Skip to main content
PLOS One logoLink to PLOS One
. 2013 Dec 20;8(12):e85347. doi: 10.1371/journal.pone.0085347

Dietary Nisin Modulates the Gastrointestinal Microbial Ecology and Enhances Growth Performance of the Broiler Chickens

Damian Józefiak 1,*, Bartosz Kierończyk 1, Jerzy Juśkiewicz 2, Zenon Zduńczyk 2, Mateusz Rawski 1, Jakub Długosz 1, Anna Sip 3, Ole Højberg 4
Editor: Gunnar Loh5
PMCID: PMC3869907  PMID: 24376878

Abstract

Due to antimicrobial properties, nisin is one of the most commonly used and investigated bacteriocins for food preservation. Surprisingly, nisin has had limited use in animal feed as well as there are only few reports on its influence on microbial ecology of the gastrointestinal tract (GIT). The present study therefore aimed at investigating effects of dietary nisin on broiler chicken GIT microbial ecology and performance in comparison to salinomycin, the widely used ionophore coccidiostat. In total, 720 one-day-old male Ross 308 chicks were randomly distributed to six experimental groups. The positive control (PC) diet was supplemented with salinomycin (60 mg/kg). The nisin (NI) diets were supplemented with increasing levels (100, 300, 900 and 2700 IU nisin/g, respectively) of the bacteriocin. The negative control (NC) diet contained no additives. At slaughter (35 days of age), activity of specific bacterial enzymes (α- and β-glucosidases, α-galactosidases and β-glucuronidase) in crop, ileum and caeca were significantly higher (P<0.05) in the NC group, and nisin supplementation decreased the enzyme activities to levels observed for the PC group. A similar inhibitory influence on bacterial activity was reflected in the levels of short-chain fatty acids (SCFA) and putrefactive SCFA (PSCFA) in digesta from crop and ileum; no effect was observed in caeca. Counts of Bacteroides and Enterobacteriacae in ileum digesta were significantly (P<0.001) decreased by nisin and salinomycin, but no effects were observed on the counts of Clostridium perfringens, Lactobacillus/Enterococcus and total bacteria. Like salinomycin, nisin supplementation improved broiler growth performance in a dose-dependent manner; compared to the NC group, the body weight gain of the NI900 and NI2700 groups was improved by 4.7 and 8.7%, respectively. Our findings suggest that dietary nisin exerts a mode of action similar to salinomycin and could be considered as a dietary supplement for broiler chickens.

Introduction

Lactic acid bacteria (LAB) of the genera Lactococcus, Streptococcus, Pediococcus, Leuconostoc, Lactobacillus and Carnobacterium are the most commonly used starter cultures in food industry. Their mode of action is mainly based on the antimicrobial effect of lactic acid and pH reduction in combination, but certain LAB are capable of producing different types of bacteriocins, which are small peptides, lethal to bacteria other than the producing strain, but most often with a rather narrow target spectrum in comparison to antibiotics.

Bacteriocins are found in the gastrointestinal tract (GIT) of animals, in soil as well as in food, e.g. fermented milk products, cheese, or meat. The widespread use of bacteriocins in food industry is due to their antimicrobial activity against key Gram-positive pathogens of food-borne diseases, such as Listeria monocytogenes or Staphylococcus aureus. In contrast, there is so far only limited information on their usage and efficacy in feed industry [1].

In a series of our studies, we have recently demonstrated significant effects of bacteriocin - divercin AS7 - on the broiler chicken GIT microbiota and fermentation status as well as bird performance [2-5]. Moreover, other studies have shown dietary efficacy of other bacteriocins in broiler chickens [6,7]. However, to our knowledge there are no available data on in vivo usage and effects of nisin; probably the most explored and commonly used bacteriocin in many types of human foodstuffs.

Nisin is a 34 amino acid residues peptide, with a molecular mass of 3.5 kDa and classified as a class-Ia bacteriocin or lantibiotic [8]. Its usage in food is approved by the European Union with the assigned E-number E234 (EEC, 1983). In USA it has been granted GRAS (Generally Recognized As Safe; notice no. GRN 000065) status by the United States Food and Drug Administration. However, nisin is not included in the European Union Register of Feed additives (EU 1831/2003). Thus, even though this bacteriocin appears in many dairy products and active packing systems, its usage in animal nutrition is still forbidden.

A recent study by Udompijitkul et al. [9] indicated that nisin exerts strong antimicrobial activity in a meat model system against different isolates of Clostridium perfringens; an important poultry pathogen. Earlier studies conducted by Bernbom et al. [10] have shown that application of nisin-producing Lactococcus lactis strain to rat diets, affected the composition of the intestinal microbiota by increasing Bifidobacterium numbers and suppressing the enterococci/streptococci population. The aim of the present study was therefore to evaluate the influence of dietary nisin on broiler chicken performance and GIT microbial ecology.

Material and Methods

Ethics statement

This study was carried out in strict accordance with the recommendations of the National Ethic Commission (Warsaw, Poland). All procedures and experiments complied with the guidelines and were approved by the Local Ethic Commission of the Poznań University of Life Sciences (Poznań, Poland) with respect to animal experimentation and care of animals under study, and all efforts were made to minimize suffering.

Birds and Housing

In total, 720 one-day-old male Ross 308 chicks were randomly distributed to 6 experimental groups using 12 replicate pens per treatment and 10 birds per pen. The broiler chickens were kept in floor pens (1.2 × 0.8 m) over a production period of 35 d. The birds were given 23 h of light and 1 h of dark during the first week and then 19 h of light and 5 h of dark from d 7 to 21. From 22 to 42 d of age, there was 23 h of light and 1 h of dark.

Diets and Feeding Program

The composition of the experimental diet is shown in Table 1. The nisin activity was expressed in international activity unit (IU). The diet was formulated to stimulate the proliferation of C. perfringens by use of viscous cereals (barley/wheat), animal fats (beef tallow/pig lard), and fishmeal [11-13]. The diets were prepared in mash form; all raw materials were ground by disc mill (Skiold A/S, Denmark) at 2.5 mm disc distance, mixed without any heat treatment, and fed ad libitum to the birds.

Table 1. Composition of the basal diets and its calculated nutritive value.

Ingredients (g/kg) Diet (1—35 d)
Wheat 326.8
Barley 250.0
Soyabean meal 215.4
Beef tallow 30.0
Pig lard 53.7
Double zero rapeseed meal 60.0
Fish meal 30.0
Monocalcium phosphate 11.0
Mineral-vitamin premix a 5.0
Limestone 4.2
L-Lysine –HCl 2.8
DL-Methionine 2.1
L-Threonine 0.3
Sodium carbonate (Na2CO3) 1.0
Salt (NaCl) 2.6
Titanium oxide (TiO2) b 2.0
Calculated nutritive value (g/kg)
ME (MJ/kg) 12.95
Crude protein 220.0
Crude fat 100.0
Crude fibre % 34.50
Calcium - Ca % 8.50
Lysine % 13.0
Methionine % 5.5
Methionine + Cystine % 9.3
Threonine % 8.1
P avilaible. 4.20
Analysed composition (g/kg)
Crude protein 214.0
Crude fibre 39.2
Crude fat 101.2
ME (MJ/kg) 12.89

a Providing the following per kilogram of diet: vitamin A (retinol), 11,166 IU; cholecalciferol, 2,500 IU; vitamin E (alpha tocopherol), 80 mg; menadione, 2.50 mg; cobalamin, 0.02 mg; folic acid, 1.17 mg; choline, 379 mg; D-pantothenic acid, 12.50 mg; riboflavin, 7.0 mg; niacin, 41.67 mg; thiamin, 2.17 mg; D-biotin, 0.18 mg; pyridoxine, 4.0 mg; ethoxyquin,0.09 mg; Mn (MnO2), 73 mg; Zn (ZnO), 55 mg; Fe (FeSO4), 45 mg; Cu (CuSO4), 20 mg;I (CaI2O6), 0.62 mg; Se (Na2SeO3), 0.3 mg.

b Replaced corresponding amount of the wheat in each diet, from 30—35 d of broiler age.

