Skip to main content
Molecules and Cells logoLink to Molecules and Cells
. 2012 Jun 4;34(1):77–84. doi: 10.1007/s10059-012-0102-6

Overexpression of 3β-Hydroxysteroid Dehydrogenases/C-4 Decarboxylases Causes Growth Defects Possibly Due to Abnormal Auxin Transport in Arabidopsis

Bokyung Kim 1, Gyusik Kim 1, Shozo Fujioka 2, Suguru Takatsuto 3, Sunghwa Choe 1,4,*
PMCID: PMC3887785  PMID: 22673766

Abstract

Sterols play crucial roles as membrane components and precursors of steroid hormones (e.g., brassinosteroids, BR). Within membranes, sterols regulate membrane permeability and fluidity by interacting with other lipids and proteins. Sterols are frequently enriched in detergent-insoluble membranes (DIMs), which organize molecules involved in specialized signaling processes, including auxin transporters. To be fully functional, the two methyl groups at the C-4 position of cycloartenol, a precursor of plant sterols, must be removed by bifunctional 3β-hydroxysteroid dehydrogenases/C-4 decarboxylases (3βHSD/D). To understand the role of 3βHSD/D in Arabidopsis development, we analyzed the phenotypes of knock-out mutants and overexpression lines of two 3βHSD/D genes (At1g47290 and At2g26260). Neither single nor double knock-out mutants displayed a noticeable phenotype; however, overexpression consistently resulted in plants with wrinkled leaves and short inflorescence internodes. Interestingly, the internode growth defects were opportunistic; even within a plant, some stems were more severely affected than others. Endogenous levels of BRs were not altered in the overexpression lines, suggesting that the growth defect is not primarily due to a flaw in BR biosynthesis. To determine if overexpression of the sterol biosynthetic genes affects the functions of membrane-localized auxin transporters, we subjected plants to the auxin efflux carrier inhibitor, 1-N-naphthylphthalamic acid (NPA). Whereas the gravity vectors of wild-type roots became randomly scattered in response to NPA treatment, those of the over-expression lines continued to grow in the direction of gravity. Overexpression of the two Arabidopsis 3βHSD/D genes thus appears to affect auxin transporter activity, possibly by altering sterol composition in the membranes.

Keywords: 3β-hydroxysteroid dehydrogenase, brassinosteroids, membrane raft, NPA, sterol

INTRODUCTION

Sterols are important components of membranes and play crucial roles in the growth, differentiation, and development of eukaryotic organisms. Yeast, higher plants, and animals have different forms of major sterols, i.e., ergosterol, sitosterol, and cholesterol, respectively (Benveniste, 2004). Plant sterols, including sitosterol, stigmasterol, 24-methylcholesterol, and campesterol (CR), regulate membrane permeability and fluidity by interacting with other lipids and proteins within the membranes (Hartmann, 1998; Kim et al., 2011). Sterols are often enriched in detergent-insoluble membranes (DIMs), which are thought to organize specialized signaling proteins at specific positions within the plasma membrane (Simon-Plas et al., 2011). DIMs are thought to play a role in signaling processes that involve Pathogen-Associated Molecular Patterns (PAMPs) (Bhat et al., 2005) and auxin transporters (Hanzal-Bayer and Hancock, 2007; Titapiwatanakun et al., 2009). In addition, sterols serve as biosynthetic precursors of growth-promoting steroid hormones, such as brassinosteroids (BRs) in plants (Kwon and Choe, 2005).

The biosynthesis of plant sterols from the initial precursor squalene involves up to 13 enzymatic steps (Schaller, 2004). Squalene is cyclized to produce the first 4-ring structure, named cycloartenol (Darnet and Rahier, 2004). To become a functional sterol, the two methyl groups at the C-4 position of cycloartenol should be removed by an enzyme complex that includes a sterol 4α-methyl oxidase (SMO) (Darnet and Rahier, 2004). In Arabidopsis, two redundant genes encoding bifunctional 3β-hydroxysteroid dehydrogenases/C-4 decarboxylases (3βHSD/D) were shown to be responsible for this step (Rahier et al., 2006).

The plant growth promoting steroid hormones, brassinosteroids (BRs), regulate cell division (Cheon et al., 2010; Ibanes et al., 2009), cell growth (Clouse and Sasse, 1998), and stress responses (Krishna, 2003). BR biosynthesis is affected by both an endogenous signal, such as auxin (Chung et al., 2011; Maharjan et al., 2011), and an exogenous cue, such as temperature (Gray et al., 1998; Maharjan and Choe, 2011). In the BR biosynthetic pathways, 3βHSD/D epimerizes the hydroxyl group at the C-3 of CR to convert it to brassinolide (BL), the most bioactive BR compound (Fujioka and Yokota, 2003; Kwon and Choe, 2005); however, the gene governing this step has not been identified. Mutants that are defective in either sterol or BR pathways highlighted the importance of these compounds in plant development. Sterol mutants, such as cyclopropylsterol isomerase (cpi) (Willemsen et al., 2003), fackel (fk) (Jang et al., 2000; Schrick et al., 2000), cytochrome P450 51A2 (cyp51A2) (Kim et al., 2010), and hydra1(hyd1) (Souter et al., 2002), display severe growth defects, partly due to abnormal positioning of PIN2 in response to developmental signals (Men et al., 2008). By contrast, BR-deficient mutants, such as dwf7 (Choe et al., 1999b), dwf1 (Choe et al., 1999a), dwf5 (Choe et al., 2000), det2 (Li et al., 1996), dwf4 (Choe et al., 1998), and cpd (Szekeres et al., 1996), and a double cyp85a1 and cyp85a2 mutant (Kim et al., 2008), display characteristic dwarf phenotypes that can be rescued by exogenous treatment with BRs. However, the phenotype of sterol mutants (e.g., fackel, hydra1, and cyp51A2) was not restored to wild type by BRs, which indicates the essential role of sterols in plant development. Because the sterol mutants had an embryonic lethal phenotype, it is difficult to establish the effects of these mutations on later developmental processes.

Previously, Rahier et al. (2006) reported that two Arabidopsis genes encode 3β-hydroxysteroid dehydrogenases/C-4 decarboxylases (3βHSD/D), i.e., 3βHSD/D1 (At1g47290) and 3βHSD/D2 (At2g26260), and found that these genes can complement a deficiency of 4α-methyl oxidase function in the yeast erg25 mutant. However, genetic or transgenic analysis of these genes has yet to be conducted. In this study, we report the importance of these genes in Arabidopsis development by analyzing both knock-out mutants and overexpression lines. The transgenic lines exhibit phenotypes that specifically involve inflorescence internodes. The overexpression lines showed different degrees of internode shortening that depended on the degree of 3βHSD/D1 and/or 3βHSD/D2 expression. Our data provide evidence that 3βHSD/Ds are important to maintain sterol quantity and/or composition at optimal levels which are essential for proper growth and development of Arabidopsis plants.

MATERIALS AND METHODS

Plant growth conditions and the gravitropism assay

Seeds were surface sterilized before being plated on 1/2 MS (Duchefa, Netherland) medium containing 1% (w/v) sucrose and 0.7% (w/v) plant agar. After stratification at 4°C for 3 days, seedlings were grown under long-day conditions (16 h light/8 h dark) at 22°C. Two days after germination, seedlings were transferred to hormone media and grown vertically for 4 more days. The concentration of growth regulators was 10−7 and 10−8 M for epi-BL and 5 × 10−6 M for NPA. Because NPA was dissolved in DMSO for stock solution, we added equal amount of DMSO to the control and consider it as mock treatment. To measure the orientation of the root tip, photographs of square plates were taken and analyzed using ImageJ (http://rsbweb.nih.gov/ij). The number of seedlings with the following root orientations was counted: 45°–135°, 135°–225°, 225°–315°, and 315°–45°.

Cloning of Arabidopsis 3β-HSD cDNAs

The coding sequences of the four 3β-HSDs genes were PCR amplified using the primers listed in Table 1 and cloned into the pENTR/SD/D-TOPO Gateway vector (Invitrogen, USA). Clones with PCR errors were eliminated by sequencing before proceeding to the next step. cDNAs in the entry vector were transferred to the pEarley101 destination vector for overexpression in Arabidopsis (Earley et al., 2006) and the pYES_DEST52 vector (Invitrogen, USA) for overexpression in yeast.

Table 1.

Gene Primer sequences (5′ to 3′)
For RT_PCR
Actin (At5g09810) F AGTGTGTCTTGTCTTATCTGGTTCG
R AATAGCTGCATTGTCACCCGATACT
DWF4 (At3g50660) F AGATGTTCGGTACAAAGGATACGATATC
R GTTTATCATCTTCTGCTAATTCCCAATTG
AtCYP85A2 (At3g30180) F TGTGGTTGGGATGATCTTGA
R CTCCACTGCGGTAATTCGTT
At1g47290 F GCAGCATATTTGGTCCTGGT
R CCAGCAGCTTTTGCACATAC
At2g26260 F TTTTTGGTCCCGGTGATAGA
R ATATGCCTGTCCTGCAGCTT
At2g33630 F TCACTGGAGGTCTTGGCTTC
R GCAAAACACAGTCTGCTCCA
At2g43420 F ATCTGCAGCCCAACTTCTGT
R TCCAGTCTCCTCCACTGCTT
For cloning
At1g47290 F CACCATGGTGATGGAAGTTACAGGAGACTG
R GTCGATCTTCTTGCTCCCGAACA
At2g26260 F CACCATGTCGCCGGCAGCTACG
R TTAGTCATGTTTCTTGCTTCCGAAC
At2g33630 F CACC ATGCATTTGAGTGAGAATGAAG
R AATCTGGTGCTCTTTCGCT
At2g43420 F CACC ATGGACGAAGATTCCGTCC
R CATGAACATTGGTTTAGATGAAG

Total RNA preparation and semi-quantitative RT-PCR analysis

Seven-day-old seedlings of wild-type and overexpression lines were grown in the light and harvested for RNA preparation using TRI Reagent (Molecular Research Center, USA). Three micrograms of total RNA was reverse-transcribed using M-MuLV Reverse Transcriptase (Fermentas, USA). Equal amounts of RT product were used for the PCR reactions. Each template RNA was normalized using the Arabidopsis Actin gene (At5g-09810) as a loading control. The oligonucleotide sequences used for RT-PCR are listed in Table 1.

Quantitative analysis of endogenous BRs and sterols by gas chromatography-mass spectrometry (GC-MS)

To determine the endogenous levels of both sterols and BRs, the aerial parts of 5-week-old Arabidopsis plants were harvested to obtain 30 g of fresh tissues, which was frozen in liquid nitrogen and immediately lyophilized at −80°C. The tissues were extracted twice with 300 ml of MeOH. Deuterium-labeled internal standards synthesized in our lab were added to the extracts. Purification and quantification of sterols and BRs were performed according to the method described previously (Fujioka et al., 2002; Kim et al., 2008).

RESULTS AND DISCUSSION

Two closely related Arabidopsis 3βHSD/D genes

Based on previous findings that Arabidopsis has multiple homologs of 3βHSD/D (Rahier et al., 2006), we performed in silico screening of the NCBI protein database using the sequence of human hydroxy-delta-5-steroid dehydrogenase 3β-hydroxysteroid dehydrogenase/Δ5-Δ4 isomerase (HSD3B1) as a query. The protein sequences deduced from yeast ERG26 and Arabidopsis At1g47290, At2g26260, At2g43420, and At2g33630 emerged as the five sequences with the highest sequence similarity. Multiple sequence alignment analysis revealed that amino acid residues Aspartic acid-39, Tyrosine-159, and Lysine-163 of yeast ERG26 are well conserved in these protein sequences. Since we aimed to understand the effects of the sterol-3-hydroxylase genes in Arabidopsis, we chose to focus on the two functionally characterized genes, At1g47290 and At2g26260. According to the previous report, we will call At1g47290 as 3βHSD/D1 and At2g26260 as 3βHSD/D2 throughout the manuscript.

The percent identity between human HSD3B1 and the Arabidopsis and yeast protein sequences are presented in Fig. 1A. A phylogenetic tree based on this sequence comparison revealed that At1g47290 was closer to human HSD3B1 than At2g26260 (Fig. 1B). To identify knock-out mutants of these genes, we searched the Arabidopsis database (http://www.arabidopsis.org). We found that the SALK_008141 and WiscDsLox342H08 lines have a T-DNA insertion in the At2g26260 and At1g47290 loci, respectively. We identified homozygous lines for these T-DNA insertional mutants by a combination of segregation analysis and PCR-based genotyping. Figure 1C illustrates the position of T-DNA insertion events in these two loci.

Fig. 1.

Fig. 1

Phylogenetic analysis of 3β-hydroxysteroid dehydrogenases/C-4 decarboxylases from yeast, Arabidopsis, and humans. (A) The percent identity between Arabidopsis 3β-hydroxysteroid dehydrogenase/C-4 decarboxylases (3βHSD/D) and the homologs from human and yeast. The numbers indicate percent identity based on multiple alignments of the protein sequences using ClustalW. (B) The phylogenetic tree was generated using Jalview and Figtree 1.3.1 programs. Bootstrap values based on 100 replicates (from 10,000 trials) are shown at the branching points. Scale bar = length of bootstrap value 100. (C) Schematic representation of At2g26260 and At1g47290. The positions of T-DNA inserts are shown with the line numbers. GenBank accession numbers are NP_000853 for human HSD3B1, NP_000189 for human HSD3B2, YGL001C for yeast ERG26, NM_103623 for Arabidopsis At1g47290 (3βHSD/D1), and NM_128183 for Arabidopsis At2g26260 (3βHSD/D2).

Lack of visible phenotype in the double knock-out mutant

To understand the role of these two 3βHSD/D genes in Arabidopsis development, we examined the phenotypes of single and double mutants of these loci. A single mutant for each of these genes did not display a visible phenotype at any point in the life cycle (data not shown). Thus, we generated a double mutant by crossing the two single mutants. After identifying a putative double mutant based on segregation analysis of the antibiotic marker genes in the T-DNA, we confirmed that this plant was indeed a double mutant by PCR amplification of the sequence surrounding the insertion sites. Fig. 2A shows a schematic representation of these loci and the positions of the T-DNA insertion as well as the primer binding sites. An amplification product was only obtained from the wild-type DNA (Fig. 2A), suggesting that the isolated line was homozygous for both of these knock-out genes.

Fig. 2.

Fig. 2

Phenotypic comparison of 7-day-old seedlings of the wild type and double mutant of At2g26260 and At1g47290. (A) Confirmation of the double mutant by showing failure to amplify the DNA around the T-DNA insertion sites. PCR amplifications (shown beneath the diagrams) were performed using the primer pairs shown. DNA amplification was successful only with wild-type DNA, but not with double mutant DNA (double). (B) Average root lengths of the wild type and double mutant. Letter ‘a’ indicates no statistical difference according to Student’s t-test (p < 0.05, n > 10). Error bars represent standard deviation. (C) Morphology of the whole seedlings grown for 1 week under the long-day condition. Bar = 1 cm.

To detect any phenotypic differences between the wild type and the double mutant, we grew the seedlings on agar-solidified media. The root lengths were not significantly different (p < 0.05, n > 15) (Fig. 2B). Furthermore, the overall morphologies of the seedlings and adult plant were not noticeably different (Fig. 2C).

Short internode phenotype during late developmental stages

To examine the function of these genes using inverse approaches, we generated gain-of-function lines by overexpressing these genes. We first evaluated the morphologies of independent transformants harboring the overexpression construct of the At1g47290 gene (At1g47290 OX). At the T1 stage, many of the transgenic lines consistently showed growth retardation (Fig. 3). The five independent lines showed phenotypes of opportunistic suppression of inflorescences. Even within one plant, the growth of some stems was relatively more suppressed than others (Fig. 3). The expansion of leaf blades was unequal toward the long axis, resulting in wrinkled leaves. In addition, the internodes were greatly shortened, causing siliques to aggregate (Fig. 3).

Fig. 3.

Fig. 3

Representative phenotypes of five independent At1g47290 OX lines and the wild type at 5 weeks post germination. The T1 generations are shown. OX lines consistently displayed characteristic phenotypes of opportunistically shortened internodes. For instance, one of the stems of inflorescences in a single line (number 8) appears normal, but the others are greatly affected and show extremely clustered internodes. Similar phenotypes are shown for other lines. The bottom row shows magnified views of the abnormal parts. Bar = 1 cm.

To examine the morphologies of the plants from earlier stages, we obtained homozygous lines for the transgenes at the T3 generation. These transgenic lines expressed higher levels of the transgene than of the nascent genes (Fig. 4A). This finding suggests that the transgenes did not cause co-suppression of the nascent genes. From 1 to 7 days post germination, visible phenotypes were not apparent (Figs. 4B and 4C). However, at later stages, the overexpression lines displayed obvious alterations in their leaf, flower, and inflorescence morphologies (Figs. 4D and 4E). Most strikingly, both overexpression lines displayed growth retardation in inflorescences (line 1-1 in Fig. 4D and 8-4 in Fig. 4E). As seen in the T1 generation (Fig. 3), the siliques were clustered due to suppression of internodes (1-1, Fig. 4D). In addition, the flower shapes of these lines were not normal. Compared to the wild-type control, the overexpression line 8-4 had longer petals and gynoecia, and its petals did not bend outwards (Fig. 4E inset). As a result of the malformed floral structure, the overexpression lines produced fewer seeds than did the wild type.

Fig. 4.

Fig. 4

Morphology of wild-type, At2g26260 OX, and At1g47290 OX plants. (A) Gel image showing cDNA amplified by RT-PCR from the wild type and individual transgenic lines. Identification numbers of independent transformants are indicated below the lanes. The levels of cDNA in transgenic lines were greater than those of the wild type. The Actin gene was used as a loading control. (B) Seedlings at 1 day after germination. Bar = 1 mm. (C) Comparison of OX lines, the wild type, and the double mutant at 7 days after germination. Hardly any phenotypic variation was detected during the seedling stages. (D,E) Phenotypes of the adult stages of the At2g26260 OX and At1g47290 OX lines at 6 and 5 weeks post germination, respectively. Magnified views of flowers from the wild type (left) and 8-4 (right) are shown in the inset of (E). The circled inset shows the floral cluster from line 8-4.

Similar levels of BRs in the overexpression lines

To examine if the morphological aberrations are due to a deficiency in endogenous BRs, we examined the levels of this steroid hormone in both wild type and overexpression lines (Fig. 5). The concentration of this hormone was essentially the same in the wild type and overexpression lines (Fig. 5). For one intermediate of the BR pathway (6-oxoCN), the level was higher in the overexpression lines, whereas the level was lower for 4-en-3-one (Fig. 5). Thus, it is not likely that the phenotypes of the overexpression lines are due to alterations in endogenous BR levels.

Fig. 5.

Fig. 5

Endogenous levels of BR biosynthetic intermediates in wild-type (Col-0), At2g26260 OX, and At1g47290 OX lines. BR content was determined using the aerial parts of plants at 5 weeks post germination. The concentration of BRs in the two overexpression lines is similar for all intermediates examined. Abbreviations: 4-en-3-one, 22-hydroxy-ergost-4-en-3-one; 3-one, 22-hydroxy-5β-ergostan-3-one; CN, campestanol; 6-OxoCN, 6-oxocampestanol; 22-OH CR, 22-hydroxycampesterol; 22-OH-3-one, 22-hydroxy-5-ergostan-3-one; 6-DeoxoCT, 6-deoxocathasterone; and 3-epi-6-DeoxoCT, 3-epi-6-deoxocathasterone.

Different mechanisms of transcriptional regulation from BR biosynthetic genes

To further rule out the possibility that the overexpression phenotypes of the two 3βHSD/D genes are not due to BRs, we examined the expression pattern of two genes involved in BR biosynthesis after BR treatment. When wild-type seedlings were treated with two different concentrations (10−8 and 10−6 M) of epi-BL, the expression of two genes involved in BR biosynthesis, CYP85A2 (Kim et al., 2008) and DWF4 (Chung et al., 2011; Kim et al., 2006; Maharjan and Choe, 2011; Maharjan et al., 2011), was downregulated in proportion to the concentration of epi-BL applied (Fig. 6). However, the transcript levels of two 3βHSD/D genes hardly changed after epi-BL treatment. This result suggests that the transcriptional regulation mechanism of these two genes differs from feedback downregulation by BL concentrations.

Fig. 6.

Fig. 6

The transcript levels of BR biosynthetic genes and 3β-HSD/Ds from Arabidopsis Col-0 wild-type seedlings. DWF4, CYP85A2, At1g47290, and At2g26260 transcript levels were examined using total RNA prepared from seedlings treated with and without epi-BL. The levels of BR biosynthetic genes (DWF4 and CYP85A2) gradually decreased proportional to the concentration of epi-BL, whereas those of At1g47290 and At2g26260 were unchanged by the treatments. Actin was used as a loading control.

Altered response of the overexpressors to an auxin efflux inhibitor

To explore the possibility that auxin is involved in the phenotype of the overexpression lines, we examined whether the overexpression lines had altered responses to treatment with the auxin efflux inhibitor, 1-N-naphthylphthalamic acid (NPA). Root gravity vectors were examined in Arabidopsis seedlings grown on agar-solidified media supplemented with mock (DMSO) or 5 μM NPA in a vertical position. As expected, mock-treated wild-type seedlings grew toward gravity and the angle between hypocotyls and roots fell within the range of 135–225° (Figs. 7A and 7B). In contrast, the root orientations of wild-type seedlings treated with NPA were distributed in all four categories of angles defined. The abnormal transport of endogenous auxin toward the root tip appeared to affect gravity-responsive growth and caused the roots to grow in random directions.

Fig. 7.

Fig. 7

Comparison of root growth vectors in wild-type and overexpression lines after treatment with the auxin efflux inhibitor, NPA. (A) Classification of the angles of root growth vectors. After treatment with mock (DMSO) or NPA, the growth vectors were determined and placed in one of the four categories. (B) The root vector of mock-treated wild-type plants pointed down in the direction of gravity (i.e., 180°); however, the vectors were scattered randomly amongst the four divisions after NPA treatment. (C) The At2g26260 OX line, which is insensitive to NPA, grew in the direction of gravity. (D) At1g47290 OX displayed a similar response as At2g26260 OX. Average values are shown with standard deviation (n > 5). Three biological replicates were performed.

The root orientations of the NPA-treated overexpression lines differed from those of the wild type; the root angles mostly fell into the range of 135–225° regardless of the treatment administered (Figs. 7C and 7D), suggesting that overexpression of these genes hampered NPA responsiveness in these lines.

It was reported that quantitative and qualitative changes in sterol levels in plasma membranes affect the proper repositioning of auxin efflux carriers like PIN1 (Titapiwatanakun et al., 2009). The altered response to NPA observed in our overexpression lines suggests that increased function of these genes led to biochemical changes in membrane sterols. Accordingly, this change might have made the overexpression lines resistant to NPA. Furthermore, it is likely that the opportunistic suppression of internode elongation (Figs. 3 and 4) is due to failure to support the proper re-distribution of auxin transport machinery in response to signals triggered by endogenous developmental programs. To investigate the roles of the two 3βHSD/D genes in Arabidopsis, we examined the phenotypes of both single double mutants of these genes. The observation that the double mutant had virtually no visible phenotype (Fig. 2) suggests that the Arabidopsis genome may contain additional functionally redundant genes besides these two. Further studies of the genes that we identified as distant homologs should address this question.

