Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 1986 Nov;83(21):8112–8116. doi: 10.1073/pnas.83.21.8112

Requirement of multiple copies of a 21-nucleotide sequence in the U3 regions of human T-cell leukemia virus type I and type II long terminal repeats for trans-acting activation of transcription.

K Shimotohno, M Takano, T Teruuchi, M Miwa
PMCID: PMC386877  PMID: 3022280

Abstract

The cis-acting regulatory sequence of transcription from long terminal repeats (LTRs) of human T-cell leukemia virus type I and type II (HTLV-I and HTLV-II), which is essential for action of the virally encoded trans-acting transcriptional factor(s) designated pX(s), in HTLV-I and -II was identified. Deletion of most of the U3 region of the HTLV-I LTR resulted in loss of trans-acting transcriptional activation. However, when a tandem repeat of a 21-nucleotide sequence (GAAGGCTCTGACGTCTCCCCC) that is present in the U3 region of HTLV-I and -II LTRs was inserted into the deleted U3 region of the HTLV-I LTRs, chloramphenicol acetyltransferase activity was restored. The extent of restoration of activity was proportional to the number of copies of the sequence inserted. To test the possibility that the 21-nucleotide sequence alone is necessary for trans-activation, a sequence (AGGAACTGAAA) homologous to a type-specific viral enhancer sequence and present in the U3 region of HTLV-II LTR, but not in the same region of the HTLV-I LTR, was inserted together with the 21-nucleotide sequence into the deleted U3 region of the HTLV-I LTR. However, no significant differences of the levels of activities of those LTRs compared to the LTRs with only the 21-nucleotide sequence repeats were observed.

Full text

PDF
8112

Images in this article

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Banerji J., Olson L., Schaffner W. A lymphocyte-specific cellular enhancer is located downstream of the joining region in immunoglobulin heavy chain genes. Cell. 1983 Jul;33(3):729–740. doi: 10.1016/0092-8674(83)90015-6. [DOI] [PubMed] [Google Scholar]
  2. Cann A. J., Rosenblatt J. D., Wachsman W., Shah N. P., Chen I. S. Identification of the gene responsible for human T-cell leukaemia virus transcriptional regulation. Nature. 1985 Dec 12;318(6046):571–574. doi: 10.1038/318571a0. [DOI] [PubMed] [Google Scholar]
  3. Chen I. S., Quan S. G., Golde D. W. Human T-cell leukemia virus type II transforms normal human lymphocytes. Proc Natl Acad Sci U S A. 1983 Nov;80(22):7006–7009. doi: 10.1073/pnas.80.22.7006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Derse D., Caradonna S. J., Casey J. W. Bovine leukemia virus long terminal repeat: a cell type-specific promoter. Science. 1985 Jan 18;227(4684):317–320. doi: 10.1126/science.2981431. [DOI] [PubMed] [Google Scholar]
  5. Derse D., Casey J. W. Two elements in the bovine leukemia virus long terminal repeat that regulate gene expression. Science. 1986 Mar 21;231(4744):1437–1440. doi: 10.1126/science.3006241. [DOI] [PubMed] [Google Scholar]
  6. Felber B. K., Paskalis H., Kleinman-Ewing C., Wong-Staal F., Pavlakis G. N. The pX protein of HTLV-I is a transcriptional activator of its long terminal repeats. Science. 1985 Aug 16;229(4714):675–679. doi: 10.1126/science.2992082. [DOI] [PubMed] [Google Scholar]
  7. Fujisawa J., Seiki M., Kiyokawa T., Yoshida M. Functional activation of the long terminal repeat of human T-cell leukemia virus type I by a trans-acting factor. Proc Natl Acad Sci U S A. 1985 Apr;82(8):2277–2281. doi: 10.1073/pnas.82.8.2277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Fujisawa J., Seiki M., Sato M., Yoshida M. A transcriptional enhancer sequence of HTLV-I is responsible for trans-activation mediated by p40 chi HTLV-I. EMBO J. 1986 Apr;5(4):713–718. doi: 10.1002/j.1460-2075.1986.tb04272.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Gorman C. M., Merlino G. T., Willingham M. C., Pastan I., Howard B. H. The Rous sarcoma virus long terminal repeat is a strong promoter when introduced into a variety of eukaryotic cells by DNA-mediated transfection. Proc Natl Acad Sci U S A. 1982 Nov;79(22):6777–6781. doi: 10.1073/pnas.79.22.6777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Gorman C. M., Moffat L. F., Howard B. H. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol. 1982 Sep;2(9):1044–1051. doi: 10.1128/mcb.2.9.1044-1051.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Graham F. L., van der Eb A. J. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology. 1973 Apr;52(2):456–467. doi: 10.1016/0042-6822(73)90341-3. [DOI] [PubMed] [Google Scholar]
  12. Hearing P., Shenk T. The adenovirus type 5 E1A transcriptional control region contains a duplicated enhancer element. Cell. 1983 Jul;33(3):695–703. doi: 10.1016/0092-8674(83)90012-0. [DOI] [PubMed] [Google Scholar]
  13. Hoshino H., Esumi H., Miwa M., Shimoyama M., Minato K., Tobinai K., Hirose M., Watanabe S., Inada N., Kinoshita K. Establishment and characterization of 10 cell lines derived from patients with adult T-cell leukemia. Proc Natl Acad Sci U S A. 1983 Oct;80(19):6061–6065. doi: 10.1073/pnas.80.19.6061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Josephs S. F., Wong-Staal F., Manzari V., Gallo R. C., Sodroski J. G., Trus M. D., Perkins D., Patarca R., Haseltine W. A. Long terminal repeat structure of an American isolate of type I human T-cell leukemia virus. Virology. 1984 Dec;139(2):340–345. doi: 10.1016/0042-6822(84)90379-9. [DOI] [PubMed] [Google Scholar]
  15. Kiyokawa T., Seiki M., Imagawa K., Shimizu F., Yoshida M. Identification of a protein (p40x) encoded by a unique sequence pX of human T-cell leukemia virus type I. Gan. 1984 Sep;75(9):747–751. [PubMed] [Google Scholar]
  16. Kiyokawa T., Seiki M., Iwashita S., Imagawa K., Shimizu F., Yoshida M. p27x-III and p21x-III, proteins encoded by the pX sequence of human T-cell leukemia virus type I. Proc Natl Acad Sci U S A. 1985 Dec;82(24):8359–8363. doi: 10.1073/pnas.82.24.8359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Lee T. H., Coligan J. E., Sodroski J. G., Haseltine W. A., Salahuddin S. Z., Wong-Staal F., Gallo R. C., Essex M. Antigens encoded by the 3'-terminal region of human T-cell leukemia virus: evidence for a functional gene. Science. 1984 Oct 5;226(4670):57–61. doi: 10.1126/science.6089350. [DOI] [PubMed] [Google Scholar]
  18. Levinson B., Khoury G., Vande Woude G., Gruss P. Activation of SV40 genome by 72-base pair tandem repeats of Moloney sarcoma virus. Nature. 1982 Feb 18;295(5850):568–572. doi: 10.1038/295568a0. [DOI] [PubMed] [Google Scholar]
  19. Luciw P. A., Bishop J. M., Varmus H. E., Capecchi M. R. Location and function of retroviral and SV40 sequences that enhance biochemical transformation after microinjection of DNA. Cell. 1983 Jul;33(3):705–716. doi: 10.1016/0092-8674(83)90013-2. [DOI] [PubMed] [Google Scholar]
  20. Miwa M., Shimotohno K., Hoshino H., Fujino M., Sugimura T. Detection of pX proteins in human T-cell leukemia virus (HTLV)-infected cells by using antibody against peptide deduced from sequences of X-IV DNA of HTLV-I and Xc DNA of HTLV-II proviruses. Gan. 1984 Sep;75(9):752–755. [PubMed] [Google Scholar]
  21. Miyoshi I., Kubonishi I., Yoshimoto S., Akagi T., Ohtsuki Y., Shiraishi Y., Nagata K., Hinuma Y. Type C virus particles in a cord T-cell line derived by co-cultivating normal human cord leukocytes and human leukaemic T cells. Nature. 1981 Dec 24;294(5843):770–771. doi: 10.1038/294770a0. [DOI] [PubMed] [Google Scholar]
  22. Popovic M., Sarin P. S., Robert-Gurroff M., Kalyanaraman V. S., Mann D., Minowada J., Gallo R. C. Isolation and transmission of human retrovirus (human t-cell leukemia virus). Science. 1983 Feb 18;219(4586):856–859. doi: 10.1126/science.6600519. [DOI] [PubMed] [Google Scholar]
  23. Renan M. J. Sequence homologies in the control regions of c-myc, c-fos, HTLV and the interleukin-2 receptor. Cancer Lett. 1985 Aug;28(1):69–76. doi: 10.1016/0304-3835(85)90094-1. [DOI] [PubMed] [Google Scholar]
  24. Rosen C. A., Sodroski J. G., Haseltine W. A. Location of cis-acting regulatory sequences in the human T-cell leukemia virus type I long terminal repeat. Proc Natl Acad Sci U S A. 1985 Oct;82(19):6502–6506. doi: 10.1073/pnas.82.19.6502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Rosen C. A., Sodroski J. G., Kettman R., Burny A., Haseltine W. A. Trans activation of the bovine leukemia virus long terminal repeat in BLV-infected cells. Science. 1985 Jan 18;227(4684):320–322. doi: 10.1126/science.2981432. [DOI] [PubMed] [Google Scholar]
  26. Rosen C. A., Sodroski J. G., Kettman R., Haseltine W. A. Activation of enhancer sequences in type II human T-cell leukemia virus and bovine leukemia virus long terminal repeats by virus-associated trans-acting regulatory factors. J Virol. 1986 Mar;57(3):738–744. doi: 10.1128/jvi.57.3.738-744.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Seiki M., Hattori S., Hirayama Y., Yoshida M. Human adult T-cell leukemia virus: complete nucleotide sequence of the provirus genome integrated in leukemia cell DNA. Proc Natl Acad Sci U S A. 1983 Jun;80(12):3618–3622. doi: 10.1073/pnas.80.12.3618. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Seiki M., Inoue J., Takeda T., Hikikoshi A., Sato M., Yoshida M. The p40x of human T-cell leukemia virus type I is a trans-acting activator of viral gene transcription. Jpn J Cancer Res. 1985 Dec;76(12):1127–1131. [PubMed] [Google Scholar]
  29. Shimotohno K., Golde D. W., Miwa M., Sugimura T., Chen I. S. Nucleotide sequence analysis of the long terminal repeat of human T-cell leukemia virus type II. Proc Natl Acad Sci U S A. 1984 Feb;81(4):1079–1083. doi: 10.1073/pnas.81.4.1079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Shimotohno K., Miwa M., Slamon D. J., Chen I. S., Hoshino H., Takano M., Fujino M., Sugimura T. Identification of new gene products coded from X regions of human T-cell leukemia viruses. Proc Natl Acad Sci U S A. 1985 Jan;82(2):302–306. doi: 10.1073/pnas.82.2.302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Shimotohno K., Takahashi Y., Shimizu N., Gojobori T., Golde D. W., Chen I. S., Miwa M., Sugimura T. Complete nucleotide sequence of an infectious clone of human T-cell leukemia virus type II: an open reading frame for the protease gene. Proc Natl Acad Sci U S A. 1985 May;82(10):3101–3105. doi: 10.1073/pnas.82.10.3101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Slamon D. J., Shimotohno K., Cline M. J., Golde D. W., Chen I. S. Identification of the putative transforming protein of the human T-cell leukemia viruses HTLV-I and HTLV-II. Science. 1984 Oct 5;226(4670):61–65. doi: 10.1126/science.6089351. [DOI] [PubMed] [Google Scholar]
  33. Sodroski J. G., Rosen C. A., Haseltine W. A. Trans-acting transcriptional activation of the long terminal repeat of human T lymphotropic viruses in infected cells. Science. 1984 Jul 27;225(4660):381–385. doi: 10.1126/science.6330891. [DOI] [PubMed] [Google Scholar]
  34. Sodroski J., Rosen C., Goh W. C., Haseltine W. A transcriptional activator protein encoded by the x-lor region of the human T-cell leukemia virus. Science. 1985 Jun 21;228(4706):1430–1434. doi: 10.1126/science.2990028. [DOI] [PubMed] [Google Scholar]
  35. Sodroski J., Trus M., Perkins D., Patarca R., Wong-Staal F., Gelmann E., Gallo R., Haseltine W. A. Repetitive structure in the long-terminal-repeat element of a type II human T-cell leukemia virus. Proc Natl Acad Sci U S A. 1984 Aug;81(15):4617–4621. doi: 10.1073/pnas.81.15.4617. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Takahashi K., Vigneron M., Matthes H., Wildeman A., Zenke M., Chambon P. Requirement of stereospecific alignments for initiation from the simian virus 40 early promoter. Nature. 1986 Jan 9;319(6049):121–126. doi: 10.1038/319121a0. [DOI] [PubMed] [Google Scholar]
  37. Yamamoto N., Okada M., Koyanagi Y., Kannagi M., Hinuma Y. Transformation of human leukocytes by cocultivation with an adult T cell leukemia virus producer cell line. Science. 1982 Aug 20;217(4561):737–739. doi: 10.1126/science.6980467. [DOI] [PubMed] [Google Scholar]
  38. Zenke M., Grundström T., Matthes H., Wintzerith M., Schatz C., Wildeman A., Chambon P. Multiple sequence motifs are involved in SV40 enhancer function. EMBO J. 1986 Feb;5(2):387–397. doi: 10.1002/j.1460-2075.1986.tb04224.x. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES