Endocarditis with Ruptured Cerebral Aneurysm Caused by Cardiobacterium valvarum sp. nov.

Abstract

A fastidious gram-negative bacterium was isolated from the blood of a 37-year-old man who had insidious endocarditis with a sudden rupture of a cerebral aneurysm. Characterization of the organism through phylogenetic and phenotypic analyses revealed a novel species of Cardiobacterium, for which the name Cardiobacterium valvarum sp. nov. is proposed. C. valvarum will supplement the current sole species Cardiobacterium hominis, a known cause of endocarditis. Surgeries and antibiotic treatment cured the patient's infection and associated complications. During cardiac surgery, a congenital bicuspid aortic valve was found to be the predisposing factor for his endocarditis.

The genus Cardiobacterium, with its sole species Cardiobacterium hominis, was established in 1964 for a group of fastidious, pleomorphic, gram-negative bacteria that were isolated from patients with endocarditis (17). So far, additional species have not been reported, although they have been implied (M. Kilian, unpublished data). We report here the isolation of a Cardiobacterium species from a patient who suffered from endocarditis with a ruptured cerebral aneurysm. Characterization of the organism by phylogenetic and phenotypic methods led to our proposal of a novel species, Cardiobacterium valvarum sp. nov.

CASE REPORT

A 37-year-old previously healthy man was brought by coworkers to the emergency department due to severe headache, nausea, vomiting, and worsening disorientation for 2 h. On physical examination, the patient was alert and oriented to person but was aphasic. His temperature was normal and his blood pressure was 133/46 mm Hg. Auscultation revealed a grade 3 of 6 diastolic heart murmur radiating to the carotid arteries without S3 sound or signs of heart failure. A mild left-sided facial droop was also noted; otherwise, the neurological examination was normal. An echocardiography revealed severe aortic valve regurgitation with a 1.1- by 1.3-cm vegetation on the valve. A magnetic resonance imaging study of the brain revealed subarachnoid hemorrhage, likely due to a ruptured aneurysm. The laboratory examination showed anemia (hemoglobin, 12.9 g/dl) and leukocytosis (14,000 leukocytes/μl) with a left shift (84% neutrophils). These findings led to a presumptive diagnosis of endocarditis with ruptured cerebral aneurysm. Blood was drawn for cultures. The patient was transferred to another nearby hospital for surgical interventions and further care.

Empirical therapy with vancomycin, ceftazidime, and gentamicin was initiated, along with other medications for the neurological and cardiovascular manifestations. The next day, a craniotomy was performed to clip the aneurysm that was located at the M2 branch of the left middle cerebral artery. The patient's aphasia improved, and he related a 2-week-earlier history of a tooth cleaning and the correction of an irregular bicuspid molar without antibiotic prophylaxis. Two weeks after the craniotomy, however, an arteriography revealed the recurrence of the aneurysm and thrombosis of the vessel, which necessitated repeated clip ligation and trapping of the lesion. Another arteriography 1 week later showed complete obliteration of the aneurysm.

In the meantime, a gram-negative bacterium (strain MDA3079) was isolated from the two bottles of aerobic blood culture that were drawn in the emergency department after an incubation of 3 days (there was no growth from Isolator tubes for 4 days, and no anaerobic cultures were performed). The organism was shown by Etest to be susceptible to amikacin (MIC, 1.5 μg/ml), cefepime (MIC, 0.38 μg/ml), ceftazidime (MIC, 0.064 μg/ml), ciprofloxacin (MIC, 0.016 μg/ml), imipenem (MIC, 0.032 μg/ml), ticarcillin-clavulanate (MIC, 0.03 μg/ml), and trimethoprim-sulfamethoxazole (MIC, 0.03 μg/ml). Fastidious growth of the organism prompted a sequencing analysis of the 16S rDNA for identification, along with the usual phenotypic studies, which were more time-consuming. A species of Cardiobacterium resembling C. hominis was suggested by the sequencing analysis. Thus, antibiotic therapy was switched to piperacillin and tazobactam, which were generally considered to be the drugs of choice (18), and was continued for 6 weeks intravenously.

After the aneurysm and infection had been treated (23 days after the onset), the patient underwent aortic valve replacement surgery. During the surgery, a congenital bicuspid aortic valve (CBAV), which had been severely damaged, was noted. An exploration of the mitral valve revealed mild prolapse, of which the patient had a history. Histological examination of the aortic valve and root showed acute and chronic inflammation, granulation tissue, fibrous thickening, calcification, and a thrombus. Forty-one days after onset, the patient was discharged from the hospital. At a 7-month follow-up, a cerebral arteriography revealed no evidence of aneurysm. His blood pressure was 104/58 mm Hg, and his pulse rate was 79 beats/min. His speech essentially returned to normal. The patient returned to work at 1 year postinfection. In view of his CBAV, his family was encouraged to undergo cardiac screening.

MATERIALS AND METHODS

Bacterial cultures and strains.

Blood cultures were performed with a set of Isolator tubes (Wampole, Cranbury, N.J.) and Bactec 9240 Plus Aerobic/F bottles with resin (BD Diagnostic Systems, Sparks, Md.). The Isolator tubes were incubated for 4 days, and the Bactec bottles were incubated for 7 days under continuous automated monitoring for bacterial growth in the medium. Anaerobic cultures were not routinely set up in our laboratory at The University of Texas M. D. Anderson Cancer Center, a 500-bed tertiary care cancer hospital, where approximately 30,000 blood cultures were performed. All subcultures were plated on blood agar and chocolate agar (BBL, Becton Dickinson Microbiology Systems, Cockeysville, Md.) and incubated aerobically at 35°C with 5% CO₂. The strain isolated from our patient, MDA3079, and the C. hominis type strain ATCC 15826 were used for side-by-side studies. In addition, seven other C. hominis strains, including clinical strain NYU-L48789 (13) and American Type Culture Collection (ATCC) strains 14900, 15827, and 29308 to 29311, were also sequenced and examined for morphology. Of all nine strains studied, ATCC 15827 was the only strain isolated from a throat culture; all others were isolated from blood (1, 13).

Sequencing of the 16S rDNA and phylogenetic analysis.

The amplification of 16S ribosomal DNA (rDNA) by PCR and subsequent sequencing of the amplicon were performed as described previously (7). Briefly, extracted genomic DNA was amplified by a set of highly conserved (universal) bacterial primers: 5′ TGCCAGCAGCCGCGGTAATAC 3′ and 5′ CGCTCGTTGCGGGACTTAACC 3′ (positions 515 to 1,107 of Escherichia coli J01859). Sequencing of the 593-bp amplicon was performed by the dye terminator method in an ABI 377 sequencer (Applied Biosystems, Foster City, Calif.). All strains were sequenced to this length. In addition, strain MDA3079 was further amplified to 1,490 bp (nearly full length) with two primers: 5′ GCGTGCTTAACACATGCAAGTC 3′ and 5′ AGGAGGTGATCCAACCGCA 3′ (positions 42 to 1,539 of E. coli J01859). The strain was sequenced with these and a few sets of internal primers.

The phylogenetic analysis was performed by using the Drawtree program of PHYLIP (http://www.molgen.mpg.de) and Clustal W multiple alignments (http://www.ebi.ac.uk/clustalw) (6).

Phenotypic characterization.

Biochemical tests were performed in conventional tube media (BBL, Becton Dickinson Microbiology Systems) and miniaturized API 20NE (BioMerieux, Marcy-l'Etoile, France). The tube media were oxidative-fermentative base media, and the choice of substrates is shown in Table 1. Cell wall fatty acids were analyzed in a commercial laboratory by gas liquid chromatography and Sherlock version 4.0 software (Microbial ID, Inc., Newark, Del.). The antibiotic susceptibility tests were performed with Etest (Biodisk, Solna, Sweden) on nonstandardized blood Mueller-Hinton agar with 48 h of incubation and were interpreted according to the breakpoints set for Pseudomonas aeruginosa and non-Enterobacteriaceae by the National Committee for Clinical Laboratory Standards (14).

TABLE 1.

Phenotypic characteristics of C. hominis and MDA3079^a

Characteristic	C. hominis ATCC 15826T	MDA3079
Colony under dissecting microscope
On blood agar	0.8 mm at 48 h, 1.6 mm at 72 h, 2.2 mm at 96 h, no agar pitting	0.2 mm at 48 h, 0.6 mm at 72 h, 0.8 mm at 96 h, no agar pitting
On chocolate agar	0.3 mm at 48 h, 0.8 mm at 72 h, slight agar pitting	0.1 mm at 48 h, 0.4 mm at 72 h, apparent agar pitting
Morphology	Round, opaque, smooth, and glistening	Round, opaque, smooth, and glistening
Hemolysis of sheep blood	Slight alpha-hemolysis	−
Growth:
On MacConkey agar	−	−
In microaerophilic jar	Slight growth	Slight growth
In anaerobic chamber	−	−
Gram stain	Gram negative, decolorized by acetone-alcohol, rarely teardrop shaped	Gram negative, decolorized by acetone-alcohol, rarely teardrop shaped
Cellular morphology	Pleomorphic to short rod and 1 by 1.5-3 μm when grown on blood agar, longer thin rod and 0.7 by 2-4 μm when grown on chocolate agar	Regular rod and 1 by 2-4 μm when grown on blood agar, pleomorphic to short rod and 1 by 1.5-3 μm when grown on chocolate agar
Motility	−	−
Production of:
Indole	+ (weakly)	+ (strongly)
Cytochrome oxidase	+	+
H2S on lead acetate paper strip	+	+
Catalase	−	−
Nitrate reduction	−	−
Urea hydrolysis	−	−
Esculin hydrolysis	−	−
Gas from glucose	−	−
API 20NE result	Reactive for tryptophanase and oxidase only, code 2000004	Reactive for tryptophanase and oxidase only, code 2000004
Oxidation/fermentation of:
Dextrose	+/+	+/±
Fructose	+/+	+/−
Galactose	−/−	−/−
Lactose	−/−	−/−
Maltose	+/+	−/−
Mannitol	+/+	−/−
Mannose	+/+	+/+
Raffinose	−/−	−/−
Sorbitol	+/+	+/+
Sucrose	+/+	−/−
Xylose	−/−	−/−
Fatty acid profile (%)
12:0	8.15	6.88
14:0	14.14	15.98
14:0-3-OH/16:1 ISO	2.76	3.07
16:1ω7c/15:0 ISO 2-OH	3.18	3.37
15:0	1.27	0.00
16:0	21.13	27.84
16:0-3-OH	2.01	2.32
18:2ω6,9c/18:0 ANTE	0.00	0.90
18:1ω7c	45.54	38.00
18:0	1.20	1.64
Total	99.4b	100.0
Similarity index	1.00	0.742

^a+, positive; −, negative, ±, weakly positive.

^bDoes not add up to 100% due to rounding up and averaging of results from multiple runs.

Nucleotide sequence accession number.

The 16S rDNA sequence of MDA3079 is deposited under GenBank accession number AF506987.

RESULTS

16S rDNA sequencing and phylogenetic analysis.

The 16S rDNA of strain MDA3079 was further sequenced to 1,493 bp. A query to the GenBank database revealed a 96.4% (1,379 of 1,430 bp) match with the 16S rDNA of C. hominis ATCC 15826^T (GenBank accession number M35014) (2), suggesting that MDA3079 is closely related to but different from C. hominis. MDA3079 matched best (99.3%, or 1,429 of 1,439 bp) with a previously unnamed Cardiobacterium sp., strain B (AF144696), that was isolated from a dental plaque in Denmark in the late 1980s, but the strain was unfortunately lost (M. Kilian and B. Pastor, personal communication). The matches with two other genera of the family Cardiobacteriaceae (2), Suttonella indologenes (M35015) and Dichelobacter nodosus (M35016), were at 92%. A phylogenetic analysis of these organisms is shown in Fig. 1. Evidently, MDA3079 shares a common root with C. hominis; however, significant sequence variations suggest the probability of a new species. For the seven other C. hominis strains (six ATCC strains and NYU-L48789) analyzed, the sequences (to 593 bp) were all identical to the type strain, thus confirming species identification of these organisms at the 16S rDNA level and demonstrating intraspecies sequence homogeneity.

FIG. 1.

(A) Phylogenetic tree of the family Cardiobacteriaceae, with P. aeruginosa as the out-group organism; (B) representative significant mismatches among the Cardiobacterium spp., with listed positions referring to those for C. hominis.

Phenotypic characterization.