The positive control (PC) diet was supplemented with an ionophore coccidiostat (salinomycin, 60 mg/kg); the negative control (NC) diet did not contain any additive. The nisin diets were supplemented with increasing levels of the bacteriocin in liquid form (3.2, 9.7, 20.1 and 87.2 ml/kg, respectively). The concentrations of nisin in the final diets were as follows: 100, 300, 900 and 2700 IU nisin/g (group NI100, NI300, NI900 and NI2700, respectively).

Preparation of nisin and analysis of nisin concentrations

The nisin preparation was prepared according to technology elaborated at the Department of Biotechnology and Food Microbiology, Poznań University of Life Sciences, using the nisin-producing strain Lactococcus lactis subsp. lactis ATCC11454. The strain was grown into log phase in MRS broth, harvested and stored at -80°C in MRS amended with 20% (vol/vol) glycerol. The strain was propagated twice in MRS broth at 30°C before use (primary cultures).Primary cultivations were performed in batch system using 5-liters fermenters (Bioflo III, New Brunswick). MRS medium without Tween 80 was inoculated with 2% (vol/vol) of an overnight culture of the L. lactis strain and incubated anaerobically (in nitrogen-flushed atmospheres) at 30°C for 16h. The suspension was maintained at constant level of pH 6.0 by addition of 5M NaOH. The cells were separated from culture medium by membrane microfiltration. The filtrates were adjusted to pH 6.5 and treated with catalase (300 IU/mL, C-3515, Sigma) to exclude the antimicrobial effects of hydrogen peroxide and heated at 80°C for 10 min in order to inactivate proteases, catalase and kill any residual cells. The filtrate was further concentrated using ultrafiltration. The ultrafiltration process was carried out in an Amicon filtration system (model CH2RSA) equipped in cellulose acetate membranes with cut-off point of 30, and further of 5 kDa. The 10-fold concentrated fluid, containing over 800 mg/liter of nisin (32,000 IU/ml), was used as a feed additive in broiler chicken diets [14].

Nisin concentrations were analysed by a bioassay method based on the method of Matsuzaki et al. [15] as follows. Five millilitres of nutrient broth (Biocorp, Poland) was inoculated with Staphylococcus aureus ATCC 25923 and incubated on a shaker (100 strokes/min) at 30°C for 15 h. Fifty microliters of the S. aureus cell suspension and 50 μl of the ultra-filtrate of the nisin-producing L. lactis culture containing nisin solution were added to 5 ml of fresh medium, and this mixture was incubated under the same conditions. After 12 h (i.e. late log phase), the cell concentration was determined by measuring the OD600 using an UV spectrophotometer (model Specord 205, JENA). The samples were diluted so that the OD600 was in range of 0.1 to 1.5 absorbance units. The OD600 values were observed to be inversely correlated with the amounts of nisin ultra-filtrate added. A calibration curve was made using commercially available nisin standard (Sigma, 1000 IU/mg of solid). Nisin concentration was expressed in milligrams per litre, and a nisin concentration of 1 mg/litre was equivalent to 40 IU/ml [16].

Data and Sample Collection

The feed intake and body weight of the chickens were measured on days 14, 28 and 35. Mortality was registered throughout the entire experiment. At the end of the trial (35d) from each experimental group, 21 randomly picked chickens (3 chickens from 7 pens) were killed by cervical dislocation. For analyses of the gastrointestinal contents (bacterial enzymes, pH and organic acid concentrations), the contents of crop, ileum and caeca from 3 birds per pen were pooled (7 replicate digesta samples of approx. 10g). The remaining part of the samples was immediately frozen and stored in -80°C for the analysis of organic acids by gas chromatography and the microbiota composition by fluorescent in situ hybridization (FISH) of single bacterial cells.

Analysis of pH, Fermentation Products and Bacterial Enzyme Activities

The pH in the pooled digesta samples from crop, ileum and caeca, respectively, was measured immediately after slaughter using a combined glass and reference electrode.

Digesta samples were subjected to short-chain fatty acids (SCFA) analysis, using GC (Shimadzu GC-2010, Kyoto, Japan). The samples (0.5g crop and ileum samples, 0.2g caeca sample) were mixed with 0.2 ml formic acid, diluted with deionised water and centrifuged at 7,211 ×g for 10 min. The supernatant was loaded onto a capillary column (SGE BP21, 30 m × 0.53 mm) using an on-column injector. The initial oven temperature was 85°C and was raised to 180°C by 8°C/min and held there for 3 min. The temperatures of the flame ionisation detector and the injection port were 180°C and 85°C, respectively. The sample volume used for GC analysis was 1 μl. The putrefactive SCFA (PSCFA) concentration was calculated as the sum of iso-butyrate, iso-valerate, and valerate concentration in the digesta.

The activity of bacterial enzymes (α- and β-glucosidase, α- and β-galactosidase and β-glucuronidase) in crop, ileum and caeca digesta (in the latter case additionally the activity of α-arabinopyranosidase and β-xylosidase were defined) was measured by the rate of p- or o-nitrophenol release from their nitrophenylglucosides, according to the method described elsewhere [17]. The following substrates were used: ρ-nitrophenyl-α-D-glucopyranoside (for α-glucosidase); ρ-nitrophenyl-β-D-glucopyranoside (for β-glucosidase); ρ-nitrophenyl-α-D-galactopyranoside (α-galactosidase); ο-nitrophenyl-β-D-galactopyranoside (β-galactosidase); ρ-nitrophenyl-β-D-glucuronide (for β-glucuronidase); ρ-nitrophenyl-α-L-arabinopyranosidase (for α-arabinopyranosidase); ρ-nitrophenyl-β-D-xylopyranoside (for β-xylosidase). The reaction mixture contained 0.3 ml of a substrate solution (5 mM) and 0.2 mL of a 1:10 (v/v) dilution of the crop, ileum or caeca samples in 100mM phosphate buffer (pH 7.0) after centrifugation at 7211 g for 15 min. Incubation was carried out at 39°C and ρ-nitrophenol was quantified spectrophotometrically at A400 nm and at A420 nm (ο-nitrophenol concentration) after the addition of 2.5 ml of 0.25 M-cold sodium carbonate. The enzymatic activity was expressed as μmol product formed per hour per g of digesta. The above outlined procedure determines the activities of extracellular bacterial enzymes released from bacterial cells into the digesta.

Microbial Community Analysis by Fluorescent In Situ Hybridization (FISH)

For FISH analysis, 100 µL of the ileum digesta were diluted in PBS and pipetted onto 0.22 µm polycarbonate filters (Frisenette K02BP02500) and vacuumed (Vaccum KNF Vacuport-Neuberg). After vacuuming, the filters were transferred onto cellulose discs for dehydration in an ethanol series (50, 80, and 96%, 3 min. each). For each sample, a series of identical filters was prepared to allow the determination of optimal hybridization [18,19]. The oligonucleotides probes used for this study (Table 2) were selected from the literature. Hybridizations were carried out in 50 µL of hybridization buffer (0.9 M NaCl; 20 mM Tris/HCl, pH 7.2; 0.01% SDS) containing the oligonucleotides probes (Table 2). After hybridization, the filters were washed with washing buffer (20 mM Tris/HCl, pH 7.2; 0.01% SDS; 5 mM EDTA) for 20 min. at 48°C. The filters were rinsed gently in distilled water, air-dried, and mounted on object glasses with VectaShield (Vector laboratories nr. H-1000) anti fading agent containing DAPI (4',6-diamidino-2-phenylindole). To distinguish total count (DAPI) of bacteria from other particles in the ileum samples filters were left in 4°C for one hour in the dark until visualized using a Carl Zeiss Microscope Axio Imager M2.

Table 2. Oligonucleotide probes.

Target Probe Sequence (5' to 3')
Bacteroides – Prevotella cluster Bac303 CCAATGTGGGGGACCTT 1
Clostridium perfringens Cperf191 GTAGTAAGTTGGTTTCCTCG2
Enterobacteriaceae Enter1432 CTTTTGCAACCCACT3
Lactobacillus sp./Enterococcus sp. Lab158 GGTATTAGCAYCTGTTTCCA 4

1 [19]2,3, [50], 4 [51]

Statistical analysis

The data were treated statistically using one-way analysis of variance, and significance of differences between groups was determined by the Duncan’s multiple range test at the significance level of P equal to or less than 0.05. The calculations were tested using the GLM procedure of SAS software [20].

Results

Microbial community analysis

The total number of bacteria (DAPI counts) was lowest in the PC group (Table 3). Compared to the NC group, nisin did not affect the total bacterial counts. None of the dietary treatments affected the Clostridium perfringens and LAB counts. Bacteroides and Enterobacteriacae counts, on the other hand, were influenced by all dietary treatments. The highest counts were observed in the NC group, whereas significant reductions were observed with salinomycin and nisin supplementation; for nisin in a dose-dependent manner.

Table 3. Selected microbial counts (log cfu/ml digesta) in ileal digesta determined by DAPI staining and fluorescent in situ hybridization (FISH).

PC NC NI100 NI300 NI900 NI2700 SEM P
DAPI 9.94c 10.01ab 10.00b 10.04a 10.01ab 10.00b 0.01 <0.001
Bacteroides-Prevotella 7.87c 8.19a 8.13ab 7.96bc 7.85c 7.82c 0.13 <0.001
Clostridium perfringens 7.77 7.71 7.87 7.82 7.82 7.70 0.13 0.369
Enterobacteriacae 8.01b 8.27a 7.93bc 7.76c 7.97bc 7.96bc 0.16 0.002
Lactobacillus/Enterococcus 8.03 8.15 8.25 8.21 8.05 8.07 0.12 0.076

PC - positive control (salinomycin, 60 mg/kg); NC - negative control (any additives);NI100 - 100 IU nisin/g (3.2 ml/kg); NI300 - 300 IU nisin/g (9.7 ml/kg); NI900 - 900 IU nisin/g (20.1 ml/kg); NI2700 - 2700 IU nisin/g (87.2 ml/kg)

DAPI - total number of bacteria determined by 4',6-diamidino-2-phenylindole staining

SEM - standard error of the mean

Within the same row, different superscripts indicate significant differences between treatments (P≤ 0.05)

Microbial fermentation patterns and enzyme activities

The microbial fermentation pattern in the broiler chicken GIT was affected by nisin and salinomycin in all examined segments (Figure 1-3, Table 4). In the crop, both additives significantly lowered the total SCFA level and dramatically changed the profile, particularly by reducing the level and proportion of propionate (Figure 1, Table 4). A similar trend was observed in ileum, however, statistically lower SCFA and PSCFA levels were observed only in the NI300, NI900 and NI2700 groups in comparison to the NC group (Table 4). Again, nisin reduced the proportion of propionate, whereas salinomycin did not exert this effect in ileum (Figure 2). Compared to crop and ileum, the highest total and individual SCFA and PSCFA levels were observed in the caeca digesta (Table 4). The lowest levels of acetic and propionic acids were detected with the highest dietary nisin levels. Iso-butyric acid was increased only by the salinomycin supplementation. Butyric acid concentration did not differ (P<0.05) between PC, NI100, and NI2700 treatments. The highest concentration of iso-valeric acid was found in the PC group but it was only statistically different (P<0.05) from the NI2700 group. Lowest valeric acid concentration was observed in NI2700 however only in case of NI300 it was statistically different (P<0.05). The highest PSCFA were detected in PC while lowest in NI2700 (P<0.05), lowest total SCFA in NI2700 (P<0.05). In the caeca, nisin and salinomycin supplementation did not affect the SCFA profile (Figure 3).

Figure 1. SCFA profiles in crop digesta.

Figure 1

PC - positive control (salinomycin, 60 mg/kg); NC - negative control (any additives); NI100 - 100 IU nisin/g (3.2 ml/kg); NI300 - 300 IU nisin/g (9.7 ml/kg); NI900 - 900 IU nisin/g (20.1 ml/kg); NI2700 - 2700 IU nisin/g (87.2 ml/kg); Different letters indicate significant differences between treatments (P≤ 0.05).

Table 4. SCFA concentrations in crop, ileum and caeca digesta (µmol/g digesta).

PC NC NI100 NI300 NI900 NI2700 SEM P
Crop
acetic acid 7.34 9.54 7.27 7.56 6.92 6.56 0.39 0.055
propionic acid 0.02b 2.51a 0.04b 0.04b 0.04b 0.07b 0.17 <.001
iso-butyric acid 0.16 0.16 0.13 0.10 0.16 0.15 0.02 0.361
butyric acid 0.18 0.14 0.05 0.04 0.12 0.02 0.02 0.065
iso-valeric acid 0.01 0.05 0.00 0.00 0.02 0.00 0.01 0.097
valeric acid 0.01 0.01 0.01 0.00 0.01 0.10 0.01 0.121
PSCFA sum 0.19 0.23 0.14 0.10 0.19 0.24 0.06 0.156
total SCFA 7.72b 12.4a 7.50b 7.74b 7.26b 6.89b 0.47 <.001
Ileum
acetic acid 4.61 4.39 4.11 4.04 3.80 4.16 0.17 0.263
propionic acid 0.38a 0.33a 0.04b 0.05b 0.06b 0.00b 0.04 0.001
iso-butyric acid 0.38b 1.38a 1.03a 0.25b 0.44b 0.21b 0.10 <.001
butyric acid 0.05 0.03 0.25 0.05 0.11 0.05 0.03 0.107
iso-valeric acid 0.02 0.00 0.05 0.02 0.04 0.04 0.01 0.339
valeric acid 0.01 0.02 0.03 0.01 0.01 0.05 0.01 0.273
PSCFA sum 0.41b 1.40a 1.11a 0.29b 0.50b 0.30b 0.10 <.001
total SCFA 5.46ab 6.15a 5.51ab 4.43b 4.47b 4.51b 0.22 0.043
Caeca
acetic acid 53.2ab 61.0a 59.1a 59.3a 57.2a 48.0b 1.32 0.006
propionic acid 4.38a 4.09a 4.25a 4.10a 3.82ab 2.86b 0.17 0.016
iso-butyric acid 0.69a 0.41b 0.44b 0.40b 0.45b 0.38b 0.03 0.012
butyric acid 9.69b 13.5a 12.1ab 13.3a 13.6a 10.0b 0.47 0.020
iso-valeric acid 0.48a 0.29ab 0.38ab 0.36ab 0.42ab 0.21b 0.03 0.010
valeric acid 0.68ab 0.65ab 0.71ab 0.81a 0.70ab 0.48b 0.04 0.038
PSCFA sum 1.85a 1.35ab 1.54ab 1.58ab 1.57ab 1.06b 0.08 0.012
total SCFA 69.2ab 80.0a 76.9a 78.3a 76.2a 61.9b 1.72 0.002

PC - positive control (salinomycin, 60 mg/kg); NC - negative control (any additives);NI100 - 100 IU nisin/g (3.2 ml/kg); NI300 - 300 IU nisin/g (9.7 ml/kg); NI900 - 900 IU nisin/g (20.1 ml/kg); NI2700 - 2700 IU nisin/g (87.2 ml/kg)

PSCFA - putrefactive SCFA (C4i+C5i+C5)

SEM - standard error of the mean

Within the same row, different superscripts indicate significant differences between treatments (P≤ 0.05)

Figure 2. SCFA profiles in ileum digesta.

Figure 2

PC - positive control (salinomycin, 60 mg/kg); NC- negative control (any additives); NI100 - 100 IU nisin/g (3.2 ml/kg); NI300 - 300 IU nisin/g (9.7 ml/kg); NI900 - 900 IU nisin/g (20.1 ml/kg); NI2700 - 2700 IU nisin/g (87.2 ml/kg); Different letters indicate significant differences between treatments (P≤ 0.05).

Figure 3. SCFA profiles in caeca digesta.

Figure 3

PC - positive control (salinomycin, 60 mg/kg); NC- negative control (any additives); NI100 - 100 IU nisin/g (3.2 ml/kg); NI300 - 300 IU nisin/g (9.7 ml/kg); NI900 - 900 IU nisin/g (20.1 ml/kg); NI2700 - 2700 IU nisin/g (87.2 ml/kg); Different letters indicate significant differences between treatments (P≤ 0.05).

There was no effect of treatment on crop digesta pH (Table 5). Significant pH effects were observed in ileum and caeca digesta; the highest values were observed in the PC group and the lowest values in the NI groups, but without a clear dose-dependent pattern (Table 5).

Table 5. pH in crop, ileum and caeca digesta.

PC NC NI100 NI300 NI900 NI2700 SEM P
pH
Crop 4.95 4.87 4.82 4.90 4.94 4.93 0.03 0.714
Ileum 5.84a 5.72a 5.53ab 5.53ab 5.37b 5.72a 0.05 0.032
Caeca 6.13a 6.09ab 5.91abc 5.78cd 5.89bcd 5.68d 0.04 <0.001

PC - positive control (salinomycin, 60 mg/kg); NC - negative control (any additives);NI100 - 100 IU nisin/g (3.2 ml/kg); NI300 - 300 IU nisin/g (9.7 ml/kg); NI900 - 900 IU nisin/g (20.1 ml/kg); NI2700 - 2700 IU nisin/g (87.2 ml/kg)

SEM - standard error of the mean

Within the same row, different superscripts indicate significant differences between treatments (P≤ 0.05)

In general, the dietary nisin and salinomycin supplementations significantly affected the activity of specific bacterial enzymes in crop, ileum and caeca (Table 6). In crop digesta, the activities of α- and β-glucosidases, α- galactosidases and β-glucuronidase were highest (P<0.05) in the NC group, while nisin supplementation decreased these activities to levels found for the salinomycin treated PC group (Table 6). As compared to the PC and NC groups, the lowest β-glucosidases and β-glucuronidase activity values were observed with the highest nisin dose (NI2700 group). In ileum digesta, the highest α-glucosidases activity was observed in the PC group and the lowest in the NI2700 group (Table 6). Similar trends were observed for the other enzymes. Irrespective of treatment, the highest activity of the bacterial enzymes was found in caeca digesta (Table 6). In addition to activities of α- and β-glucosidases, α- galactosidases and β-glucuronidase, activities of α-arabinopyranosidase and β-xylosidase were analysed as well. As compared to the NC group, nisin supplementation (NI300, NI900, NI2700) significantly decreased the activity of α- and β-glucosidases, (NI900, NI2700), α- galactosidases (NI100, NI300, NI900, NI2700); β-glucosidases (NI2700) β-glucuronidase (NI100, NI300, NI900, NI2700); α-arabinopyranosidase (NI2700); β-xylosidase (NI2700).

Table 6. Activity of extracellular bacterial enzymes in crop, ileum and caeca digesta (µmol/h/g digesta).

PC NC NI100 NI300 NI900 NI2700 SEM P
Crop
α-glucosidase 0.47b 1.13a 0.50b 0.37b 0.31b 0.22b 0.06 <.0001
β-glucosidase 5.60b 7.14a 4.83bc 4.45bc 4.52bc 3.94c 0.23 <.0001
α-galactosidase 14.9 16.5 16.1 15.6 16.2 14.7 0.43 0.313
β-galactosidase 0.99c 6.33a 4.84b 4.18b 4.21b 2.26c 0.34 <.0001
β-glucuronidase 0.15ab 0.18a 0.13ab 0.04b 0.04b 0.04b 0.02 0.039
Ileum
α-glucosidase 2.80a 1.98b 1.52bc 1.30bc 1.28bc 1.18c 0.13 <.0001
β-glucosidase 0.50a 0.22ab 0.29ab 0.13b 0.15b 0.09b 0.04 0.014
α-galactosidase 1.17a 1.10a 1.09a 1.10a 0.91a 0.31b 0.09 0.014
β-galactosidase 2.05a 1.59ab 1.27b 1.02b 0.95b 0.81b 0.18 0.003
β-glucuronidase 0.89a 0.23b 0.12b 0.13b 0.15b 0.12b 0.05 <.0001
Caeca
α-glucosidase 20.1ab 23.2a 19.6abc 18.1bc 15.8bc 15.3c 0.71 0.001
β-glucosidase 4.96b 6.57a 5.26ab 3.90bc 3.44c 2.95c 0.27 <.0001
α-galactosidase 24.7ab 31.7a 21.5bc 22.2bc 16.3c 14.9c 1.33 <.0001
β-galactosidase 38.5ab 44.8a 41.9a 39.7ab 41.4a 26.1b 2.06 0.018
β-glucuronidase 23.0b 38.0a 19.7b 17.7b 14.4b 14.4b 1.91 <.0001
α-arabinopyranosidase 4.36a 4.31a 4.06a 4.13a 4.02a 2.37b 0.22 0.014
β-xylosidase 9.33a 9.63a 9.02a 7.48ab 6.90ab 4.90b 0.45 0.002

PC - positive control (salinomycin, 60 mg/kg); NC - negative control (any additives);NI100 - 100 IU nisin/g (3.2 ml/kg); NI300 - 300 IU nisin/g (9.7 ml/kg); NI900 - 900 IU nisin/g (20.1 ml/kg); NI2700 - 2700 IU nisin/g (87.2 ml/kg)

SEM - standard error of the mean

Within the same row, different superscripts indicate significant differences between treatments (P≤0.05)

Bird performance

In the 1-14 d period, the lowest body weight gain (BWG) was recorded in the PC group (Table 7). Nisin supplementation improved BWG in all treatments as compared to PC, however, birds fed the lowest dosage of the bacteriocin did not differ from the NC group (P=0.001). In the 15-28 d period, only the NI900 and NI2700 groups were statistically different from the control groups. In the last period (29-35 d), the PC group was characterized by the highest BWG, but it was not statistically different from the NI900 and NI2700 groups. Over the entire experimental period (1-35 d), the highest BWG was observed for the nisin-supplemented NI900 and NI2700 groups. Dietary additives also affected the feed conversion ratio (FCR). In the 1-14 d period, the lowest FCR were observed in the NI900 and NI2700 groups and highest in the PC group. These differences were not continued in later growth stages; in the 29-35 d period, salinomycin improved FCR to the same extent as NI2700 but numerically it was the lowest value among all treatments. In the entire experimental period (1-35 d), the lowest FCR was observed in the treatments with highest inclusion of nisin (NI900 and NI2700). Nisin and well as salinomycin effected feed intake (FI) of the broiler chickens. In the 1-14 d and 15-28 d periods, the highest FI was observed in the NI900 and NI2700 groups. A similar trend was observed over the entire experimental period (1-35 d).

Table 7. Broiler chicken performance.

PC NC NI100 NI300 NI900 NI2700 SEM P
BWG (g/bird)
1-14d 313b 332a 332a 346c 360d 381e 3.12 <.0001
14-28d 859a 858a 899ab 900ab 932b 946b 8.16 0.003
28-35d 591b 539a 520a 530a 556ab 591b 6.85 0.002
1-35d 1763a 1729a 1751a 1776a 1847b 1918c 12.61 <.0001
FE (kg/kg)
1-14d 1.42d 1.37a 1.37a 1.36a 1.32c 1.27b 0.01 <.0001
14-28d 1.62 1.63 1.59 1.62 1.60 1.58 0.01 0.754
28-35d 1.87b 2.01a 2.08a 1.99ac 1.97abc 1.89bc 0.02 0.001
1-35d 1.66a 1.70a 1.69a 1.68a 1.65ab 1.61b 0.01 0.003
FI (g/bird)
1-14d 446a 456ac 455a 470bc 475b 483b 2.50 <.0001
14-28d 1388a 1391a 1425ac 1452bc 1489b 1493b 8.54 <.0001
28-35d 1101 1079 1073 1052 1090 1113 7.79 0.281
1-35d 2934a 2926a 2953ab 2973ab 3054bc 3089c 15.72 0.005

PC - positive control (salinomycin, 60 mg/kg); NC - negative control (any additives);NI100 - 100 IU nisin/g (3.2 ml/kg); NI300 - 300 IU nisin/g (9.7 ml/kg); NI900 - 900 IU nisin/g (20.1 ml/kg); NI2700 - 2700 IU nisin/g (87.2 ml/kg);

BWG -Body Weight Gain; FE - Feed Efficiency; FI - Feed Intake

SEM - standard error of the mean

Within the same row, different superscripts indicate significant differences between treatments (P≤ 0.05)

Discussion

In general, the results of the present study demonstrate salinomycin as well as nisin to modulate the microbial ecology of the broiler GIT. The digesta concentrations of SCFAs were thus highest in the non-supplemented control group in each GIT segment, and the observed levels of total and individual SCFAs were in good agreement with our earlier studies [21,22]. Moreover, both additives changed the SCFA profiles of crop and ileum. The reduction of the fermentation activity in the GIT was generally in agreement with the observed bacterial enzyme activities. However, salinomycin and nisin showed slightly different modes of action. In ileum, α-glucosidase and β-galactosidase activities were highest in the salinomycin supplemented PC group, whereas nisin supplementation decreased these activities in a dose-dependent manner.

In the present study, none of the applied additives influenced pH in the crop, but significant pH effects were observed in the ileum and caeca. In contrast to our earlier studies with bacteriocins [2], the observed pH values did not reflect SCFA concentrations. Particularly in the crop, marked changes in total SCFA were observed without any concomitant effects on digesta pH (Table 5). The lack of consistency may relate to the fact that lactic acid, known to have a major influence on digesta pH, was not analyzed in the present study.

Nisin is reported to exert antimicrobial activity against numerous LAB and some bacteria belonging to the genera Staphylococcus, Micrococcus, Corynebacterium, Mycobacterium, Listeria, Clostridium and Bacillus [23,24]. In human studies it has been reported that nisin is inactivated by proteolytic enzymes and therefore exerts no effect on the GIT microbiota [10,25]. Data from in vivo and in vitro studies with ruminants, on the other hand, indicates that nisin can influence rumen fermentation and methanogenesis [26-28], and nisin has been reported to exert effects similar to the ionophore monensin [29]. These observations indicate that nisin is not immediately degraded in the rumen.

The commercially available nisin products are dry and contain 2.5% nisin, 74.4% sodium chloride and 23.8% of denatured milk solids. This composition makes them unsuitable for poultry nutrition due to high amount of NaCl. However, in the available literature there are many other nisin preparations obtained from L. lactis fermentation, which can have relatively high nisin activity combined with low NaCl content. In poultry feeds, some additives (e.g. enzymes) are used in liquid form, thus development of the cheap method of nisin production would be very interesting from this point of view. However, it must be emphasized that even though nisin is used worldwide for food preservation purposes, it is not allowed to be used for animal nutrition in many countries. The FAO/WHO Codex Committee on milk and milk products accepted nisin as a food additive for processed cheese at a concentration of 12.5 mg pure nisin per kilogram product [30]. In some countries (e.g. Peru and France) nisin is accepted without any limits in particular foods (processed cheese) while in other countries there are strong national legislations (e.g. Argentina, USA, Italy) on maximum dosage. Besides food applications there is some work done on its clinical potential. In humans, there were successful attempts to use nisin in the treatment of atopic dermatitis [31], stomach ulcers and colon infections for patients with immune deficiencies [32], as well as staphylococcal mastitis during lactation in women. Bartoloni et al. [33] tested metronidazole, vancomycin, and nisin against 60 toxigenic strains of Clostridium difficile collected from human subjects with Clostridium difficile-associated diarrhea and observed nisin to much more effective than applied antibiotics. However, most studies agree that due to nisin susceptibility to degradation by the digestive enzymes, it cannot play any role in the development of the endogenous GIT microbiota [10,25].

The present study demonstrates that dietary nisin can modulate the microbial ecology of the broiler chicken GIT in a manner similar to the ionophore cocidiostat salinomycin. In contrast to our findings, work done on human microflora-associated rats indicated that dietary nisin had no effect on the gastrointestinal microbial ecology, whereas diet supplementation with nisin-producing Lactococcus lactis strain CHCC5826, significantly affected the microbial community [10]. The differences in the observations could be linked with differences in the digestion processes in mammals and birds [34-36]; particularly digesta passage time and, hence, nisin exposure to different proteolytic enzymes. In rats digesta passage time is rather slow and around 10-13h [37], whereas in broiler chickens passage time is very rapid and usually do not exceed 3-5h [36]. The duration of the experiments could have had an impact as well; the rats were given in two single dosages for two days whereas in the present study, nisin was fed to the birds throughout the experimental period of 35 d.

The growth promoting effect of salinomycin observed in the present study is in agreement with earlier observations on broiler chickens [38], ruminants [39] and pigs [40]. Many of the applied ionophore coccidiostats strongly influence the GIT microbiota by targeting not only Eimeria species but also certain Gram-positive bacteria and thereby reducing the numbers of e.g., Clostridium perfringens [41] and lactic acid bacteria, including Lactobacillus species [38]. Thus, the improvement of bird growth and feed utilization by salinomycin can be explained not only by direct suppression of coccidia, but also by inhibited growth and activity of pathogenic as well as commensal bacteria, alleviating the direct competition with the host for nutrients and decreasing e.g., the microbial deconjugation of bile salts [42,43], thereby improving fat digestibility [44]. Even though, salinomycin is usually observed to suppress the major groups of Gram-positive bacteria (e.g. LAB and C. perfringens), this is not always the case [2], however, it was not observed in the present study. This may relate to the fact that within e.g. the Lactobacillus genus, susceptibility to salinomycin has been observed to differ between species, and e.g. Lactobacillus salivarius is reported to be particularly susceptible [46]. A similar phenomenon may be expected for nisin. Depending on the composition of the LAB population, the overall suppressive effect of salinomycin as well as nisin may therefore not be similar from case to case. Concerning C. perfringens, the present data could indicate a similar phenomenon, namely that the probe may have covered/targeted other, less susceptible Clostridiaceae, which may have blurred the specific influence on C. perfringens. Moreover, in the present study we only analyzed the microbiota of the ileum. More dramatic changes could be expected to have occurred in the crop, where bacteriocins may be more active, since gizzard maceration and proteinase activity may impede the activity of these small peptides further down the GIT. The important role of the crop in the bacteriocins mode of action is also supported by our earlier findings [2] and the changes in the SCFA profile observed in the present study.

After the EU ban of the antibiotic growth promoters, ionophores have therefore played an important role in reducing many types of bacterial enteritis in broiler chickens. However, a ban of ionophores as feed additives has been considered in the European Union as of 2012, but a final decision on this issue has been postponed due to an obvious lack of alternative disease control strategies. In this context, the growth promoting effects of nisin as observed for broiler chickens in the present study are very promising and could be expanded by investigations of the potential role of this peptide in Eimeria challenged birds.

As mentioned above, information on broiler chicken performance as influenced by the use of dietary bacteriocins is scarce [45]. In our previous work [2-5], we have demonstrated however that dietary supplementation of the bacteriocin divercin AS7 in a liquid preparation improved broiler performance in a manner similar to the use of the ionophore cocidiostat salinomycin. Likewise, pediocin A, produced by Pediococcus pentosaceus FBB61, was observed to improve growth and feed utilization of broiler chickens challenged with Clostridium perfringens [7]. A significant reduction of Campylobacter jejuni has also been demonstrated in turkey poults after dietary addition of bacteriocin B602 from Paenibacillus polymyxa (NRRL B-30509) and bacteriocin OR7 from Lactobacillus salivarius NRRL B-35014 [46]. Finally, dietary albusin B (bacteriocin) of Ruminococcus albus 7 expressed by yeast, has been reported to increase intestinal nutrient absorption, elevate the fecal Lactobacillus counts and decrease the population of Enterococcus and Salmonella, and thereby improving the growth performance of broiler chickens [47].

The results of the present work demonstrate that nisin exerted a clearly modulating effect on the microbial ecology of the GIT, and even in an unprotected form, the nisin ultra-filtrate was able to improve bird performance significantly. Even though the detailed microbiological mechanisms behind the observed effects are still to be investigated for further elucidation, the present study is, to our knowledge, the first to demonstrate the dietary efficacy of this bacteriocin in broiler chickens. It is particular noteworthy that in comparison to salinomycin, dietary nisin in the NI900 and NI2700 treatments, improved broiler chicken body weight gain by 4.7 and 8.7%, respectively (P=0.0001). Moreover, birds from the NI2700 group were characterized by the best feed utilization (P=0.003) among all groups. This phenomenon can be explained by several modes of action, as modulation of host immunity and stimulation of response to Eimeria, similar to ionophores [48]. Improved cellular immune response after Eimeria infection, resulting in reduced fecal oocyst shedding [49] or improved nutrient absorption and utilization [5]. Unfortunately, the present study did not include analysis of Eimeria sp. colonization of the broiler chickens, wherefore direct effects of the nisin on this parasite could not be evaluated.

Conclusions

The findings of the present study suggest that for broiler chickens, dietary nisin exerts a mode of action similar to that of the ionophore salinomycin; they both improve broiler growth performance by modulating the microbial ecology of the GIT. Dietary nisin supplementation may thus be considered a novel strategy in poultry production for improving broiler chicken feed utilization and growth performance presumably by reducing microbial density and activity in the GIT.

