Abstract
Methanococcus maripaludis is an archaeon with two studied surface appendages, archaella and type IV-like pili. Previously, the major structural pilin was identified as MMP1685 and three additional proteins were designated as minor pilins (EpdA, EpdB and EpdC). All of the proteins are likely processed by the pilin-specific prepilin peptidase EppA. Six other genes were identified earlier as likely encoding pilin proteins processed also by EppA. In this study, each of the six genes (mmp0528, mmp0600, mmp0601, mmp0709, mmp0903 and mmp1283) was deleted and the mutants examined by electron microscopy to determine their essentiality for pili formation. While mRNA transcripts of all genes were detected by RT-PCR, only the deletion of mmp1283 led to nonpiliated cells. This strain could be complemented back to a piliated state by supplying a wildtype copy of the mmp1283 gene in trans. This study adds to the complexity of the type IV pili system in M. maripaludis and raises questions about the functions of the remaining five pilin-like genes and whether M. maripaludis under other growth conditions may be able to assemble additional pili-like structures.
Introduction
Type IV pili are a very common type of surface appendage found in a variety of Gram-negative and Gram positive bacteria, as well as certain members of the Domain Archaea [1]–[6]. They are involved in a wide variety of processes including adherence, aggregation, DNA transfer in transformation and conjugation, biofilm formation, electron transfer and a type of surface motility termed twitching [5]–[8]. The core components of a type IV pili system includes structural proteins with class 3 signal peptides, a prepilin signal peptidase, one or more ATPases and a conserved membrane (platform) protein [5], [9], [10]. One ATPase powers the incorporation of new subunits into the growing filament while in many cases, the presence of a second, depolymerizing ATPase acts to remove subunits from the structure. The combined activities of the two ATPases results in extension and retraction of the pili, leading to the twitching motility associated with type IV pili in many bacteria [11]. The conserved inner membrane or platform protein is considered to interact with the ATPase(s) and form an export complex for the structural proteins and to be involved in both pilus assembly and disassembly [10]. In addition to these conserved components, type IV pili systems in different organisms often have other components whose role in pilus assembly and function remain unknown [6].
The structural subunits of the type IV pilus consist of a major pilin and typically several other pilins, termed minor pilins due to their much lower abundance, all synthesized initially with class 3 signal peptides that are specifically processed by the prepilin peptidase [12], [13]. Minor pilins have been shown to be necessary for pili formation in several different systems [14]–[17] and they have been detected in sheared pili samples of N. gonorrhoeae and P. aeruginosa [16], [18], although other roles for minor pilins as activators of pilus assembly without incorporation into the structure have also been proposed in other systems [19], [20]. In some type IV pili systems, evidence for a minor pilus constituent acting as a specific adhesin has been presented [21]–[24].
Archaea are known to use the type IV pili-like model to assemble numerous surface structures [2], [3], [25], [26] including type IV-like pili [25], [26], [29]–[32], the bindosome for substrate uptake in Sulfolobus solfataricus [25], [33], [34]),likely the unusual Iho670 fibres of Ignicoccus hospitalis [35], [36] and the best studied example, namely the archaellum [25], [28], [37]–[40]. The name “archaellum” has been proposed to replace the term “archaeal flagellum” [27] since the archaeal structure, while involved in swimming (as well as other functions), is not homologous to the bacterial flagellum and is related instead to type IV pili in structure and likely assembly [28], [41], [42]. This proposal is still under discussion in the scientific community and further arguments, both pro and con, have been presented [43], [44].
Recent studies in Methanococcus, Haloferax and especially Sulfolobus have been devoted specifically to the study of the type IV-like pili [29]–[31], [45]–[48]. Sulfolobus has been shown to produce two different type IV pili structures. One, called UV-inducible type IV pili (Ups pili; [29], [47]), is widespread throughout the Sulfolobales while the second called archaeal adhesive pili (Aap pili) is limited so far to S. acidocaldarius [25], [30], [49]. Ups pili are upregulated under conditions that lead to DNA double stranded breaks such as UV light and their formation leads to cell aggregation that promotes DNA exchange that might help in repairing the DNA damage [29], [47]. On the other hand, Aap pili are the most abundant surface appendage observed on S. acidocaldarius under normal growth conditions in nutrient rich medium [25]. Aap pili are adhesion structures primarily but they also influence biofilms, promoting the formation of tower-like structures [49]. The loci identified as encoding the biosynthesis of both Aap pili and Ups pili were shown to consist of only five genes [2], [29], [30]. In each case, there are genes for two prepilins, a single pilin assembly ATPase, the conserved pilus membrane/platform protein and one additional gene in each operon that has an unknown function. In the Aap system, AapB appears to be the major pilin and AapA the minor pilin [30]. Mutational studies demonstrated that all five aap genes were necessary for pili formation [30]. In the Ups system, deletion of the gene encoding the ATPase (upsE) eliminated UV-induced aggregation [29]. The assignment of UpsA or UpsB proteins as the major or minor pilins has not been reported.
In Haloferax volcanii, six novel type IV pilins termed PilA(1–6) involved in adhesion have been recently studied [48]. Each protein contains a highly conserved domain of unknown function (Duf1628) at their N-terminus and all are processed by PibD. Strains carrying deletions of up to five of the six pilin genes are still able to adhere while a mutant with all six genes deleted cannot. Complementation of the strain deleted for all six pilin genes with any single pilin gene results in cells that have functional pili.
In Methanococcus maripaludis, an in-silico study by Szabo et al [32] identified the existence of a type IV pili-like locus, consisting of 11 potential genes, including three encoding prepilin-like proteins and one encoding a prepilin peptidase. Subsequent genetic studies demonstrated that two of the pilin genes (epdB and epdC) were essential for pili formation while deletion of the third (epdA) resulted in cells with a reduced number of pili [31]. Unexpectedly, none of these genes encoded the major structural protein which was revealed by mass spectrometry of purified pili samples to be MMP1685, located at a distant locus [31]. Several other genes in the 11 gene operon are also essential for piliation (Nair et al. submitted). Unlike the case with Sulfolobus pili loci, the assembly ATPase and conserved pilus membrane protein genes are not found within this operon (Nair et al., submitted). The novel additional essential genes found in the pilus locus in M. maripaludis, the presence of at least four pilin structural proteins, coupled with the separate locations of both the major pilin and the ATPase and membrane component genes and the presence of two essential copies of the membrane component gene (Nair et al., submitted) all suggest that the pili of this methanogen may be more complex than those found in Sulfolobus species.
In addition to the four identified pilin genes (epdA, epdB, epdC and mmp1685), the initial in-silico study also identified six other genes in the M. maripaludis genome that were predicted to be type IV pilin-like genes processed by EppA (mmp0528, mmp0600, mmp0601, mmp0709, mmp0903 and mmp1283) [32]. Whether these genes encode additional essential structural components of the type IV pili assembled mainly from MMP1685 subunits has not yet been addressed. These genes were the focus of the current study where it was shown that only mmp1283 was essential for pili formation.
Materials and Methods
Strains and Growth Conditions
Methanococcus maripaludis MM900 [50]) and a non-archaellated ΔflaK mutant strain derived from MM900 [51] were grown in Balch medium III [52] at 35°C under a headspace gas of CO2/H2 (20∶80). For transformations, cells were grown in McCas medium [50] supplemented at various steps with neomycin (1 mg/ml) or 8-azohypoxanthine (240 µg/ml) for selection. For complementation experiments, transformants were grown in Balch medium III with added puromycin (2.5 µg/ml) to select for uptake of the vectors. E. coli TOP10 cells (Invitrogen), used for various cloning steps, were grown in Luria-Bertani medium supplemented with ampicillin (100 µg/ml) as needed for transformations.
Reverse Transcriptase-PCR
RT-PCR was done to determine if all the six genes used in this study were being transcribed. Primer pairs were designed to amplify an internal fragment of each particular gene. The template RNA was extracted from the wildtype cells using an RNeasy Mini Kit (Qiagen Inc. Canada Mississauga, ON) with optional DNase digestion as per the manufacturer’s instructions. A One-Step RT-PCR kit (Qiagen Inc.) was used to amplify the cDNA. Using the same primer pairs, additional templates were also used in PCR reactions, including purified RNA not subjected to the reverse transcriptase step (as a control for DNA contamination of the RNA preparation) and genomic DNA to verify amplicon size and specificity of the primers.
Construction of Gene Deletion Plasmids
Plasmids were generated as described earlier [50], [53] to make inframe deletions of each of the targeted potential minor pilin genes. The P1/P2 primers (Table 1) were used to amplify an approximately 1 kb fragment upstream of the target gene and the P3/P4 primers to amplify an approximately 1 kb fragment downstream of the gene. P2 and P3 primers were designed with added AscI restriction sites so that the upstream and downstream fragments could be digested with AscI and then ligated together, resulting in an inframe deletion of most of the targeted gene. The ligated piece was used as template for another PCR using the P1 and P4 primers, which were designed with added BamHI sites. The approximately 2 kb PCR product was purified, digested with BamHI and cloned into pCRPrtNeo to create the plasmids (Table 2) used in generating the deletion strains [50].
Table 1. Primers used in this study.
Technique and primer name | Sequence | Restriction sites |
RT-PCR | ||
mmp0528_ RT_ for | 5′-AATGGAAATGGGAATCTTGGTTG | |
mmp0528_ RT_ rev | 5′-AACGTTTATAAGGGCATTACTCG | |
mmp0600_ RT_ for | 5′-GAGACATATTATCCGACGTTAGG | |
mmp0600_ RT_ rev | 5′-GTGATGTTTCAGTATATGGTAACAG | |
mmp0601_ RT_ for | 5′-GGAACGATATTCGCGGCACACATG | |
mmp0601_ RT_ rev | 5′-CTGGGTGGAACATCATAGGTAAGG | |
mmp0709_ RT_ for | 5′-GAGACTACTGCTGTTAATGATGTTCAGG | |
mmp0709_ RT_ rev | 5′-CGTAAGTAGTACTGTCCAGCACCAGTTC | |
mmp0903_ RT_ for | 5′-CCAGATATCTCTTGAACTTGGTG | |
mmp0903_ RT_ rev | 5′-CTGCACTGTTATACATGCCGACAG | |
mmp1283_ RT_ for | 5′-GCTGGTTCTTGCGGTCATTACAG | |
mmp1283_ RT_ rev | 5′-AAGCATCTATTGCTGTATTGTGAG | |
Screening of deletion mutants | ||
mmp0528_ seq _ for | 5′-GGATCATGGGGAGATGACCC | |
mmp0528_ seq _ rev | 5′-GTGCACGGCATACATTCGTG | |
mmp0600_ seq _ rev | 5′-TACTGGCGACTATTATACATTGG | |
mmp0600_ seq _ rev | 5′-GAAATAGTATTTGCGTCACTAGTTCCG | |
mmp0601_ seq _ for | 5′-TGACTACGTGATTATTGGAAGAG | |
mmp0601_ seq _ rev | 5′-GTATTAATTCTATCGAAATCTGG | |
mmp0709_ seq _ for | 5′-GAGTATGCCCTCATGGGGTAGC | |
mmp0709_ seq _ rev | 5′-GTTCCGTCACGGTAATTACC | |
mmp0903_ seq _ for | 5′-CCGAACCTAAATTTAGGAGG | |
mmp0903_ seq _ rev | 5′-CCGAGAATTGCACCTGTTGCG | |
mmp1283_ seq _ for | 5′-GAAGGTTGTATTGGGTTTAC | |
mmp1283_ seq _ rev | 5′-GAGACATGGTACTGCAATCG | |
In-frame deletions/plasmids | ||
mmp0528_P1 | 5′-CGGATCCGGATATTACCGAAAGGAAAGT | BamH1 |
mmp0528_P2 | 5′-TTGGCGCGCCAATGTTTGTGGCAATATTTCTG | Asc1 |
mmp0528_P3 | 5′-TTGGCGCGCCCAACCAAGATTCCCATTTCC | Asc1 |
mmp0528_P4 | 5′-GCGGATCCACATTTCTGCTCACAATCTTCG | BamH1 |
mmp0600_P1 | 5′-GCGGATCCGGCACACATGACAAAGAATACTGTAAGC | BamH1 |
mmp0600_P2 | 5′-TTGGCGCGCCTACCTGCAAGAAGTACTCTGTC | Asc1 |
mmp0600_P3 | 5′-TTGGCGCGCCACAACTTCGGGGACTATAGAGCTG | Asc1 |
mmp0600-P4 | 5′-GCGGATCCTGCTGGATTATATTCCTGATGATGAGG | BamH1 |
mmp0601_P1 | 5′-GCGGATCCTTCTCGCGGAGTCCTAACTCTTGTTGG | BamH1 |
mmp0601_P2 | 5′-TTGGCGCGCCTCATGTGTGCCGCGAATATCG | Asc1 |
mmp0601_P3 | 5′-TTGGCGCGCCACTGGCGACTATTATACATTGG | Asc1 |
mmp0601_P4 | 5′-GCGGATCCTTCCACCAAAGTCTGTTGTGGTGGTT | BamH1 |
mmp0709_P1 | 5′-GCGGACTGCGGATCCGTGGACTCGG | BamH1 |
mmp0709_P2 | 5′-TTGGCGCGCCCTAGTGCAACGTAAGAACCAG | Asc1 |
mmp0709_P3 | 5′-TTGGCGCGCCCAGTACTACTTACGATTAGTGG | Asc1 |
mmp0709_P4 | 5′-GCGGATCCCGCAACTGCAATTCCAAGTCCG | BamH1 |
mmp0903_P1 | 5′-GCGGATCCAATCCGTGGCCTTTAATTGGTGG | BamH1 |
mmp0903_P2 | 5′-TTGGCGCGCCGTTCAAGAGATATCTGGCCCCG | Asc1 |
mmp0903_P3 | 5′- GTGGCGCGCCAGTGCAGTAAACAGAATTACTG | Asc1 |
mmp0903_P4 | 5′-GCGGATCCAATTCGTCGCTTCCAACCATG | BamH1 |
mmp1283_P1 | 5′-GGGGATCCAGTCTTCCGGTTCCAACTCTTAACG | BamH1 |
mmp1283_P2 | 5′-TTGGCGCGCCAAATTCAAGACTCAATTGGC | Asc1 |
mmp1283_P3 | 5′-TTGGCGCGCCTGCAATAGATGCTTTAAGTGAAGTTAG | Asc1 |
mmp1283_P4 | 5′-GGGGATCCGGGCGGAATTCCCGTTGAGGAC | BamH1 |
Complementation | ||
mmp1283_comp_for | 5′-CCAATGCATGTCTGTTGCTTTAAAGAAGTTTTTTTCGAA ACG | Nsi1 |
mmp1283_comp_rev | 5′-AGCACGCGTTTAACTAACTTCACTTAAAGCATCTATTGC | Mlu1 |
Table 2. Plasmids used in this study.
Plasmid | Description and/or genotype | Source or reference |
pCRPrtNeo | hmv promoter-hpt fusion plus Neor cassette in pCR2.1Topo; Ampr | [50] |
pKJ976 | pCRPrtNeo with in-frame deletion of mmp1283 | This study |
pKJ1016 | pCRPrtNeo with in-frame deletion of mmp0600 | This study |
pKJ1053 | pCRPrtNeo with in-frame deletion of mmp528 | This study |
pKJ1056 | pCRPrtNeo with in-frame deletion of mmp0903 | This study |
pKJ1068 | pCRPrtNeo with in-frame deletion of mmp0709 | This study |
pKJ1104 | pCRPrtNeo with in-frame deletion of mmp0601 | This study |
pWLG40 | hmv promoter-lacZ fusion plus Pur cassette; Ampr | John Leigh |
pKJ1007 | pWLG40 with mmp1283 complement | This study |
M. maripaludis Mutant Generation
The pCRPrtNeo plasmid derivatives carrying the inframe deletions of possible minor pilins were transformed into M. maripaludis ΔflaK using the PEG precipitation method [54]. Following growth overnight without selection, the transformation mixture was subcultured into McCas medium with neomycin to select for plasmid integration. Subsequently, the culture was used to inoculate McCas medium without antibiotic selection. After growth overnight in non-selective McCas medium, aliquots were plated onto 8-azahypoxanthine (240 µg/ml)-containing McCas-Noble agar plates and incubated at 37°C for a week in an anaerobic steel canister. Individual transformant colonies were subsequently picked and grown in Balch III medium. Cells from the various individual colonies were washed, resuspended in 2% NaCl and used as template for PCR using the respective sequencing primers (Table 1) which were designed to amplify across the targeted genes. Amplicons were analyzed by agarose gel electrophoresis to identify the smaller fragments expected of the deletion mutants. Potential mutants identified this way were restreaked for purity, single colonies again picked, grown in Balch medium III and screened by PCR with the sequencing primers.
Complementation of the Deletion Strains
Each of the deleted genes was complemented by cloning the wildtype version of the gene under the control of the nif promoter in plasmid Complementation of the Δmmp1283 deletion strain.
Complementation of the Δmmp1283 gene deletion were done in pWLG40 [55] in which the complementing gene is under the control of the constitutive, strong hmv promoter [31], [56], [57]. For this, the mmp1283 gene was amplified using the forward and reverse complementation primers (Table 1) containing added Nsi1 and Mlu1 restriction sites, respectively. The PCR product was digested with NsiI and MluI and cloned into pWLG40, to generate pKJ1007. This plasmid was transformed into M. maripaludis Δmmp1283 using puromycin for selection.
Electron Microscopy
Overnight cultures were washed with 50 mM MgSO4, and negatively stained with 2% phosphotungstic acid. Cells were examined on Formvar-coated gold grids and imaged under a Hitachi 7000 electron microscope operating at an accelerating voltage of 75 kV.
