3054.2002.1150112.x. PubMed: 12010473. [DOI] [PubMed] [Google Scholar]
  • 43. Rajam MV, Chandola N, Saiprasad Goud P, Singh D, Kashyap V et al. (2007) Thaumatin gene confers resistance to fungal pathogens as well as tolerance to abiotic stresses in transgenic tobacco plants. Biologia Plantarum 51: 135-141. doi: 10.1007/s10535-007-0026-8. [DOI] [Google Scholar]
  • 44. Chinnusamy V, Jagendorf A, Zhu J-K (2005) Understanding and Improving Salt Tolerance in Plants. Crop Sci 45: 437-448. doi: 10.2135/cropsci2005.0437. [DOI] [Google Scholar]
  • 45. El-kereamy A, El-sharkawy I, Ramamoorthy R, Taheri A, Errampalli D et al. (2011) Prunus domestica pathogenesis-related protein-5 activates the defense response pathway and enhances the resistance to fungal infection. PLOS ONE 6: e17973. doi: 10.1371/journal.pone.0017973. PubMed: 21448276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Acharya K, Pal AK, Gulati A, Kumar S, Singh AK et al. (2013) Overexpression of Camellia sinensis thaumatin-like protein, CsTLP in potato confers enhanced resistance to Macrophomina phaseolina and Phytophthora infestans infection. Mol Biotechnol 54: 609-622. doi: 10.1007/s12033-012-9603-y. PubMed: 23086453. [DOI] [PubMed] [Google Scholar]
  • 47. Ladyzhenskaia EP, Korableva NP (2006) The effect of thaumatin gene overexpression on the properties of H(+)-ATPase from the plasmalemma of potato tuber cells. Prikl Biokhim Mikrobiol 42: 462-467. PubMed: 17022457. [PubMed] [Google Scholar]
  • 48. Sakamoto Y, Watanabe H, Nagai M, Nakade K, Takahashi M et al. (2006) Lentinula edodes tlg1 encodes a thaumatin-like protein that is involved in lentinan degradation and fruiting body senescence. Plant Physiol 141: 793-801. doi: 10.1104/pp.106.076679. PubMed: 16648221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Seo PJ, Lee AK, Xiang F, Park CM (2008) Molecular and functional profiling of Arabidopsis pathogenesis-related genes: insights into their roles in salt response of seed germination. Plant Cell Physiol 49: 334-344. doi: 10.1093/pcp/pcn011. PubMed: 18203731. [DOI] [PubMed] [Google Scholar]
  • 50. Gao LL, Anderson JP, Klingler JP, Nair RM, Edwards OR et al. (2007) Involvement of the octadecanoid pathway in bluegreen aphid resistance in Medicago truncatula . Mol Plant Microbe Interact 20: 82-93. doi: 10.1094/MPMI-20-0082. PubMed: 17249425. [DOI] [PubMed] [Google Scholar]
  • 51. Kempema LA, Cui X, Holzer FM, Walling LL (2007) Arabidopsis transcriptome changes in response to phloem-feeding silverleaf whitefly nymphs. Similarities and distinctions in responses to aphids. Plant Physiol 143: 849-865. PubMed: 17189325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Zarate SI, Kempema LA, Walling LL (2007) Silverleaf whitefly induces salicylic acid defenses and suppresses effectual jasmonic acid defenses. Plant Physiol 143: 866-875. PubMed: 17189328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Johnson ET, Dowd PF, Liu ZL, Musser RO (2011) Comparative transcription profiling analyses of maize reveals candidate defensive genes for seedling resistance against corn earworm. Mol Genet Genomics 285: 517-525. doi: 10.1007/s00438-011-0626-z. PubMed: 21556895. [DOI] [PubMed] [Google Scholar]
  • 54. Dafoe NJ, Zamani A, Ekramoddoullah AK, Lippert D, Bohlmann J et al. (2009) Analysis of the poplar phloem proteome and its response to leaf wounding. J Proteome Res 8: 2341-2350. doi: 10.1021/pr800968r. PubMed: 19245218. [DOI] [PubMed] [Google Scholar]
  • 55. Gómez-Leyva JF, Blanco-Labra A (2001) Bifunctional α-amylase/trypsin inhibitor activity previously ascribed to the 22 KDa TL protein, resided in a contaminant protein of 14 KDa. J Plant Physiol 158: 177-183. doi: 10.1078/0176-1617-00191. [DOI] [Google Scholar]
  • 56. Franco OL, Rigden DJ, Melo FR, Grossi-De-Sá MF (2002) Plant alpha-amylase inhibitors and their interaction with insect alpha-amylases. Eur J Biochem 269: 397-412. doi: 10.1046/j.0014-2956.2001.02656.x. PubMed: 11856298. [DOI] [PubMed] [Google Scholar]
  • 57. Takemoto D, Furuse K, Doke N, Kawakita K (1997) Identification of chitinase and osmotin-like protein as actin-binding proteins in suspension-cultured potato cells. Plant Cell Physiol 38: 441-448. doi: 10.1093/oxfordjournals.pcp.a029187. PubMed: 9177030. [DOI] [PubMed] [Google Scholar]
  • 58. Kobayashi K, Fukuda M, Igarashi D, Sunaoshi M (2000) Cytokinin-binding proteins from tobacco callus share homology with osmotin-like protein and an endochitinase. Plant Cell Physiol 41: 148-157. doi: 10.1093/pcp/41.2.148. PubMed: 10795308. [DOI] [PubMed] [Google Scholar]
  • 59. Kim MJ, Ham BK, Kim HR, Lee IJ, Kim YJ et al. (2005) In vitro and in planta interaction evidence between Nicotiana tabacum thaumatin-like protein 1 (TLP1) and cucumber mosaic virus proteins. Plant Mol Biol 59: 981-994. doi: 10.1007/s11103-005-2619-y. PubMed: 16307370. [DOI] [PubMed] [Google Scholar]
  • 60. Yeh S, Moffatt BA, Griffith M, Xiong F, Yang DS et al. (2000) Chitinase genes responsive to cold encode antifreeze proteins in winter cereals. Plant Physiol 124: 1251-1264. doi: 10.1104/pp.124.3.1251. PubMed: 11080301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Doxey AC, Yaish MW, Griffith M, McConkey BJ (2006) Ordered surface carbons distinguish antifreeze proteins and their ice-binding regions. Nat Biotechnol 24: 852-855. doi: 10.1038/nbt1224. PubMed: 16823370. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

12% SDS-PAGE analysis showing protein profiles. (M) Protein marker, (UI & I) uninduced and induced proteins respectively.

(TIF)

Table S1

Sequences of gene specific primers used in semi-quantitative RT-PCR for amplification of defence related gene transcripts.

(DOCX)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES