Abstract
Some studies have shown that the NetB toxin may be an important virulence factor of Clostridium perfringens associated necrotic enteritis in poultry. Additionally, research has shown that strains of C. perfringens positive for both the netB gene and a second toxin-encoding gene, tpeL, appear to be more virulent than strains with only netB. In the past, detection of these genes has been performed relatively inefficiently using two single locus PCRs. This report describes a novel multiplex PCR developed to detect netB and tpeL simultaneously in C. perfringens strains isolated from cases of necrotic enteritis in broilers, providing a more efficient diagnostic tool in the screening of strains for these genes.
1. Introduction
The disease necrotic enteritis (NE) is a major issue affecting the poultry industry, causing extensive economic loss through mortality, reduced bird performance, and carcass condemnation at slaughter [1, 2]. Caused by the bacterium Clostridium perfringens (CP), NE is characterized by necrotic lesions, primarily in the jejunum and ileum, which can vary in severity from thickened mucosa and multifocal ulceration in less severe cases to the formation of a greenish or yellowish pseudomembrane in the case of extensive mucosa inflammation and necrosis [3]. In the past, alpha-toxin produced by CP type A has been implicated as the primary virulence factor in NE pathogenesis [2, 4, 5]; however, the NetB toxin, encoded by the netB gene, was shown to be important for the virulence of certain strains [6, 7]. Another toxin, TpeL (encoded by the tpeL gene) [8], is a potential virulence factor as well. In a recent study, inoculation of broilers with strains positive for both tpeL and netB was associated with greater severity of gross lesions over strains with only netB [9].
Existing studies ascertaining the prevalence of netB and tpeL have been limited to certain geographic populations of CP, mainly in Australia, Belgium, Denmark, Sweden, and Canada [1, 7]. In the United States, studies on the prevalence of these genes have analyzed CP populations from New England, New York, and Pennsylvania [10]. The relatively small number of sampled CP populations underlines a need for more analysis to determine the importance of these genes on a worldwide scale. Additionally, detection of these genes has been performed relatively inefficiently using two single locus PCRs. This report describes a multiplex PCR developed to detect netB and tpeL simultaneously, providing a more efficient tool in screening CP strains for these genes.
2. Materials and Methods
Strains used as positive controls were provided by J.G. Songer of Iowa State University (JGS-1870 and JGS-4140) and the Mitchem-Sparks Regional Diagnostic Laboratory located in Boaz, Alabama (C103-99). All strains (Table 1) were prepared for DNA extraction by enriching in cooked meat medium (HiMedia Laboratories Pvt. Ltd., Mumbai, India) for 24 hr and then streaking the enriched samples for isolation onto trypticase soy agar with 5% sheep's blood (BD Diagnostics, Franklin Lakes, NJ). After 24–48 hr, a single colony exhibiting typical hemolysis was placed into brain-heart infusion (BHI) broth (BD Diagnostics) and incubated for 24 hr. All incubation was carried out at 37°C within a Bactron IV Anaerobic Environmental Chamber (Shel Lab, Cornelius, OR) with the following atmospheric conditions: 90% N2, 5% CO2, and 5% H2. After incubation, BHI broth cultures were centrifuged at 16,000 g for 5 min and the broth supernatant was aspirated and discarded. Utilizing a Wizard Genomic DNA Purification Kit (Promega Corp., Madison, WI), DNA was extracted from the resulting bacterial pellet. Extracted DNA was analyzed for quantity and purity with a Nanodrop 1000 Spectrophotometer (Thermo Scientific Inc., Bremen, Germany) according to the manufacturer's instructions. The standard for DNA purity was a 260/280 nm absorbance ratio of 1.8–2.0.
Table 1.
Bacterial strains used as positive and negative controls in a multiplex polymerase chain reaction designed for detection of Clostridium perfringens genes netB and tpeL.
| Strain ID number | Species | netB | tpeL | Relevance | Source |
|---|---|---|---|---|---|
| C103-99 | Clostridium perfringens | + | + | Positive control | Necrotic enteritis |
| JGS-1870 | Clostridium perfringens | + | + | Positive control | Necrotic enteritis |
| JGS-4140 | Clostridium perfringens | + | + | Positive control | Necrotic enteritis |
| 232-2 | Clostridium bifermentans | − | − | Negative control | Poultry litter |
| 259-14 | Bacteroides caccae | − | − | Negative control | Poultry litter |
| 250-4 | Wolinella sp. | − | − | Negative control | Poultry litter |
A previously published primer set [7] was used for the detection of tpeL and a primer set detecting netB was designed using the primer Basic Local Alignment Search Tool (BLAST) function on the National Center for Biotechnology website. Primer specifications are listed in Table 2. The netB primers were confirmed to target mostly conserved sequences by performing a sequence alignment with 47 netB sequences in GenBank using genetic analysis software.
Table 2.
Specifications of primers used in a multiplex PCR for the detection of netB and tpeL.
| Primer ID | Sequence | Target gene | Product length |
|---|---|---|---|
| netB5F | CGCTTCACATAAAGGTTGGAAGGC | netB | 316 |
| netB5R | TCCAGCACCAGCAGTTTTTCCT |
||
| AKP80* | ATATAGAGTCAAGCAGTGGAG | tpeL | 466 |
| AKP81* | GGAATACCACTTGATATACCTG |
*Primers previously published by Keyburn et al., 2010 [7].
EconoTaq PLUS GREEN Master Mix (Lucigen Corp., Middleton, WI) was used at 1x concentration providing Taq polymerase, MgCl2, dNTPs, and reaction buffer (pH 9.0). Reagent concentrations of the optimized multiplex were as follows: 1.2 units/25 uL of Taq DNA polymerase; 1.44 mM of MgCl2; 192 uM of each dNTP; 0.2 uM of each primer; and 100 ng/25 uL of template DNA. The following cycling conditions were used: an initial denaturing step at 95°C for 5 min; 40 cycles of denaturing at 95°C for 30 sec; annealing at 55°C for 30 sec, and extension at 72°C for 30 sec, with a final extension step at 72°C for 7 min.
Products were separated by electrophoresis in a 2% agarose gel. Gels and running buffer were made using 1x concentrations of AccuGENE TBE buffer (Lonza Group, Basel, Switzerland). For visualization of bands, 1 uL of an ethidium bromide solution (10 mg/mL) was added to the molten gel before solidifying. Electrophoresis took place at 100 v for about one hr or until sufficient separation between products occurred. A 100 bp DNA Ladder (Promega) was utilized as a DNA size standard. Bands corresponding to the expected amplicons were excised and DNA was purified using a GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, Buckinghamshire, UK).
Forward and reverse strands of the purified DNA were sequenced by Lucigen and a consensus sequence was determined for each amplicon. These consensus sequences were then subjected to a nucleotide BLAST search using the NCBI database Nucleotide collection (nr/nt) to calculate the likelihood that each PCR product was produced from the target gene.
3. Results
After the analysis of 47 netB gene sequences published in GenBank, the target sequences for both forward (netB5F) and reverse (netB5R) primers proved to be mostly conserved. A single polymorphism was present at site number 756 of the alignment, with 21 (44.7%) of the sequences having G at this site and 26 (55.3%) having A. This site was complementary to the sixth base from the 5′ end of primer netB5R and resulted in a single A:C mismatch between the primer and 55.3% of the gene sequences. This same mutation affects primers previously described by Keyburn et al. [6], resulting in a G:T mismatch between the seventh base from the 5′ end of AKP78 (the forward primer) and 24 (51.1%) of the analyzed gene sequences.
Gel electrophoresis of PCR products confirmed the amplification of the target sequences for all three positive controls. Bands of the expected size corresponding to the netB (316 bp) and tpeL (466 bp) fragments were observed for the positive controls, and no bands were observed for the negative controls. Sequences obtained from PCR products matched the target sequence (at least 99% max identity) with significantly low E-values after performing a BLAST search (Table 3).
Table 3.
BLAST output for sequenced PCR products*.
| Target gene | Sequence source† | Description of top result | GenBank accession | Max identity (%) | E-value |
|---|---|---|---|---|---|
| netB | C103-99 | Clostridium perfringens strain CP4 plasmid pCP4netB pathogenicity locus 1 genomic sequence | JF837812.1 | 100 | 5 × 10−158 |
| netB | JGS-1870 | Clostridium perfringens strain CP4 plasmid pCP4netB pathogenicity locus 1 genomic sequence | JF837812.1 | 100 | 3 × 10−152 |
| netB | JGS-4140 | Clostridium perfringens strain CP4 plasmid pCP4netB pathogenicity locus 1 genomic sequence | JF837812.1 | 100 | 1 × 10−144 |
| tpeL | C103-99 | Clostridium perfringens A strain CP4 TpeL (tpeL) gene, complete cds | EU848493.1 | 99 | 0 |
| tpeL | JGS-1870 | Clostridium perfringens A strain CP4 TpeL (tpeL) gene, complete cds | EU848493.1 | 99 | 0 |
| tpeL | JGS-4140 | Clostridium perfringens A strain CP4 TpeL (tpeL) gene, complete cds | EU848493.1 | 99 | 0 |
*Each row corresponds to a single sequenced band.
†lists the strain that the sequenced band was amplified from.
4. Discussion
The multiplex PCR described in this report successfully detected the netB and tpeL genes in three control organisms and did not produce false positives in the negative controls. The chance of a false negative was minimized by choosing primers that targeted mostly conserved sites within the C. perfringens genome. After analysis of 47 sequences, one polymorphism was observed in the target sequence indicating an internal A:C mismatch between the netB5R primer and 55.3% of the 47 aligned sequences. Although mismatches between a template and the 3′ end of a primer are known to interfere with the active site of DNA polymerase and can result in reduced reaction efficiency [11, 12], internal mismatches, or those closer to the 5′ end, have a much smaller impact [12]. In addition, out of the possible mismatches, A:C (purine-pyrimidine) mismatches generally produce only minor interferences [12]. Previously published primer AKP787 contained a G:T mismatch between 51.1% of the sequences. As G:T is another purine-pyrimidine mismatch and the mismatch also occurred near the 5′ end of the primer, it is comparable to netB5R. In consequence, it is unlikely that this mismatch between the template and netB5R would have a significant impact on product formation. Although evidence suggests the netB and tpeL toxin genes may be important virulence factors for certain strains of C. perfringens, relatively few bacterial populations have been screened for these two genes. More populations must be screened to determine the overall impact of these genes in NE. By pairing the detection of both netB and tpeL into one PCR reaction, this multiplex PCR has the potential to increase the efficiency with which strains are screened for these two genes of interest. The effectiveness of this assay has been shown in three control organisms and must now be confirmed using a larger number of strains.
Acknowledgments
The authors recognize and appreciate the advice of Dr. Mark Liles regarding sequencing and primer analysis; Dr. Joseph Giambrone for the use of his laboratory equipment; and Dr. J. G. Songer and Janice Seibel for providing positive control strains. The authors declare that there is no conflict of interests regarding the publication of this paper.
References
- 1.Johansson A, Aspán A, Kaldhusdal M, Engström BE. Genetic diversity and prevalence of netB in Clostridium perfringens isolated from a broiler flock affected by mild necrotic enteritis. Veterinary Microbiology. 2010;144(1-2):87–92. doi: 10.1016/j.vetmic.2009.12.017. [DOI] [PubMed] [Google Scholar]
- 2.Van Immerseel F, Rood JI, Moore RJ, Titball RW. Rethinking our understanding of the pathogenesis of necrotic enteritis in chickens. Trends in Microbiology. 2009;17(1):32–36. doi: 10.1016/j.tim.2008.09.005. [DOI] [PubMed] [Google Scholar]
- 3.Ficken MD, Wages DP. Necrotic enteritis. In: Calnek BW, Barnes HJ, Beard CW, McDougald LR, Saif YM, editors. Diseases of Poultry. 10th edition. Ames, Iowa, USA: Iowa State University Press; 1997. pp. 261–264. [Google Scholar]
- 4.Al-Sheikhly F, Truscott RB. The pathology of necrotic enteritis of chickens following infusion of crude toxins of Clostridium perfringens into the duodenum. Avian Diseases. 1977;21(2):241–255. [PubMed] [Google Scholar]
- 5.Keyburn AL, Sheedy SA, Ford ME, et al. Alpha-toxin of Clostridium perfringens is not an essential virulence factor in necrotic enteritis in chickens. Infection and Immunity. 2006;74(11):6496–6500. doi: 10.1128/IAI.00806-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Keyburn AL, Boyce JD, Vaz P, et al. netB, a new toxin that is associated with avian necrotic enteritis caused by Clostridium perfringens . PLoS Pathogens. 2008;4, article e26 doi: 10.1371/journal.ppat.0040026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Keyburn AL, Yan X-X, Bannam TL, Van Immerseel F, Rood JI, Moore RJ. Association between avian necrotic enteritis and Clostridium perfringens strains expressing netB toxin. Veterinary research. 2010;41, article 21 doi: 10.1051/vetres/2009069. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Amimoto K, Noro T, Oishi E, Shimizu M. A novel toxin homologous to large clostridial cytotoxins found in culture supernatant of Clostridium perfringens type C. Microbiology. 2007;153(4):1198–1206. doi: 10.1099/mic.0.2006/002287-0. [DOI] [PubMed] [Google Scholar]
- 9.Coursodon CF, Glock RD, Moore KL, Cooper KK, Songer JG. TpeL-producing strains of Clostridium perfringens type A are highly virulent for broiler chicks. Anaerobe. 2012;18(1):117–121. doi: 10.1016/j.anaerobe.2011.10.001. [DOI] [PubMed] [Google Scholar]
- 10.Martin TG, Smyth JA. Prevalence of netB among some clinical isolates of Clostridium perfringens from animals in the United States. Veterinary Microbiology. 2009;136(1-2):202–205. doi: 10.1016/j.vetmic.2008.10.026. [DOI] [PubMed] [Google Scholar]
- 11.Kwok S, Kellogg DE, McKinney N, et al. Effects of primer-template mismatches on the polymerase chain reaction: human immunodeficiency virus type 1 model studies. Nucleic Acids Research. 1990;18(4):999–1005. doi: 10.1093/nar/18.4.999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Stadhouders R, Pas SD, Anber J, Voermans J, Mes THM, Schutten M. The effect of primer-template mismatches on the detection and quantification of nucleic acids using the 5′ nuclease assay. Journal of Molecular Diagnostics. 2010;12(1):109–117. doi: 10.2353/jmoldx.2010.090035. [DOI] [PMC free article] [PubMed] [Google Scholar]