The phenotypic features of MDA3079 were compared with those of C. hominis (Table 1). Both organisms were fastidious and showed better growth on sheep blood agar than on chocolate agar. MDA3079 grew more slowly, and the colonies were pinpoint (0.2 mm) at 48 h and became visible (0.6 mm) at 72 h but hardly reached 1 mm after extended incubation. In contrast, the colonies of C. hominis were readily visible (0.8 mm) at 48 h and reached 2.2 mm at 96 h. Under a dissecting microscope, the colonies of both organisms were observed to be round, elevated, opaque, smooth, and glistening. MDA3079 was nonhemolytic on sheep blood agar, whereas C. hominis had a tint of alpha-hemolysis, better shown after 3 to 4 days of incubation. This feature was consistent among all eight strains of C. hominis examined. Both organisms pit chocolate agar but not blood agar. They were gram-negative rods readily decolorized by acetone-alcohol. When first isolated from our patient, MDA3079 exhibited readily noticeable swollen ends (teardrops); however, this feature became occasional to rare after it was subcultured and stored at −80°C. The swollen ends were rarely observed for the C. hominis strains. The size and shape of both organisms varied considerably depending on the culture medium (Fig. 2; Table 1). On blood agar, the favored growth medium for both organisms, MDA3079 was a fairly large, regular bacillus (1 by 2 to 4 mm), while C. hominis was a short rod (1 by 1.5 to 3 μm). On chocolate agar, however, MDA3079 became a short rod (1 by 1.5 to 3 μm), whereas C. hominis was long and thin (0.7 by 2 to 4 μm).

FIG. 2.

Gram stain morphology (magnification, ×1000). MDA3079 was grown on blood agar (organism sizes, 1 by 2 to 4 μm) (A) and chocolate agar (organism sizes, 1 by 1.5 to 3 μm) (B). C. hominis was grown on blood agar (organism sizes, 1 by 1.5 to 3 μm) (C) and chocolate agar (organism sizes, 0.7 by 2 to 4 μm) (D).

Conventional biochemical tests (Table 1) revealed that MDA3079, like C. hominis, was positive for indole, cytochrome oxidase, and hydrogen sulfite production but negative for catalase production, urea hydrolysis, esculin hydrolysis, and nitrate reduction. Of note was that the spot indole reaction for MDA3079 was strong and immediate (bright green), in contrast to the weaker and slower reaction for C. hominis (dull blue to green for all eight strains examined). Both organisms utilized dextrose, fructose, sorbitol, and mannose. However, unlike C. hominis, MDA3079 did not utilize sucrose, maltose, or mannitol. On a miniaturized API 20NE test, neither organism reacted as described above (code 2000004), resulting in misidentifications as Pasteurella multocida (95.7% confidence). Thus, API 20NE was unsuitable as a test for these fastidious organisms.

Analysis of cell wall fatty acids showed that MDA3079 had an overall similarity index of 0.742 (of 1.00) with C. hominis (Table 1), suggesting a good match. However, MDA3079 exhibited some noticeable differences in the major peaks, such as with carbons with 16:0 and 18:1ω7c chain lengths. Therefore, while MDA3079 was qualitatively and quantitatively consistent with members of the genus Cardiobacterium, novel species status could not be confidently established by this method. Future analysis of additional strains may be needed in this regard.

Together, the above phenotypic characteristics suggest that MDA3079 differs considerably from C. hominis despite many similarities. These different features should separate the two organisms at the phenotype level. The validity of these results was supported by the fact that the phenotype and biochemical reaction of the C. hominis strains were essentially identical to those that were described in the literature (9, 20).

DISCUSSION

In view of the phylogenetic distance and phenotypic differences between MDA3079 and C. hominis (the sole species in the genus), the previous isolation of a similar Cardiobacterium sp., strain B, and the medical significance of this strain, we propose species status for MDA3079, C. valvarum sp. nov. Despite efforts to obtain or identify additional C. valvarum strains, including 16S rDNA sequencing analysis of the seven other C. hominis strains, no additional C. valvarum strains have so far been found; hopefully, this study will raise awareness of this rare but dangerous organism. This novel species will also add to the diversity of the genus Cardiobacterium.

Description of C. valvarum sp. nov.

C. valvarum (val.va′rum. M.L. fem. n. valvarum, folding doors, referring to the heart valve) is a fastidious gram-negative bacillus. Its preferred culture medium is sheep blood agar, and visible colonies appear after an incubation period of 3 days. The colonies, observed under a dissecting microscope, are round, elevated, opaque, smooth, and glistening. However, the colonies hardly reach 1 mm after extended incubation. Thus, C. valvarum is more fastidious than C. hominis, whose colonies appear after a 2-day incubation and reach a diameter of 2.2 mm after 4 days. Microscopically, C. valvarum appears readily decolorized by acetone alcohol, and the cellular morphology varies depending on culture medium. When grown on blood agar, it is a fairly large regular bacillus, measuring 1 by 2 to 4 μm. On chocolate agar, it is smaller and pleomorphic. C. valvarum is positive for the production of indole (strong spot indole reaction), cytochrome oxidase, and hydrogen sulfite but negative for catalase production, urea hydrolysis, esculin hydrolysis, and nitrate reduction. It utilizes dextrose, fructose, sorbitol, and mannose, like C. hominis, but unlike C. hominis does not utilize maltose, sucrose, or mannitol. The type strain is MDA3079, which is deposited as ATCC BAA-694, NCTC 13294, or CCUG 48245. It was isolated in 2001 from the blood of a 37-year-old man with endocarditis. C. valvarum is probably an oral organism, like C. hominis, in view of (i) the origin of Cardiobacterium sp. strain B from a dental plaque, (ii) the recent detection of strain B in an oral lesion (15), and (iii) the history of dental work of our patient.

The clinical features of the patient's case illustrate a few interesting points. The endocarditis was afebrile and insidious, so that the patient did not seek early medical attention until the rupture of a cerebral aneurysm. Among all the 50 or so patients reported to have C. hominis endocarditis, approximately one-third were also afebrile (18, 20). In view of the previously sole species status of C. hominis and the many overlapping phenotypic features of C. hominis and C. valvarum, we think some of those afebrile cases might have been caused by C. valvarum. However, the lack of early recognition of C. valvarum attests to its rarity (more rare than C. hominis). Cerebral aneurysm occurs as a rare complication of bacterial endocarditis, and to our knowledge, there have been only four reported cases of cerebral aneurysm with C. hominis endocarditis (10, 12, 13, 16). In one of the cases (13; J. Lynfield, personal communication), the eventual diagnosis of indolent endocarditis was initially unsuspected for the 47-year-old man who presented with headache and aphasia and had a 30-year history of aortic valvotomy due to CBAV. His mild leukocytosis prompted a blood culture, which revealed C. hominis (strain NYU-L48789), which was identified initially by biochemical tests and later by our 16S rDNA sequencing analysis.

CBAV was a probable predisposing factor for our patient to contract the endocarditis. Occurring in 1 to 2% of the general population, CBAV is one of the most frequent congenital cardiac anomalies (19). Serious complications, such as aortic stenosis, regurgitation, and infection, develop in approximately one-third of patients with CBAV (19). In two recent studies of infective endocarditis of native valves, patients with CBAV accounted for 12.3 and 16.7% of all patients (3, 11). Therefore, we estimate that the presence of this congenital anomaly incurs at least a 10- to 20-fold-higher relative risk for endocarditis. In addition, in the Lamas and Eykyn study (11), all of the 50 patients with CBAV endocarditis were men with a mean age of 39 years. Our patient, being a 37-year-old man, fits these general characteristics well. The clinical and pathophysiological implications of CBAV have been reviewed previously (5). The majority of CBAVs are nonobstructive at birth; however, with time, wear and tear cause fibrosis, stiffness, obstruction, and calcification in a few of these valves (15). Sooner or later depending on the initial severity of the deformity, but usually by age 39, as suggested by the mean age of these patients, the damage becomes severe enough to be an infection-prone niche. It is unexplained, however, why such endocarditis affects men far more frequently than women. The occurrence of CBAV has a high rate of familial clustering, with some evidence suggestive of inheritance through autosomal dominance with reduced penetrance (1a, 4, 8). Men and women are equally affected in the familial cases, whereas the male-to-female ratio is 1.8:1 in nonfamilial cases (8).

ADDENDUM IN PROOF

We have identified three oral strains of C. valvarum in the CCUG collection, all of which are being characterized.