In contrast, overexpression analysis led to the discovery of novel phenotypes, especially at later developmental stages. Overexpression lines of the two genes exhibited the same phenotypes, such as wrinkled leaves, malformed flowers, and clustered siliques due to shortening of the internodes (Figs. 3 and 4). Consistency in the overexpression phenotypes of these two genes indicates that they participate in the same biochemical reactions; this was indeed shown in previous reports (Rahier et al., 2006; 2009). Since the endogenous levels of BRs were not significantly altered in the overexpression lines (Fig. 5), it is likely that the phenotypes stem from changes in the biochemical properties of membrane sterols. Elevation of 3βHSD/D function in the overexpression lines might have caused the 3-one (22-hydroxy-5β-ergostan-3-one) type of sterol biosynthetic intermediates to accumulate, and this might hinder the formation of modified sterols via the hydroxyl function at C-3. Indeed, it was reported that free and conjugated sterols with fatty acids or sugars at C-3 can be enriched in DIMs or membrane rafts (Simon-Plas et al., 2011). Given that signaling proteins, including auxin transporters (Titapiwatanakun and Murphy, 2009) and receptors (Keinath et al., 2010), are organized in DIMs, failure to supply normal composition of sterols in the overexpression lines might have affected the function of these signaling proteins accordingly.

Using the overexpression lines presented in this study, questions regarding the in vivo function of these genes in sterol metabolic pathways, the biochemical properties of DIMs in plasma membranes, and the signal-triggered relocation processes of auxin transporters, can be addressed in future studies.

Acknowledgments

This research was supported in part by grants from the Next-Generation BioGreen 21 Program (Plant Molecular Breeding Center No. PJ008051), Rural Development Administration, Republic of Korea; by the Technology Development Program (110033-5) for Agriculture and Forestry, Ministry for Food, Agriculture, Forestry and Fisheries, Republic of Korea; by the Basic Science Research Program (2010-0012736) through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (to SC); by a Grant-in-Aid for Scientific Research (B) from the Ministry of Education, Culture, Sports, Science and Technology of Japan (grant no. 19380069 to SF), and by Brain Korea 21 Research Fellowships funded by the Ministry of Education, Science, and Technology of the Korean Government (to BK). S.D.G.

REFERENCES

  1. Benveniste P. Biosynthesis and accumulation of sterols. Annu. Rev. Plant Biol. 2004;55:429–457. doi: 10.1146/annurev.arplant.55.031903.141616. [DOI] [PubMed] [Google Scholar]
  2. Bhat R.A., Miklis M., Schmelzer E., Schulze-Lefert P., Panstruga R. Recruitment and interaction dynamics of plant penetration resistance components in a plasma membrane microdomain. Proc. Natl. Acad. Sci. USA. 2005;102:3135–3140. doi: 10.1073/pnas.0500012102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Cheon J., Park S.Y., Schulz B., Choe S. Arabidopsis brassinosteroid biosynthetic mutant dwarf7-1 exhibits slower rates of cell division and shoot induction. BMC Plant Biol. 2010;10:270. doi: 10.1186/1471-2229-10-270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Choe S., Dilkes B.P., Fujioka S., Takatsuto S., Sakurai A., Feldmann K.A. The DWF4 gene of Arabidopsis encodes a cytochrome P450 that mediates multiple 22β-hydroxylation steps in brassinosteroid biosynthesis. Plant Cell. 1998;10:231–243. doi: 10.1105/tpc.10.2.231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Choe S., Dilkes B.P., Gregory B.D., Ross A.S., Yuan H., Noguchi T., Fujioka S., Takatsuto S., Tanaka A., Yoshida S., et al. The Arabidopsis dwarf1 mutant is defective in the conversion of 24-methylenecholesterol to campesterol in brassinosteroid biosynthesis. Plant Physiol. 1999a;119:897–907. doi: 10.1104/pp.119.3.897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Choe S., Noguchi T., Fujioka S., Takatsuto S., Tissier C.P., Gregory B.D., Ross A.S., Tanaka A., Yoshida S., Tax F.E., et al. The Arabidopsis dwf7/ste1 mutant is defective in the delta7 sterol C-5 desaturation step leading to brassinosteroid biosynthesis. Plant Cell. 1999b;11:207–221. [PMC free article] [PubMed] [Google Scholar]
  7. Choe S., Tanaka A., Noguchi T., Fujioka S., Takatsuto S., Ross A.S., Tax F.E., Yoshida S., Feldmann K.A. Lesions in the sterol delta reductase gene of Arabidopsis cause dwarfism due to a block in brassinosteroid biosynthesis. Plant J. 2000;21:431–443. doi: 10.1046/j.1365-313x.2000.00693.x. [DOI] [PubMed] [Google Scholar]
  8. Chung Y., Maharjan P.M., Lee O., Fujioka S., Jang S., Kim B., Takatsuto S., Tsujimoto M., Kim H., Cho S., et al. Auxin stimulates DWARF4 expression and brassinosteroid biosynthesis in Arabidopsis. Plant J. 2011;66:564–578. doi: 10.1111/j.1365-313X.2011.04513.x. [DOI] [PubMed] [Google Scholar]
  9. Darnet S., Rahier A. Plant sterol biosynthesis: identification of two distinct families of sterol 4alpha-methyl oxidases. Biochem. J. 2004;378:889–898. doi: 10.1042/BJ20031572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Earley K.W., Haag J.R., Pontes O., Opper K., Juehne T., Song K., Pikaard C.S. Gateway-compatible vectors for plant functional genomics and proteomics. Plant J. 2006;45:616–629. doi: 10.1111/j.1365-313X.2005.02617.x. [DOI] [PubMed] [Google Scholar]
  11. Fujioka S., Yokota T. Biosynthesis and metabolism of brassinosteroids. Annu. Rev. Plant Biol. 2003;54:137–164. doi: 10.1146/annurev.arplant.54.031902.134921. [DOI] [PubMed] [Google Scholar]
  12. Fujioka S., Takatsuto S., Yoshida S. An early C-22 oxidation branch in the brassinosteroid biosynthetic pathway. Plant Physiol. 2002;130:930–939. doi: 10.1104/pp.008722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Gray W.M., Ostin A., Sandberg G., Romano C.P., Estelle M. High temperature promotes auxin-mediated hypocotyl elongation in Arabidopsis. Proc. Natl. Acad. Sci. USA. 1998;95:7197–7202. doi: 10.1073/pnas.95.12.7197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hanzal-Bayer M.F., Hancock J.F. Lipid rafts and membrane traffic. FEBS Lett. 2007;581:2098–2104. doi: 10.1016/j.febslet.2007.03.019. [DOI] [PubMed] [Google Scholar]
  15. Hartmann M.A. Plant sterols and the membrane environment. Trends Plant Sci. 1998;3:170–175. [Google Scholar]
  16. Ibanes M., Fabregas N., Chory J., Cano-Delgado A.I. Brassinosteroid signaling and auxin transport are required to establish the periodic pattern of Arabidopsis shoot vascular bundles. Proc. Natl. Acad. Sci. USA. 2009;106:13630–13635. doi: 10.1073/pnas.0906416106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Jang J.C., Fujioka S., Tasaka M., Seto H., Takatsuto S., Ishii A., Aida M., Yoshida S., Sheen J. A critical role of sterols in embryonic patterning and meristem programming revealed by the fackel mutants of Arabidopsis thaliana. Genes Dev. 2000;14:1485–1497. [PMC free article] [PubMed] [Google Scholar]
  18. Keinath N.F., Kierszniowska S., Lorek J., Bourdais G., Kessler S.A., Shimosato-Asano H., Grossniklaus U., Schulze W.X., Robatzek S., Panstruga R. PAMP (pathogen-associated molecular pattern)-induced changes in plasma membrane compartmentalization reveal novel components of plant immunity. J. Biol. Chem. 2010;285:39140–39149. doi: 10.1074/jbc.M110.160531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kim H.B., Kwon M., Ryu H., Fujioka S., Takatsuto S., Yoshida S., An C.S., Lee I., Hwang I., Choe S. The regulation of DWARF4 expression is likely a critical mechanism in maintaining the homeostasis of bioactive brassinosteroids in Arabidopsis. Plant Physiol. 2006;140:548–557. doi: 10.1104/pp.105.067918. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kim B.K., Fujioka S., Takatsuto S., Tsujimoto M., Choe S. Castasterone is a likely end product of brassinosteroid biosynthetic pathway in rice. Biochem. Biophys. Res. Commun. 2008;374:614–619. doi: 10.1016/j.bbrc.2008.07.073. [DOI] [PubMed] [Google Scholar]
  21. Kim H.B., Lee H., Oh C.J., Lee H.Y., Eum H.L., Kim H.S., Hong Y.P., Lee Y., Choe S., An C.S., et al. Postembryonic seedling lethality in the sterol-deficient Arabidopsis cyp51A2 mutant is partially mediated by the composite action of ethylene and reactive oxygen species. Plant Physiol. 2010;152:192–205. doi: 10.1104/pp.109.149088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kim W., Ahn H.J., Chiou T.J., Ahn J.H. The role of the miR399-PHO2 module in the regulation of flowering time in response to different ambient temperatures in Arabidopsis thaliana. Mol. Cells. 2011;32:83–88. doi: 10.1007/s10059-011-1043-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Krishna P. Brassinosteroid-mediated stress responses. J. Plant Growth Regul. 2003;22:289–297. doi: 10.1007/s00344-003-0058-z. [DOI] [PubMed] [Google Scholar]
  24. Kwon M., Choe S. Brassinosteroid biosynthesis and dwarf mutants. J. Plant Biol. 2005;48:1–15. [Google Scholar]
  25. Li J., Nagpal P., Vitart V., McMorris T.C., Chory J. A role for brassinosteroids in light-dependent development of Arabidopsis. Science. 1996;272:398–401. doi: 10.1126/science.272.5260.398. [DOI] [PubMed] [Google Scholar]
  26. Maharjan P.M., Choe S. High temperature stimulates DWARF4 (DWF4) expression to increase hypocotyl elongation in Arabidopsis. J. Plant Biol. 2011;54:425–429. [Google Scholar]
  27. Maharjan P.M., Schulz B., Choe S. BIN2/DWF12 antagonistically transduces brassinosteroid and auxin signals in the roots of Arabidopsis. J. Plant Biol. 2011;54:126–134. [Google Scholar]
  28. Men S., Boutte Y., Ikeda Y., Li X., Palme K., Stierhof Y.D., Hartmann M.A., Moritz T., Grebe M. Sterol-dependent endocytosis mediates post-cytokinetic acquisition of PIN2 auxin efflux carrier polarity. Nat. Cell Biol. 2008;10:237–244. doi: 10.1038/ncb1686. [DOI] [PubMed] [Google Scholar]
  29. Rahier A., Darnet S., Bouvier F., Camara B., Bard M. Molecular and enzymatic characterizations of novel bifunctional 3beta-hydroxysteroid dehydrogenases/C-4 decarboxylases from Arabidopsis thaliana. J. Biol. Chem. 2006;281:27264–27277. doi: 10.1074/jbc.M604431200. [DOI] [PubMed] [Google Scholar]
  30. Rahier A., Bergdoll M., Genot G., Bouvier F., Camara B. Homology modeling and site-directed mutagenesis reveal catalytic key amino acids of 3beta-hydroxysteroid-dehydrogenase/C4-decarboxylase from Arabidopsis. Plant Physiol. 2009;149:1872–1886. doi: 10.1104/pp.108.132282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Schrick K., Mayer U., Horrichs A., Kuhnt C., Bellini C., Dangl J., Schmidt J., Jurgens G. FACKEL is a sterol C-14 reductase required for organized cell division and expansion in Arabidopsis embryogenesis. Genes Dev. 2000;14:1471–1484. [PMC free article] [PubMed] [Google Scholar]
  32. Simon-Plas F., Perraki A., Bayer E., Gerbeau-Pissot P., Mongrand S. An update on plant membrane rafts. Curr. Opin. Plant Biol. 2011;4:642–649. doi: 10.1016/j.pbi.2011.08.003. [DOI] [PubMed] [Google Scholar]
  33. Souter M., Topping J., Pullen M., Friml J., Palme K., Hackett R., Grierson D., Lindsey K. hydra Mutants of Arabidopsis are defective in sterol profiles and auxin and ethylene signaling. Plant Cell. 2002;14:1017–1031. doi: 10.1105/tpc.001248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Szekeres M., Nemeth K., Koncz-Kalman Z., Mathur J., Kauschmann A., Altmann T., Redei G.P., Nagy F., Schell J., Koncz C. Brassinosteroids rescue the deficiency of CYP90, a cytochrome P450, controlling cell elongation and de-etiolation in Arabidopsis. Cell. 1996;85:171–182. doi: 10.1016/s0092-8674(00)81094-6. [DOI] [PubMed] [Google Scholar]
  35. Titapiwatanakun B., Murphy A.S. Post-transcriptional regulation of auxin transport proteins: cellular trafficking, protein phosphorylation, protein maturation, ubiquitination, and membrane composition. J. Exp. Bot. 2009;60:1093–1107. doi: 10.1093/jxb/ern240. [DOI] [PubMed] [Google Scholar]
  36. Titapiwatanakun B., Blakeslee J.J., Bandyopadhyay A., Yang H., Mravec J., Sauer M., Cheng Y., Adamec J., Nagashima A., Geisler M., et al. ABCB19/PGP19 stabilises PIN1 in membrane microdomains in Arabidopsis. Plant J. 2009;57:27–44. doi: 10.1111/j.1365-313X.2008.03668.x. [DOI] [PubMed] [Google Scholar]
  37. Willemsen V., Friml J., Grebe M., van den Toorn A., Palme K., Scheres B. Cell polarity and PIN protein positioning in Arabidopsis require STEROL METHYLTRANSFERASE1 function. Plant Cell. 2003;15:612–625. doi: 10.1105/tpc.008433. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Molecules and Cells are provided here courtesy of Korean Society for Molecular and Cellular Biology

RESOURCES