Funding Statement

The current study was supported by the following grant: “Bacteriocins-innovative supplements for poultry diets” UDA-POIG 01.03.01-30-179/09, Innovative Economy Programme. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Józefiak D, Sip A (2013) Bacteriocins in poultry nutrition–a review. Annals-- Animal Science 13: 449-462. [Google Scholar]
  • 2. Jozefiak D, Sip A, Rawski M, Rutkowski A, Kaczmarek S et al. (2011) Dietary divercin modifies gastrointestinal microbiota and improves growth performance in broiler chickens. Br Poult Sci 52: 492-499. doi: 10.1080/00071668.2011.602963. PubMed: 21919577. [DOI] [PubMed] [Google Scholar]
  • 3. Józefiak D, Sip A, Kaczmarek S, Rutkowski A (2010) The effects of Carnobacterium divergens AS7 bacteriocin on gastrointestinal microflora in vitro and on nutrient retention in broiler chickens. Journal of Animal and Feed Sciences 19: 460-467. [Google Scholar]
  • 4. Józefiak D, Sip A, Rawski M, Steiner T, Rutkowski A (2011) The dose response effects of liquid and lyophilized Carnobacterium divergens AS7 bacteriocin on the nutrient retention and performance of broiler chickens. Journal of Animal and Feed Sciences 20: 401-411. [Google Scholar]
  • 5. Józefiak D, Sip A, Rutkowski A, Rawski M, Kaczmarek S et al. (2012) Lyophilized Carnobacterium divergens AS7 bacteriocin preparation improves performance of broiler chickens challenged with Clostridium perfringens . Poult Sci 91: 1899-1907. doi: 10.3382/ps.2012-02151. PubMed: 22802184. [DOI] [PubMed] [Google Scholar]
  • 6. Wang HT, Li YH, Chou IP, Hsieh YH, Chen BJ et al. (2013) Albusin B modulates lipid metabolism and increases antioxidant defense in broiler chickens by a proteomic approach. J Sci Food Agric 93: 284-292. doi: 10.1002/jsfa.5754. PubMed: 22729694. [DOI] [PubMed] [Google Scholar]
  • 7. Grilli E, Messina MR, Catelli E, Morlacchini M, Piva A (2009) Pediocin A improves growth performance of broilers challenged with Clostridium perfringens . Poult Sci 88: 2152-2158. doi: 10.3382/ps.2009-00160. PubMed: 19762869. [DOI] [PubMed] [Google Scholar]
  • 8. Cleveland J, Montville TJ, Nes IF, Chikindas ML (2001) Bacteriocins: safe, natural antimicrobials for food preservation. Int J Food Microbiol 71: 1-20. doi: 10.1016/S0168-1605(01)00560-8. PubMed: 11764886. [DOI] [PubMed] [Google Scholar]
  • 9. Udompijitkul P, Paredes-Sabja D, Sarker MR (2012) Inhibitory effects of nisin against Clostridium perfringens food poisoning and nonfood-borne isolates. J Food Sci 77: M51-M56. doi: 10.1111/j.1750-3841.2011.02475.x. PubMed: 22132724. [DOI] [PubMed] [Google Scholar]
  • 10. Bernbom N, Licht TR, Brogren C-H, Jelle B, Johansen AH et al. (2006) Effects of Lactococcus lactis on composition of intestinal microbiota: role of nisin. Appl Environ Microbiol 72: 239-244. doi: 10.1128/AEM.72.1.239-244.2006. PubMed: 16391049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Kaldhusdal M, Hofshagen M, Løvland A, Langstrand H, Redhead K (1999) Necrotic enteritis challenge models with broiler chickens raised on litter: evaluation of preconditions, Clostridium perfringens strains and outcome variables. FEMS Immunol Med Microbiol 24: 337-343. doi: 10.1111/j.1574-695X.1999.tb01303.x. PubMed: 10397320. [DOI] [PubMed] [Google Scholar]
  • 12. Drew MD, Syed NA, Goldade BG, Laarveld B, Van Kessel AG (2004) Effects of dietary protein source and level on intestinal populations of Clostridium perfringens in broiler chickens. Poult Sci 83: 414-420. PubMed: 15049494. [DOI] [PubMed] [Google Scholar]
  • 13. Knarreborg A, Simon MA, Engberg RM, Jensen BB, Tannock GW (2002) Effects of dietary fat source and subtherapeutic levels of antibiotic on the bacterial community in the ileum of broiler chickens at various ages. Appl Environ Microbiol 68: 5918–5924. doi: 10.1128/AEM.68.12.5918-5924.2002. PubMed: 12450811. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Standardization WECoB, Organization WH; (1970) WHO expert committee on biological standardization [meeting held in Geneva from 30 September to 8 October 1969]: twenty-second report [Google Scholar]
  • 15. Matsusaki E, Endo N, Sonomoto K, Ishizaki A (1995) Purification and identification of a peptide antibiotic produced by Lactococcus lactis IO-1. Journal of the Faculty of Agriculture Kyushu University 40: 73-85. [Google Scholar]
  • 16. Matsusaki H, Endo N, Sonomoto K, Ishizaki A (1996) Lantibiotic nisin Z fermentative production by Lactococcus lactis IO-1: Relationship between production of the lantibiotic and lactate and cell growth. Appl Microbiol Biotechnol 45: 36-40. doi: 10.1007/s002530050645. PubMed: 8920177. [DOI] [PubMed] [Google Scholar]
  • 17. Juskiewicz J, Zdunczyk Z, Jankowski J (2003) Effect of adding mannan-oligosaccharide to the diet on the performance, weight of digestive tract segments, and caecal digesta parameters in young turkeys. Journal of Animal and Feed Sciences 12: 133-142. [Google Scholar]
  • 18. Manz W, Amann R, Ludwig W, Vancanneyt M, Schleifer KH (1996) Application of a suite of 16S rRNA-specific oligonucleotide probes designed to investigate bacteria of the phylum Cytophaga-flavobacter-bacteroides in the natural environment. Microbiology 142 ( 5): 1097-1106. doi: 10.1099/13500872-142-5-1097. PubMed: 8704951. [DOI] [PubMed] [Google Scholar]
  • 19. Manz W, Szewzyk U, Ericsson P, Amann R, Schleifer KH et al. (1993) In situ identification of bacteria in drinking water and adjoining biofilms by hybridization with 16S and 23S rRNA-directed fluorescent oligonucleotide probes. Appl Environ Microbiol 59: 2293-2298. PubMed: 8357261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. SAS (1990) SAS User's Guide: Statistics. Version 6. 4th ed SAS Institute, Cary, NC. [Google Scholar]
  • 21. Jozefiak D, Rutkowski A, Kaczmarek S, Jensen BB, Engberg RM et al. (2010) Effect of β -glucanase and xylanase supplementation of barley- and rye-based diets on caecal microbiota of broiler chickens. Br Poult Sci 51: 546 - 557. doi: 10.1080/00071668.2010.507243. PubMed: 20924850. [DOI] [PubMed] [Google Scholar]
  • 22. Józefiak D, Rutkowski A, Jensen BB, Engberg RM (2006) The effect of β-glucanase supplementation of barley- and oat-based diets on growth performance and fermentation in broiler chicken gastrointestinal tract. Br Poult Sci 47: 57 - 64. doi: 10.1080/00071660500475145. PubMed: 16546798. [DOI] [PubMed] [Google Scholar]
  • 23. Delves-Broughton J (1990) Nisin and its application as a food preservative. International Journal of Dairy Technology 43: 73-76. doi: 10.1111/j.1471-0307.1990.tb02449.x. [DOI] [Google Scholar]
  • 24. Fowler G, Gasson M (1991) Antibiotics-nisin. Food Preservatives: 135-152. [Google Scholar]
  • 25. Mills S, Stanton C, Hill C, Ross RP (2011) New developments and applications of bacteriocins and peptides in foods. In: Doyle MP, Klaenhammer TR. Annual review of food science and technology, Vol 2 Palo Alto: Annual Reviews; pp. 299-329. [DOI] [PubMed] [Google Scholar]
