Externa otitis caused by the Graphium stage of Pseudallescheria apiosperma

Abstract

We report a case of otomycosis caused by the Graphium stage of Pseudallescheria apiosperma in an immunocompetent 32 years old man who was suffering from hypoacusia and purulent otorrhea. Isolates were identified as Graphium stage of Pseudallescheria sp. on the basis of macroscopic and microscopic characteristics. Pseudallescheria apiosperma was correctly identified by PCR sequencing of ITS regions and β-tubulin gene. In this case the contamination could be due to intensive activity of gardening with poor hygiene.

1. Introduction

Significant taxonomic developments have taken place in Pseudallescheria during the past 5 years. Scedosporium apiospermum was for a long time considered to be the anamorph of Pseudallescheria boydii. At present, P. boydii (anamorph S. boydii) and S. apiospermum (teleomorph P. apiosperma) are judged to represent two different species [1]. The Pseudallescheria complex now comprises five species: Scedosporium dehoogii, S. aurantiacum, Pseudallescheria minutispora, P. apiosperma, and P. boydii. But, the validities of some sibling species are still debated [2,3]. The taxonomic entities differ in ecology and in their ability to cause infections in human [4]. P. apiosperma appears to be the prevalent clinical species [5]. While Graphium may be isolated as an occasional contaminant, its telemorph Pseudallescheria and its synanamorph Scedosporium may cause diseases [6]. We report an unusual case of otitis externa due to the Graphium stage of P. apiosperma.

2. Case

A 32-year-old man was referred to the otolaryngology clinic with complaint of ear infection. He was suffering from hypoacusia for 7 years and right purulent otorrhea for 4 years before the first consultation (November 2010). There was no history of fever or other systemic symptoms. Ciprofloxacin (500 mg×2/day) and ofloxacin–ear solution (1 single- dispensing container×2/day) were prescribed for seven days as a probabilistic antibiotherapy, without any improvement. But also, evolution was marked 6 months later by occurrence of left ear otorrhea. The otoscopy showed the presence of fetid yellowish white pus, in both external auditory canals which were very inflammatory. Auricular swab and aspiration were practiced. The bacterial cultures were negative while the direct examination showed hyaline septate branching mycelium and spherical conidia. Culture on Sabouraud medium without actidione and malt agar allowed isolating the fungus that was identified as Graphium stage of Pseudallescheria sp.: fast-growing cottony colonies, white becoming gray (Fig. 1a). The microscopic examination revealed oval conidia and synnemata: large, erect bundles of hyphae terminating in a dense aggregate of conidiogenous cells (Fig. 1b). Conidiogenesis was annellidic. No cleistothecia were found after 3 weeks. This result was confirmed by repeated sampling and visualization of a fungal ball in the liquid of aspiration. In fact, many samples (more than 5 folds) were taken at different times (separated about 15–30 days) during the follow up of our patient. And all mycological examinations of these different were positive for Graphium stage of Pseudallescheria sp.

Fig. 1.

Graphium stage of Pseudallescheria apiosperma (a) Macroscopy and (b) microscopy: Synnemata of Graphium.

A PCR sequencing of the internal transcribed spacer regions of the ribosomal DNA (ITS) and the β-tubulin gene was realized. Primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) [7] were used to amplify ITS regions. Primers Bt2a (5′–GGTAACCAAATCGGTGCTGCTTTC-3′) and Bt2b (5′–ACCCTCAGTGTAGTGACCCTTGGC-3′) [8] were used to amplify the partial β-tubulin gene region. The PCR reaction mix contained 10 µl of 10× reaction buffer (Go Taq DNA buffer; Promega), 2.5 mM of MgCl₂, 0.2 mM of dNTPs, 0.3 mM of each primer, and 2.5 unit of Go Taq DNA polymerase (Promega). PCR was performed in a thermocycler (Mastercycler^® eppenddorf, Germany). It consisted of an initial denaturation at 94 °C for 5 min, followed by 35 cycles of 1 min at 94 °C, 30 s at 60 °C, and 1 min at 72 °C and a final extension at 72 °C for 10 min. The amplification of the ITS region resulted in fragment of 614 bp. Amplicon for the β-tubulin gene region was approximately 595 bp in length. Purification of PCR products was done using a DNA purification kit Promega (Wizard SV Gel and PCR Clean-Up System) according to the manufacturer's request. The nucleotide sequences were determined automatically using the BigDye^® Terminator v3.1 Cycle Sequencing Kit in the ABI PRISM 3100-Avant Genetic Analyzer with the primers mentioned for each region. The two sequences were submitted to GenBank under the accession numbers: JX032762 and JX032763. The etiological agent was than correctly identified down to species level as the Graphium stage of Pseudallescheria apiosperma with assistance of CBS members (Fungal Biodiversity Centre, Utrecht, The Netherlands) using the Scedosporium/ Pseudallescheria in-house database.

The interrogation revealed an activity of gardening (harvest of olives in winter and almonds in summer). The patient was treated successfully with intense cleaning and Ecorex^® (5 drops×2/day) for 10 weeks.

3. Discussion

Pseudallescheria boydii and P. apiosperma strains have been isolated from clinical samples worldwide, and both species are regarded as environmental opportunic fungi with similar spectra of clinical manifestations. In temperate climates, P. apiosperma can be isolated from soils with increased nitrogen concentrations and lowered pH [4]. In arid areas, such as Australia and Spain, the member of the Pseudallescheria clade, most frequently isolated from environmental and clinical samples is S. aurantiacum [9]. In contrast, P. boydii is the most frequently encountered agent in human infection [4]. In general, members of the Pseudallescheria clade tend to inhabit environments with increased human impact (agricultural soils, urban playgrounds, industrial areas, hydrocarbon-contaminated soils) and are also able to cause infections. In immunocompetent patients these infections are either traumatic or cerebral in almost drowned victims [10,11], whereas in immunocompromised patients (e.g. transplant recipients) disseminated infections occur [12].

Several clinical and animal cases attributed to Graphium species probably concerned misidentified strains [13]. Graphium eumorphum, of which no type material is known to exist, was reported from a case of otitis externa [14]. The ITS sequence of the strain from this case, CBS 987.73 was found to be identical to the ex-type strain of P. apiosperma, CBS 117407. A systemic infection with cerebral involvement in a dog caused by G. fructicola was described [15]. But neither the original fungal material nor the veterinary specimen are known as preserved. The brain abscesses including histopathology reported in this case [15] were similar to those caused by P. apiosperma and P. boydii in human infections, so a species of the Pseudallescheria clade may have been involved [13].

Already in the 19th century S. apiospermum (the syanamorph of Graphium) was observed to be involved in cases of otitis, but this disorder is infrequent [12]. Among 370 cases of human infections caused by Scedosporium spp. submitted to the Fungus Testing Laboratory at The University of texas health science center at San Antonio from 2000 to 2007, there were 5 cases of otitis [16]. In total, about twenty cases of otitis externa due to Scedosporium were described in the literature [17].

We incriminated this fungus at the origin of this otomycosis, by basing on several criteria: abundance of hyaline mycelium and spores in numerous direct examinations, pure cultures isolating Graphium stage with the absence of another fungus or bacterial agents associated and therapeutic test (very good response after antifungal therapy: no otorrhea, nor inflammatory aspects of external auditory canals and mycological examination became negative).

For our case, both ears were affected. Generally, the occurrence of bilateral otomycosis is very low. In fact, a bilateral involvement is observed in 7%–20% of patients [18–20].

Graphium synemata are uncommonly observed in the clinical laboratory. It may be produced at the edge of colony in later stages [16]. In this case, ours isolates of Graphium stage of P. apiosperma were identified initially on the basis of phenotypic characteristics. PCR sequencing of ITS regions and β-tubulin gene was useful to eliminate Graphium-like species having affinities to the family Ophiostomatales and which are placed in the genus Pesotum, but this method was unable to distinguish between the Graphium state and the sexual state P. apiosperma. Various genetic clusters close to P. apiosperma have subsequently been described as separate taxa on the basis of multilocus analyses, mating experiments, morphology and physiology. Given the near absence of classical criteria and the fact that some of the species, such as P. boydii and P. apiosperma, also have closely similar ITS sequences. The differences between P. boydii and P. apiosperma is very small, with a minimum ITS distance of 0.3% [5].

How our patient acquired his infection is unknown. He lived in a rural area of Sfax (Tunisia), where he regularly worked in his yard. It is probably a simple contamination with telluric origin regarding to the existence of an intense activity of gardening and pitiful sanitary conditions.

Members of this species are known to carry multiple resistances against all available antifungal drugs [12]. No data about antifungal susceptibilities are available for Graphium stage. Published studies of in vitro susceptibility profiles according to the latest taxonomical standards are rare. The two species P. apiosperma and P. boydii have similar susceptibility profiles, with the lowest MICs/MECs of Voriconazole and Micafungin. However, P. apiosperma was found to be more susceptible to Posaconazole than was P. boydii [21]. For our case, Econazole nitrate has shown efficacy in this clinical setting. Bassiouny et al. studied also the effects of antifungal agents and found that econazole was effective antifungal agents in the treatment of otomycosis [22]. Removal of debris and thorough cleaning of the ear is also important for treatment of otomycosis as it was noted in our case and recommended by Vennewald et al. [23].

P. apiosperma and its Graphium stage are emerging opportunist pathogens among immunocompetent individuals and also among immunocompromised patients. Isolation, proper identification, and susceptibility testing of this fungus are important steps in the optimal treatment of these infections.

Conflict of interest

No conflict of interest statement.