Results
Using the FlaFind program, Szabo et al. 2007 [32] identified 14 proteins in M. maripaludis that had class 3 signal peptides characteristic of archaellins and bacterial type IV pilins. Of these 14 genes, three were previously identified as archaellins [57] and several were already shown to be involved in pili formation [31]. The latter included epdA, epdB and epdC as well as the major pilin gene mmp1685. One of the 14 genes is a NAD+ synthase-related protein while the remaining six genes encode type IV pilin-like proteins with a DUF361 Pfam domain. The six pilin-like proteins were predicted to be processed by EppA, a prepilin peptidase that was already shown to process the DUF361 domain-containing pilins EpdA and EpdC [32]. The six genes under study here as encoding potential pili structural proteins are mmp0528, mmp0600, mmp0601, mmp0709, mmp0903 and mmp1283. All of these proteins have a class 3 signal peptide of 5–13 amino acids ending with a glycine, a conserved +5 glutamic acid, and a conserved +1 glutamine (Figure 1), which may be required for EppA processing [32]. Of the six genes, mmp0600 and mmp0601 appear to be in an operon while the four remaining genes are not. MMP0528, MMP0903 and MMP1283 are very small proteins of 67–76 amino acids in length (54–63 amino acids after signal peptide removal), almost identical to the size of the major structural pilin, MMP1685 which is 74 amino acids in length (62 amino acids after signal peptide removal). The minor pilins already identified (EpdA, EpdB and EpdC) are about twice as long (130–156 amino acids). MMP0600, MMP0601 and MMP0703 are much larger proteins (200–299 amino acids). MMP1685 is known to be a glycoprotein with an attached N-linked pentasaccharide identical in structure to the tetrasaccharide identified attached to archaellins [58] but with an additional hexose attached as a branch to the linking sugar N-acetyl-galactosamine [31]. Analysis of the sequence of the 6 putative minor pilins identified 1–6 N-glycosylation sequons (N-X-S/T, where X is not proline) which indicates that all of these proteins could also be N-glycosylated (Figure 1).
As a first step to determining that the 6 putative minor pilin genes corresponded to true genes, evidence for an mRNA transcript of each gene was sought using RT-PCR since detection of transcript provides support that an ORF indeed encodes a true protein [59]. RT-PCR was performed on isolated total RNA using primers that would amplify an internal fragment of each gene. In all cases, a PCR product was obtained of the predicted size only when the RNA was subjected to a reverse transcription step and not from the RNA sample itself (Figure 2), indicating that the product arose from cDNA and not contaminating genomic DNA present in the RNA preparation. The product of the RT-PCR was, in each case, identical in size to that obtained using genomic DNA as template. Sequencing of each PCR product confirmed their identities. Thus, all 6 putative pilin genes were transcribed under standard growth conditions in Balch medium III at 35°C.
Each of the 6 genes was then targeted for deletion. The parent strain for these deletions was M. maripaludis ΔflaK [31]. This strain is deleted for flaK which encoded the prepilin peptidase essential for signal peptide removal from archaellins [60], [61]. Without this processing, the cells cannot assemble archaella so that the only surface structures remaining are pili. This makes analysis of effects on piliation by specific gene deletions easier to visualize. Transformants were screened using a PCR method with whole cells as template and primers that would amplify across the targeted genes. Successful deletion of each gene would result in a smaller PCR amplification product, whose size can be predicted from the site of the primers used in the PCR. Mutants carrying a deletion of each of the 6 putative minor pilin genes were obtained (Figure 3).
To investigate whether any of the targeted genes played an essential role in piliation, all mutants were examined by electron microscopy for the presence and abundance of pili. In bacterial type IV pili systems usually there is one major pilin and a number of minor pilins [5], [20]. The major pilin, as well as three minor pilins, were already identified in M. maripaludis so it seemed unlikely that all six putative minor pilin genes studied here would be involved in assembly of the MMP1685 pili as this would result in a total of ten different structural proteins. The electron microscopic examination of the various mutants supported this contention as only the strain carrying the deletion of mmp1283 was nonpiliated (Figure 4). Strains with deletions in mmp0528, mmp0600, mmp0601, mmp0709 and mmp0903 were all piliated to the extent of the parent M. maripaludis ΔflaK cells (compare piliation here to that seen in M. maripaludis ΔflaK cells in Figure 5). In the case of the mmp1283 deletion strain, complementation with a wildtype version of mmp1283 supplied in trans restored the cells to a piliation state comparable to M. maripaludis ΔflaK cells (Figure 5).
Discussion
Methanococcus maripaludis is known to have at least two surface appendages that are assembled in a bacterial type IV pili mode, namely archaella and type IV-like pili [3], [26], [62]. Unusual for Archaea is that the processing of the structural subunits, i.e. archaellins and pilins, in M. maripaludis has been demonstrated to occur through the actions of two different prepilin peptidase-like enzymes whose substrate specificities do not overlap. FlaK processes only archaellins and EppA only pilins [32], [60], [63]. In other studied Archaea, a single enzyme designated PibD is thought to remove the signal peptide from all pilin-like substrates, including archaellins [25], [64], [65]. As more Archaea are studied, it seems likely that the division of labor in processing prepilin-like substrates by two separate prepilin peptidase-like enzymes reported so far only in M. maripaludis may be found in other members of the domain. It has been reported that several members of the Euryarchaeota, mainly Methanococcales as well as Pyrococcus and Thermococcus species harbor both flaK and eppA homologs in their genomes [32]. There are also a limited number of Euryarchaeota that have been reported to possess more than one copy of flaK [66] but the roles and substrates of these potential prepilin peptidases, some found in species reported to be non-archaellated cells, has not been studied.
Previous studies have demonstrated roles for four pilins in the biosynthesis of the M. maripaludis pili. Genes encoding three minor pilins, EpdA, EpdB and EpdC are found in a single large gene cluster [32] that also includes EppA and several other genes shown to be essential for pili formation (Nair et al., submitted). Deletions of the genes for the three pilins result in either completely nonpiliated cells or cells in which the number of pili is significantly reduced [31]. The major structural protein was identified as MMP1685 and deletion of mmp1685 led to nonpiliated cells. Interestingly, MMP1685 had been previously identified by bioinformatics analysis as a predicted substrate for EppA [32]. In addition, that study also predicted that six other genes encoded pilin-like proteins likely to be EppA substrates. In this report, deletions were created in all six genes to investigate the potential role of the encoded pilin-like proteins in the biosynthesis of the surface pili of M. maripaludis.
Three of the pilin-like proteins MMP0528, MMP0903 and MMP1283 are of similar size to the previously identified major pilin structural protein MMP1685 [31] while the other three (MMP0600, MMP0601 and MMP0709) are much larger. The smaller pilin sizes are typical lengths for type IV pilins of the Flp (Tad) class and the presence of +1 glutamine is also common in Gram positive Flp pilins [1], [5], [6]. M. maripaludis pilins, however, lack the +6 tyrosine and so called Flp motif of Flp pilins. All six pilin-like proteins possess a +5 glutamic acid, conserved in most bacterial type IV pilins [5] but absent in the pilins of both Sulfolobus [2], [30] and Haloferax [48]. Examination of mutant strains carrying deletions of each of the targeted genes by electron microscopy indicated that only mmp1283 was essential for piliation as all other deletion strains had similar numbers of pili per cell as wildtype cells. A piliated state could be restored to the Δmmp1283 strain by supplying a wildtype copy of the gene in trans under the control of a constitutive hmv promoter. Like the major pilin MMP1685 and all the previously identified minor pilins (EpdA, EpdB, and EpdC), MMP1283 carries an amino acid sequon necessary for N-linked glycan attachment, suggesting that MMP1283 may be modified by the pentasaccharide found attached to MMP1685 [31]. While the M. maripaludis major pilins are modified with the N-linked glycan, this posttranslational modification is not needed for pilus formation as pili are formed even in an aglB mutant that is missing the oligosaccharyltransferase necessary to transfer the glycan from its lipid carrier to the protein target [67]. It is not yet known if these assembled pili, however, are functional in surface attachment, the only known function attributed to the pili [62].
The function of the other pilin-like genes shown not to be essential for the MMP1685 pili is unknown but several possibilities exist. They could still be involved in the MMP1685 pili structure but dispensable proteins. In Neisseria meningitidis type IV pili, five different pilin proteins are necessary for piliation while three others that are normally incorporated into the pilus are dispensable for pili formation but play important roles in function. Interestingly, these three minor pilins (PilX, ComP and PilV) all have different functions [68]. Alternatively, the pilin-like proteins could be structural proteins of an entirely separate pilus-like structure. It is known in the thermoacidophilic archaeon Sulfolobus acidocaldarius that two different types of type IV pili are made [25], [30], [47] with one type (Ups pili) only made after UV induction or other DNA damaging treatment [29], [47]. Perhaps, under still undefined growth conditions or stress, M. maripaludis has the capacity to assemble a novel pilus type composed of one or more of the remaining pilin-like proteins that currently have no function. Although mRNA transcripts were detected for all five of the other pilin-like genes by RT-PCR, it is possible that posttranscriptional regulation mechanisms prevent pilin protein synthesis. The regulation of archaella assembly, for example, in S. acidocaldarius seems to involve both transcriptional and posttranscriptional control [25], [69]. Alternatively, in the case of the five pilin-like proteins for which deletion did not affect formation of MMP1685 pili, other key components essential for pili formation from these pilin-like proteins may not be made under tested growth conditions, even though the pilins themselves are made. In the case of S. acidocaldarius, archaella synthesis is induced under tryptone starvation conditions even though archaella core proteins are constitutively produced. This is because the major structural protein (the archaellin FlaB) is only made under starvation conditions [25]. A third possibility is that M. maripaludis makes a very short pilus-like structure from one or more of these proteins that has gone undetected by electron microscopy. In Sulfolobus solfataricus, it is known that sugar binding proteins are pilin-like glycoproteins that form a macromolecular cell-surface-associated structure [25], [33] that may form a short pilus-like structure that extends only from the cytoplasmic membrane to the S-layer [3]. The putative bindosome pilus-like structure has never been observed in electron microscopic studies. Type two secretion systems in bacteria use type IV pilin-like proteins to produce a very short pilus-like piston (pseudopilus) proposed to push exoproteins through an outer membrane channel [70]. This pseudopilus would extend only from the cytoplasmic membrane to the outer membrane and likely be dynamic in nature. While M. maripaludis does not utilize sugars as substrates or possess a type II secretion system, there may be other functions in the cells that may require such a short type IV pilus-like structure. The recent identification of putative diverse type IV pili in a variety of Gram positive bacteria using a program called PilFind [1] suggest that all possible functions for these structures have not likely been identified yet.
In bacteria, it is not unusual for type IV pili to be composed of a major pilin and multiple minor pilins. For example, in P. aeruginosa, the pilus is comprised of the major pilin PilA and five minor pilins (FimU, PilV, PilW, PIlX and PilE) which were all shown to be incorporated into the pilus by immunogold labelling experiments [18]. Among the studied Archaea, however, the type IV pilus locus of M. maripaludis appears to be considerably more complex than the two gene clusters encoding Aap and Ups pili in Sulfolobus. In both the Aap and Ups pili systems, there appear to be only two pilin genes and they are encoded along with the conserved ATPase and membrane component genes. Interestingly, in the case of Aap pilins of S. acidocaldarius and Ups pili of S. solfataricus, the lengths (138–168 amino acids with signal peptides) are much larger than seen with MMP1685. In the case of the six recently described Hfx. volcanii pilins, none are co-transcribed with the pilus ATPase and conserved membrane protein genes [48]. The M. maripaludis pili genes are known to lie now in at least four separate locales around the chromosome. One major operon encoding EppA, EpdA, EpdB and EpdC along with other essential genes has already been analyzed to some extent [31], [32]. Furthermore, there is a separate locus encoding the ATPase and two membrane protein components (Nair et al., submitted) as well as the major pilin subunit MMP1685 [31] and now, in this report, the minor pilin MMP1283. It is not yet known if type IV pili formation is constitutive in M. maripaludis or whether it can be induced or repressed under specific environmental circumstances such as attachment or planktonic conditions, as is observed in bacterial type IV pili systems [5]. If pili formation is not constitutive then the cells must regulate transcription of several essential gene clusters located at some distance from each other. Regulation of minor pilin expression has not been well studied even in bacteria. In type IVb systems where minor pilins are clustered with other components of the pilus system, they are likely co-regulated with them. However, in type IVa systems, minor pilins are often unlinked to other pilus component genes, as found in M. maripaludis, and they can be differentially regulated, sometimes by two-component systems [5], [6], [71].
In Sulfolobus species, studies on the regulation of pili have already been initiated, with intriguing findings reported. In S. acidocaldarius, a two component regulatory system (ArnA and ArnB) was found to repress archaella expression. Interestingly, overproduction of ArnA also resulted in a strong enhancement of Aap pili production, suggesting there is a regulation of the two surface organelles that involves cross-talk between the two systems [69]. Recently, the product of an Lrs14 regulator gene saci0446, was shown to bind to promoters of both archaellum (fla) genes and aap pili genes and result in an upregulation of aap genes and downregulation of fla genes, again showing that regulation of different surface structures in this archaeon is connected [46].
This report adds to our knowledge about the complexity of the type IV-like pili in M. maripaludis by identifying a fourth minor pilin that is essential for piliation. Unlike other archaeal systems, piliation in M. maripaludis requires a separate pilin-specific signal peptidase, two conserved membrane (platform) proteins), four minor pilins and additional novel essential proteins [31], [32]. This report also eliminates five other pilin-like proteins as playing an essential role in MMP1685 pili formation and hints that they may form additional type IV pili-like surface structures under appropriate growth conditions.
Funding Statement
This work was funded by a Discovery grant from the Natural Sciences and Engineering Research Council of Canada to KFJ. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Imam S, Chen Z, Roos DS, Pohlschröder M (2011) Identification of surprisingly diverse type IV pili, across a broad range of gram-positive bacteria. PloS one 6: e28919. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Pohlschroder M, Ghosh A, Tripepi M, Albers SV (2011) Archaeal type IV pilus-like structures-evolutionarily conserved prokaryotic surface organelles. Curr Opin Microbiol 14: 1–7. [DOI] [PubMed] [Google Scholar]
- 3. Ng SYM, Zolghadr B, Driessen AJM, Albers SV, Jarrell KF (2008) Cell surface structures of archaea. J Bacteriol 190: 6039–6047. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Pelicic V (2008) Type IV pili: E pluribus unum? Mol Microbiol 68: 827–837. [DOI] [PubMed] [Google Scholar]
- 5. Giltner CL, Nguyen Y, Burrows LL (2012) Type IV pilin proteins: Versatile molecular modules. Microbiol Mol Biol Rev 76: 740–772. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Burrows LL (2012) Pseudomonas aeruginosa twitching motility: Type IV pili in action. Annu Rev Microbiol 66: 493–520. [DOI] [PubMed] [Google Scholar]
- 7. Boesen T, Nielsen LP (2013) Molecular dissection of bacterial nanowires. Mbio 4: e00270–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Lovley D, Ueki T, Zhang T, Malvankar NS, Shrestha PM, et al. (2011) Geobacter: The microbe electric's physiology, ecology, and practical applications. Adv Microb Physiol 59: 1–100. [DOI] [PubMed] [Google Scholar]
- 9. Pohlschroder M, Gimenez MI, Jarrell KF (2005) Protein transport in archaea: Sec and twin arginine translocation pathways. Curr Opin Microbiol 8: 713–719. [DOI] [PubMed] [Google Scholar]
- 10. Takhar HK, Kemp K, Kim M, Howell PL, Burrows LL (2013) The platform protein is essential for type IV pilus biogenesis. J Biol Chem 288: 9721–9728. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Burrows LL (2005) Weapons of mass retraction. Mol Microbiol 57: 878–888. [DOI] [PubMed] [Google Scholar]
- 12. Strom MS, Nunn DN, Lory S (1993) A single bifunctional enzyme, PilD, catalyzes cleavage and N-methylation of proteins belonging to the type IV pilin family. Proc Natl Acad Sci U S A 90: 2404–2408. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Strom MS, Lory S (1993) Structure-function and biogenesis of the type IV pili. Annu Rev Microbiol 47: 565–596. [DOI] [PubMed] [Google Scholar]
- 14. Alm RA, Mattick JS (1995) Identification of a gene, pilV, required for type 4 fimbrial biogenesis in Pseudomonas aeruginosa, whose product possesses a pre-pilin-like leader sequence. Mol Microbiol 16: 485–496. [DOI] [PubMed] [Google Scholar]
- 15. Alm RA, Hallinan JP, Watson AA, Mattick JS (1996) Fimbrial biogenesis genes of Pseudomonas aeruginosa: pilW and pilX increase the similarity of type 4 fimbriae to the GSP protein-secretion systems and pilY1 encodes a gonococcal PilC homologue. Mol Microbiol 22: 161–173. [DOI] [PubMed] [Google Scholar]
- 16. Winther-Larsen HC, Wolfgang M, Dunham S, van Putten JP, Dorward D, et al. (2005) A conserved set of pilin-like molecules controls type IV pilus dynamics and organelle-associated functions in neisseria gonorrhoeae . Mol Microbiol 56: 903–917. [DOI] [PubMed] [Google Scholar]
- 17. Carbonnelle E, Helaine S, Nassif X, Pelicic V (2006) A systematic genetic analysis in Neisseria meningitidis defines the pil proteins required for assembly, functionality, stabilization and export of type IV pili. Mol Microbiol 61: 1510–1522. [DOI] [PubMed] [Google Scholar]
- 18. Giltner CL, Habash M, Burrows LL (2010) Pseudomonas aeruginosa minor pilins are incorporated into type IV pili. J Mol Biol 398: 444–461. [DOI] [PubMed] [Google Scholar]
- 19. Cisneros DA, Pehau-Arnaudet G, Francetic O (2012) Heterologous assembly of type IV pili by a type II secretion system reveals the role of minor pilins in assembly initiation. Mol Microbiol 86: 805–818. [DOI] [PubMed] [Google Scholar]
- 20. Burrows LL (2012) Prime time for minor subunits of the type II secretion and type IV pilus systems. Mol Microbiol 86: 765–769. [DOI] [PubMed] [Google Scholar]
- 21. Ishiwa A, Komano T (2004) PilV adhesins of plasmid R64 thin pili specifically bind to the lipopolysaccharides of recipient cells. J Mol Biol 343: 615–625. [DOI] [PubMed] [Google Scholar]
- 22. Heiniger RW, Winther-Larsen HC, Pickles RJ, Koomey M, Wolfgang MC (2010) Infection of human mucosal tissue by Pseudomonas aeruginosa requires sequential and mutually dependent virulence factors and a novel pilus-associated adhesin. Cell Microbiol 1158: 1173. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Rudel T, Scheurerpflug I, Meyer TF (1995) Neisseria PilC protein identified as type-4 pilus tip-located adhesin. Nature 373: 357–359. [DOI] [PubMed] [Google Scholar]
- 24. Winther-Larsen HC, Hegge FT, Wolfgang M, Hayes SF, van Putten JP, et al. (2001) Neisseria gonorrhoeae PilV, a type IV pilus-associated protein essential to human epithelial cell adherence. Proc Natl Acad Sci U S A 98: 15276–15281. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Lassak K, Ghosh A, Albers SV (2012) Diversity, assembly and regulation of archaeal type IV pili-like and non-type-IV pili-like surface structures. Res Microbiol 163: 630–644. [DOI] [PubMed] [Google Scholar]
- 26. Jarrell KF, Ding Y, Nair DB, Siu S (2013) Surface appendages of archaea: Structure, function, genetics and assembly. Life 3: 86–117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Jarrell KF, Albers SV (2012) The archaellum: An old motility structure with a new name. Trends Microbiol 20: 307–312. [DOI] [PubMed] [Google Scholar]
- 28. Ghosh A, Albers SV (2011) Assembly and function of the archaeal flagellum. Biochem Soc Trans 39: 64–69. [DOI] [PubMed] [Google Scholar]
- 29. Frols S, Ajon M, Wagner M, Teichmann D, Zolghadr B, et al. (2008) UV-inducible cellular aggregation of the hyperthermophilic archaeon sulfolobus solfataricus is mediated by pili formation. Mol Microbiol 70: 938–952. [DOI] [PubMed] [Google Scholar]
- 30. Henche AL, Ghosh A, Yu X, Jeske T, Egelman E, et al. (2012) Structure and function of the adhesive type IV pilus of Sulfolobus acidocaldarius . Environ Microbiol 14: 3188–3202. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Ng SYM, Wu J, Nair DB, Logan SM, Robotham A, et al. (2011) Genetic and mass spectrometry analysis of the unusual type IV-like pili of the archaeon Methanococcus maripaludis . J Bacteriol 193: 804–814. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Szabo Z, Stahl AO, Albers SV, Kissinger JC, Driessen AJM, et al. (2007) Identification of diverse archaeal proteins with class III signal peptides cleaved by distinct archaeal prepilin peptidases. J Bacteriol 189: 772–778. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Zolghadr B, Klingl A, Rachel R, Driessen AJ, Albers SV (2011) The bindosome is a structural component of the Sulfolobus solfataricus cell envelope. Extremophiles 15: 235–244. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Zolghadr B, Weber S, Szabo Z, Driessen AJM, Albers SV (2007) Identification of a system required for the functional surface localization of sugar binding proteins with class III signal peptides in Sulfolobus solfataricus . Mol Microbiol 64: 795–806. [DOI] [PubMed] [Google Scholar]
- 35. Muller DW, Meyer C, Gurster S, Kuper U, Huber H, et al. (2009) The Iho670 fibers of Ignicoccus hospitalis: A new type of archaeal cell surface appendage. J Bacteriol 191: 6465–6468. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Yu X, Goforth C, Meyer C, Rachel R, Schröder GF, et al. (2012) Filaments from Ignicoccus hospitalis show diversity of packing in proteins containing N-terminal type IV pilin helices. J Mol Biol 422: 274–281. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Lassak K, Neiner T, Ghosh A, Klingl A, Wirth R, et al. (2012) Molecular analysis of the crenarchaeal flagellum. Mol Microbiol 83: 110–124. [DOI] [PubMed] [Google Scholar]
- 38.Jarrell KF, VanDyke DJ, Wu J (2009) Archaeal flagella and pili. In: Jarrell KF, editor. Pili and Flagella: Current Research and Future Trends. Norfolk, U.K. Caister Academic Press. 215–234.
- 39.Jarrell KF, Jones GM, Nair DB (2010) Role of N-linked glycosylation in cell surface structures of archaea with a focus on flagella and S layers. Int J Microbiol. [DOI] [PMC free article] [PubMed]
- 40. Jarrell KF, Bayley DP, Kostyukova AS (1996) The archaeal flagellum: A unique motility structure. J Bacteriol 178: 5057–5064. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Ng SY, Chaban B, Jarrell KF (2006) Archaeal flagella, bacterial flagella and type IV pili: A comparison of genes and posttranslational modifications. J Mol Microbiol Biotechnol 11: 167–191. [DOI] [PubMed] [Google Scholar]
- 42. Peabody CR, Chung YJ, Yen MR, Vidal-Ingigliardi D, Pugsley AP, et al. (2003) Type II protein secretion and its relationship to bacterial type IV pili and archaeal flagella. Microbiology 149: 3051–3072. [DOI] [PubMed] [Google Scholar]
- 43. Wirth R (2012) Response to Jarrell and Albers: Seven letters less does not say more. Trends Microbiol 20: 511–512. [DOI] [PubMed] [Google Scholar]
- 44. Eichler J (2012) Response to Jarrell and Albers: The name says it all. Trends Microbiol 20: 512–513. [DOI] [PubMed] [Google Scholar]
- 45. Wang YA, Yu X, Ng SYM, Jarrell KF, Egelman EH (2008) The structure of an archaeal pilus. J Mol Biol 381: 456–466. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Orell A, Peeters E, Vassen V, Jachlewski S, Schalles S, et al. (2013) Lrs14 transcriptional regulators influence biofilm formation and cell motility of crenarchaea. ISME J 7: 1886–1898. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Ajon M, Fröls S, van Wolferen M, Stoecker K, Teichmann D, et al. (2011) UV-inducible DNA exchange in hyperthermophilic archaea mediated by type IV pili. Mol Microbiol 82: 807–817. [DOI] [PubMed] [Google Scholar]
- 48. Esquivel RN, Xu R, Pohlschroder M (2013) Novel archaeal adhesion pilins with a conserved N terminus. J Bacteriol 17: 3808–3818. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Henche AL, Koerdt A, Ghosh A, Albers S- (2012) Influence of cell surface structures on crenarchaeal biofilm formation using a thermostable green fluorecent protein. Environ Microbiol 14: 779–793. [DOI] [PubMed] [Google Scholar]
- 50. Moore BC, Leigh JA (2005) Markerless mutagenesis in Methanococcus maripaludis demonstrates roles for alanine dehydrogenase, alanine racemase, and alanine permease. J Bacteriol 187: 972–979. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Ng SY, VanDyke DJ, Chaban B, Wu J, Nosaka Y, et al. (2009) Different minimal signal peptide lengths recognized by the archaeal prepilin-like peptidases FlaK and PibD. J Bacteriol 191: 6732–6740. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Balch WE, Fox GE, Magrum LJ, Woese CR, Wolfe RS (1979) Methanogens: Reevaluation of a unique biological group. Microbiol Rev 43: 260–296. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53. VanDyke DJ, Wu J, Ng SY, Kanbe M, Chaban B, et al. (2008) Identification of putative acetyltransferase gene, MMP0350, which affects proper assembly of both flagella and pili in the archaeon Methanococcus maripaludis . J Bacteriol 190: 5300–5307. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54. Tumbula DL, Makula RA, Whitman WB (1994) Transformation of Methanococcus maripaludis and identification of a pstI-like restriction system. FEMS Microbiol Lett 121: 309–314. [Google Scholar]
- 55. Lie TJ, Leigh JA (2003) A novel repressor of nif and glnA expression in the methanogenic archaeon Methanococcus maripaludis. . Mol Microbiol 47: 235–246. [DOI] [PubMed] [Google Scholar]
- 56. Lie TJ, Wood GE, Leigh JA (2005) Regulation of nif expression in Methanococcus maripaludis: Roles of the euryarchaeal repressor NrpR, 2-oxoglutarate, and two operators. J Biol Chem 280: 5236–5241. [DOI] [PubMed] [Google Scholar]
- 57. Chaban B, Ng SY, Kanbe M, Saltzman I, Nimmo G, et al. (2007) Systematic deletion analyses of the fla genes in the flagella operon identify several genes essential for proper assembly and function of flagella in the archaeon, Methanococcus maripaludis . Mol Microbiol 66: 596–609. [DOI] [PubMed] [Google Scholar]
- 58. Kelly J, Logan SM, Jarrell KF, Vandyke DJ, Vinogradov E (2009) A novel N-linked flagellar glycan from Methanococcus maripaludis . Carbohydr Res 344: 648–653. [DOI] [PubMed] [Google Scholar]
- 59. Abu-Qarn M, Eichler J (2006) Protein N-glycosylation in archaea: Defining Haloferax volcanii genes involved in S-layer glycoprotein glycosylation. Mol Microbiol 61: 511–525. [DOI] [PubMed] [Google Scholar]
- 60. Bardy SL, Jarrell KF (2002) FlaK of the archaeon Methanococcus maripaludis possesses preflagellin peptidase activity. FEMS Microbiol Lett 208: 53–59. [DOI] [PubMed] [Google Scholar]
- 61. Bardy SL, Jarrell KF (2003) Cleavage of preflagellins by an aspartic acid signal peptidase is essential for flagellation in the archaeon Methanococcus voltae . Mol Microbiol 50: 1339–1347. [DOI] [PubMed] [Google Scholar]
- 62. Jarrell KF, Stark M, Nair DB, Chong JPJ (2011) Flagella and pili are both necessary for efficient attachment of Methanococcus maripaludis to surfaces. FEMS Microbiol Lett 319: 44–50. [DOI] [PubMed] [Google Scholar]
- 63. Ng SY, Chaban B, VanDyke DJ, Jarrell KF (2007) Archaeal signal peptidases. Microbiology 153: 305–314. [DOI] [PubMed] [Google Scholar]
- 64. Albers SV, Szabo Z, Driessen AJM (2003) Archaeal homolog of bacterial type IV prepilin signal peptidases with broad substrate specificity. J Bacteriol 185: 3918–3925. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65. Tripepi M, Imam S, Pohlschroder M (2010) Haloferax volcanii flagella are required for motility but are not involved in PibD-dependent surface adhesion. J Bacteriol 192: 3093–3102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66. Desmond E, Brochier-Armanet C, Gribaldo S (2007) Phylogenomics of the archaeal flagellum: Rare horizontal gene transfer in a unique motility structure. BMC Evol Biol 7: 106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67. Vandyke DJ, Wu J, Logan SM, Kelly JF, Mizuno S, et al. (2009) Identification of genes involved in the assembly and attachment of a novel flagellin N-linked tetrasaccharide important for motility in the archaeon Methanococcus maripaludis . Mol Microbiol 72: 633–644. [DOI] [PubMed] [Google Scholar]
- 68. Brown DR, Helaine S, Carbonnelle E, Pelicic V (2010) Systematic functional analysis reveals that a set of seven genes is involved in fine-tuning of the multiple functions mediated by type IV pili in Neisseria meningitidis . Infect Immun 78: 3053–3063. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69. Reimann J, Lassak K, Khadouma S, Ettema TJ, Yang N, et al. (2012) Regulation of archaella expression by the FHA and von willebrand domain-containing proteins ArnA and ArnB in Sulfolobus acidocaldarius . Mol Microbiol 86: 24–36. [DOI] [PubMed] [Google Scholar]
- 70. Korotkov KV, Sandkvist M, Hol WG (2012) The type II secretion system: Biogenesis, molecular architecture and mechanism. Nature Reviews Microbiology 10: 336–351. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71. Belete B, Lu H, Wozniak DJ (2008) Pseudomonas aeruginosa AlgR regulates type IV pilus biosynthesis by activating transcription of the fimU-pilVWXY1Y2E operon. J Bacteriol 190: 2023–2030. [DOI] [PMC free article] [PubMed] [Google Scholar]