  • 26. Callaway TR, DeMelo AMS, Russell JB (1997) The effect of nisin and monensin on ruminal fermentations in vitro. Curr Microbiol 35: 90-96. doi: 10.1007/s002849900218. PubMed: 9216882. [DOI] [PubMed] [Google Scholar]
  • 27. Santoso B, Mwenya B, Sar C, Takahashi J (2006) Ruminal fermentation and nitrogen metabolism in sheep fed a silage-based diet supplemented with Yucca schidigera or Y-schidigera and nisin. Animal Feed Science and Technology 129: 187-195. doi: 10.1016/j.anifeedsci.2006.01.001. [DOI] [Google Scholar]
  • 28. Sar C, Santoso B, Mwenya B, Gamo Y, Kobayashi T et al. (2004) Manipulation of rumen methanogenesis by the combination of nitrate with beta 1-4 galacto-oligosaccharides or nisin in sheep. Animal Feed Science and Technology 115: 129-142. doi: 10.1016/j.anifeedsci.2004.01.006. [DOI] [Google Scholar]
  • 29. Jalc D, Lauková A (2002) Effect of nisin and monensin on rumen fermentation in artificial rumen. Berl Munch Tierarztl Wochenschr 115: 6-10. PubMed: 11852686. [PubMed] [Google Scholar]
  • 30. Ross RP, Morgan S, Hill C (2002) Preservation and fermentation: past, present and future. Int J Food Microbiol 79: 3-16. doi: 10.1016/S0168-1605(02)00174-5. PubMed: 12382680. [DOI] [PubMed] [Google Scholar]
  • 31. Valenta C, Bernkop-Schnürch A, Rigler HP (1996) The antistaphylococcal effect of nisin in a suitable vehicle: A potential therapy for atopic dermatitis in man. J Pharm Pharmacol 48: 988-991. doi: 10.1111/j.2042-7158.1996.tb06019.x. PubMed: 8910870. [DOI] [PubMed] [Google Scholar]
  • 32. Dubois A (1995) Spiral bacteria in the human stomach: the gastric helicobacters. Emerg Infect Dis 1: 79–85. doi: 10.3201/eid0103.950302. PubMed: 8903168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Bartoloni A, Mantella A, Goldstein BP, Dei R, Benedetti M et al. (2004) In-vitro activity of nisin against clinical isolates of Clostridium difficile . J Chemother 16: 119-121. PubMed: 15216943. [DOI] [PubMed] [Google Scholar]
  • 34. McConnell EL, Basit AW, Murdan S (2008) Measurements of rat and mouse gastrointestinal pH, fluid and lymphoid tissue, and implications for in-vivo experiments. J Pharm Pharmacol 60: 63-70. doi: 10.1211/jpp.60.1.0008. PubMed: 18088506. [DOI] [PubMed] [Google Scholar]
  • 35. Owusu-Asiedu A, Patience JF, Laarveld B, Van Kessel AG, Simmins PH et al. (2006) Effects of guar gum and cellulose on digesta passage rate, ileal microbial populations, energy and protein digestibility, and performance of grower pigs. J Anim Sci 84: 843-852. PubMed: 16543561. [DOI] [PubMed] [Google Scholar]
  • 36. Hughes RJ (2008) Relationship between digesta transit time and apparent metabolisable energy value of wheat in chickens. Br Poult Sci 49: 716-720. doi: 10.1080/00071660802449145. PubMed: 19093244. [DOI] [PubMed] [Google Scholar]
  • 37. Platel K, Srinivasan K (2001) Studies on the influence of dietary spices on food transit time in experimental rats. Nutrition Research 21: 1309-1314. doi: 10.1016/S0271-5317(01)00331-1. [DOI] [Google Scholar]
  • 38. Engberg RM, Hedemann MS, Leser TD, Jensen BB (2000) Effect of zinc bacitracin and salinomycin on intestinal microflora and performance of broilers. Poult Sci 79: 1311-1319. PubMed: 11020077. [DOI] [PubMed] [Google Scholar]
  • 39. Spears JW (1990) Ionophores and nutrient digestion and absorption in ruminants. J Nutr 120: 632-638. PubMed: 2191094. [DOI] [PubMed] [Google Scholar]
  • 40. Moore RJ, Kornegay ET, Lindemann MD (1986) Effect of salinomycin on nutrient absorption and retention by growing pigs fed corn-soybean meal diets with or without oat hulls or wheat bran. Canadian Journal of Animal Science 66: 257-265. doi: 10.4141/cjas86-026. [DOI] [Google Scholar]
  • 41. Bjerrum L, Pedersen AB, Engberg RM (2005) The influence of whole wheat feeding on Salmonella infection and gut flora composition in broilers. Avian Dis 49: 9-15. doi: 10.1637/7223-061504R. PubMed: 15839406. [DOI] [PubMed] [Google Scholar]
  • 42. Knarreborg A, Engberg RM, Jensen SK, Jensen BB (2002) Quantitative determination of bile salt hydrolase activity in bacteria isolated from the small intestine of chickens. Appl Environ Microbiol 68: 6425-6428. doi: 10.1128/AEM.68.12.6425-6428.2002. PubMed: 12450872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Guban J, Korver DR, Allison GE, Tannock GW (2006) Relationship of dietary antimicrobial drug administration with broiler performance, decreased population levels of Lactobacillus salivarius, and reduced bile salt deconjugation in the ileum of broiler chickens. Poult Sci 85: 2186-2194. PubMed: 17135676. [DOI] [PubMed] [Google Scholar]
  • 44. Knarreborg A, Lauridsen C, Engberg RM, Jensen SK (2004) Dietary antibiotic growth promoters enhance the bioavailability of alpha-tocopheryl acetate in broilers by altering lipid absorption. J Nutr 134: 1487-1492. PubMed: 15173416. [DOI] [PubMed] [Google Scholar]
  • 45. Svetoch EA, Stern NJ (2010) Bacteriocins to control Campylobacter spp. in poultry--a review. Poult Sci 89: 1763-1768. doi: 10.3382/ps.2010-00659. PubMed: 20634535. [DOI] [PubMed] [Google Scholar]
  • 46. Stern NJ, Svetoch EA, Eruslanov BV, Kovalev YN, Volodina LI et al. (2005) Paenibacillus polymyxa purified bacteriocin to control Campylobacter jejuni in chickens. J Food Prot 68: 1450-1453. PubMed: 16013385. [DOI] [PubMed] [Google Scholar]
  • 47. Wang H-T, Yu C, Hsieh Y-H, Chen S-W, Chen B-J et al. (2011) Effects of albusin B (a bacteriocin) of Ruminococcus albus 7 expressed by yeast on growth performance and intestinal absorption of broiler chickens—its potential role as an alternative to feed antibiotics. J Sci Food Agric, 91: 2338-2343. PubMed: 21567416. [DOI] [PubMed] [Google Scholar]
  • 48. Travers MA, Florent I, Kohl L, Grellier P (2011) Probiotics for the control of parasites: an overview. Journal Parasitology Research, 2011: 2011. PubMed: 21966589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Dalloul RA, Lillehoj HS, Tamim NM, Shellem TA, Doerr JA (2005) Induction of local protective immunity to Eimeria Acervulina by a Lactobacillus-based probiotic. Comp Immunol Microbiol Infect Dis 28: 351-361. doi: 10.1016/j.cimid.2005.09.001. PubMed: 16293311. [DOI] [PubMed] [Google Scholar]
  • 50. Sghir A, Gramet G, Suau A, Rochet V, Pochart P et al. (2000) Quantification of bacterial groups within human fecal flora by oligonucleotide probe hybridization. Appl Environ Microbiol 66: 2263-2266. doi: 10.1128/AEM.66.5.2263-2266.2000. PubMed: 10788414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Harmsen HJM, Elfferich P, Schut F, Welling GW (1999) A 16S rRNA-targeted probe for detection of Lactobacilli and Enterococci in faecal samples by fluorescent In Situ hybridization. Microbial Ecology in Health and Disease 11: 3 - 12. doi: 10.1080/089106099435862. [DOI] [Google Scholar]

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES