Synergistic Activation of Steroidogenic Acute Regulatory Protein Expression and Steroid Biosynthesis by Retinoids: Involvement of cAMP/PKA Signaling

Abstract

Both retinoic acid receptors (RARs) and retinoid X receptors (RXRs) mediate the action of retinoids that play important roles in reproductive development and function, as well as steroidogenesis. Regulation of steroid biosynthesis is principally mediated by the steroidogenic acute regulatory protein (StAR); however, the modes of action of retinoids in the regulation of steroidogenesis remain obscure. In this study we demonstrate that all-trans retinoic acid (atRA) enhances StAR expression, but not its phosphorylation (P-StAR), and progesterone production in MA-10 mouse Leydig cells. Activation of the protein kinase A (PKA) cascade, by dibutyrl-cAMP or type I/II PKA analogs, markedly increased retinoid-responsive StAR, P-StAR, and steroid levels. Targeted silencing of endogenous RARα and RXRα, with small interfering RNAs, resulted in decreases in 9-cis RA-stimulated StAR and progesterone levels. Truncation of and mutational alterations in the 5′-flanking region of the StAR gene demonstrated the importance of the −254/−1-bp region in retinoid responsiveness. An oligonucleotide probe encompassing an RXR/liver X receptor recognition motif, located within the −254/−1-bp region, specifically bound MA-10 nuclear proteins and in vitro transcribed/translated RXRα and RARα in EMSAs. Transcription of the StAR gene in response to atRA and dibutyrl-cAMP was influenced by several factors, its up-regulation being dependent on phosphorylation of cAMP response-element binding protein (CREB). Chromatin immunoprecipitation studies revealed the association of phosphorylation of CREB, CREB binding protein, RXRα, and RARα to the StAR promoter. Further studies elucidated that hormone-sensitive lipase plays an important role in atRA-mediated regulation of the steroidogenic response that involves liver X receptor signaling. These findings delineate the molecular events by which retinoids influence cAMP/PKA signaling and provide additional and novel insight into the regulation of StAR expression and steroidogenesis in mouse Leydig cells.

Retinoids (vitamin A and its derivatives), especially all-trans retinoic acid (atRA; the most notable retinoid) and 9-cis RA, have been shown to play unique modulatory and integrative roles across multiple metabolic and physiological processes (1, 2). Retinoids are small, lipophilic, hormone-like molecules that predominantly act through 2 families of ligand-activated nuclear receptors, the retinoic acid receptors (RARs) and retinoid X receptors (RXRs), each of which have 3 subtypes (α, β, and γ), with additional isoforms resulting from alternative splicing (3–5). Whereas RARs are activated by both atRA and 9-cis RA, RXRs are activated exclusively by 9-cis RA. These receptors form either hetero- or homodimers and bind to a retinoid response element, termed the RARE/RXRE (RAR response element/RXR response element), which is composed of a direct repeat of 2 hexameric half-sites with the consensus sequences 5′-PuG(G/T)TCA-3′, their inverted or everted forms, present in the regulatory region of target genes (5, 6). The binding of dimers to RARE/RXRE mediates conformational alterations, leading to recruitment of coactivator complexes in modulating their regulatory action. Both RARs and RXRs interact with intracellular mediators of multiple signaling pathways and result in a large array of combinatorial actions that underlie the pleiotropic effects of retinoids (6–8). Studies have reported that RAR-RXR heterodimers are the functional units that transduce the retinoid signal both in vivo and in vitro (3–5). Northern and immunohistochemical analyses have previously detected all 3 RAR and RXR subtypes in rodent testis/Leydig cells (1, 2). Mice lacking RARα, RARγ, and RXRβ display male sterility (2, 8, 9), underscoring the importance of retinoid signaling in testicular function as well as in steroidogenesis. Of note, RXRα is the functionally predominant subtype in vivo, and RXRα-null mice exhibit embryonic lethality (8, 10). However, the mechanisms of action of retinoids in the regulation of steroidogenic acute regulatory (StAR) protein and, thus, steroid biosynthesis, remain to be elucidated.

The StAR protein mediates the rate-limiting and regulated step in steroid biosynthesis, ie, the transport of cholesterol, the substrate for all steroid hormones, from the outer to the inner mitochondrial membrane, in steroidogenic tissues (11–14). At the inner membrane, cytochrome P450scc (CYP11A1) cleaves the cholesterol side chain to form the first steroid, pregnenolone, which is further converted by a series of enzymes to various steroid hormones in specific tissues. Both basic and clinical studies have furnished compelling evidence concerning the crucial role of StAR in regulating steroidogenesis, and striking correlations between the synthesis of StAR protein and the synthesis of steroids have been demonstrated (reviewed in References 13 and 15). Regulation of StAR protein is influenced by protein kinase A (PKA), protein kinase C, and a host of other signaling pathways and involves transcriptional and translational modifications (12, 13, 16). Alternatively, 10%-15% of steroid biosynthesis appears to be mediated through StAR-independent mechanisms. In the mouse StAR protein, two putative phosphorylation sites at Ser56 and Ser194 have been identified, and mutations of these sites (Ser → Ala) demonstrated the predominant importance of the latter in the biological activity of StAR in steroid synthesis (17–19).

Transcriptional regulation of the StAR gene, through cAMP signaling, involves the concerted action of multiple proteins that bind directly or indirectly to sequence-specific DNA-regulatory elements located approximately 250 bp upstream of the transcription start site (13, 20–22). One of the well-known downstream targets of cAMP/PKA and other kinases (affected by a plethora of extracellular stimuli, ie, hormones, growth factors, cytokines, and stress signals) is the activation of CREB, and this event is instrumental in the transcriptional regulation of a number of genes, including StAR (18, 23, 24). Phosphorylation of CREB at Ser133 recruits CREB-binding protein (CBP) and/or its functional homolog, p300, which act as bridging proteins between the sequence-specific transcription factors and the general transcriptional machinery, favoring chromatin remodeling and thus influencing gene regulation (21, 24–26). Despite prior findings that retinoids can enhance StAR and/or steroid production (27–29), no consensus RARE/RXRE sequence has been identified in the 5′-flanking region of the StAR promoter, suggesting retinoid-regulated StAR gene transcription involves an alternative mechanism. Studies have reported that the retinoid response with the liver X receptor (LXR) element is the result of a unique interaction between LXR and RXR (30, 31). As such, an LXR-RXR heterodimer has been shown to bind the StAR promoter and activate its transcription (32, 33). We have recently demonstrated the functional cooperation between LXR and RXR signaling in hormone-sensitive lipase (HSL)-mediated regulation of StAR expression and steroid biosynthesis (19). Moreover, regulation of HSL-dependent steroidogenesis is linked with the LXR target genes, sterol receptor element-binding protein 1c (SREBP-1c) and ATP-binding cassette transporter A1 (ABCA1). Notably, SREBP-1c gene expression has been shown to be induced by retinoids in a number of cellular models (34, 35). HSL is a multifunctional lipase that catalyzes the hydrolysis of both cholesteryl and retinyl esters (36, 37) and thus facilitates cholesterol accessibility for steroidogenesis. In light of these observations, the present investigation was designed to uncover the regulatory events by which retinoid signaling mediates StAR expression and steroid biosynthesis utilizing MA-10 mouse Leydig cells.

Materials and Methods

Reagents

Dibutyryl-cAMP (Bu)₂cAMP), atRA, 9-cis RA, TTNPB, SR11233, T0901317, and H-89 were purchased from Sigma-Aldrich. CAY10499 was purchased from Cayman Chemical Co. 8-(6-Aminohexyl)amino-cAMP (AHA-cAMP), 8-piperidino-cAMP (PIP-cAMP), and N6-mono-tert-butylcarbamoyl-cAMP (MBC-cAMP) were obtained from Biologs. Trizol, PCR primers, and OPTI-MEM were obtained from Invitrogen Life Technologies. DNAs, random hexamers, and Taqman Mastermix were obtained from Applied Biosystems. Avian Myeloblastosis Virus-reverse transcriptase, RNAsin, and other enzymes were from Promega Corp. The antibodies for StAR (38) and phospho-StAR (18) have been described elsewhere. Other primary antibodies were obtained from the following sources: RARα, RXRα, CREB, phosphorylation of CREB (P-CREB) (Ser133), HSL, phosphorylation of HSL (P-HSL) (Ser660) (Cell Signaling Technology), CBP (Santa Cruz Biotechnology), CYP11A1 (Chemicon International Inc), and β-actin (Applied Biosystems/Ambion).

Plasmids, transfections, and luciferase assays

Various truncations in the 5′-flanking region of the mouse StAR promoter (−966, −426, −254, −151, and −68 bp) were synthesized using a PCR-based cloning strategy and inserted into the XhoI and HindIII sites of the pGL3 basic vector (Promega) (39–41). Deletion constructs generated were in relation to the translation initiation codon (−1 bp). Mutational analyses were carried out using the −254/−1-bp StAR luciferase segment. Plasmids containing mutations in the LXR/RXR (−200/−185 bp), Sp1 (−146/−137 bp), CCAAT enhancer-binding protein (C/EBP) (−117/−108 bp), steroidogenic factor-1 (SF-1/3) (−102/−96 bp), cAMP response element (CRE)2/activator protein 1 (AP-1) (−81/−75 bp), GATA (−66/−61 bp), and SREBP (−60/−52 bp) sites (sequences corresponding to mouse StAR promoter) were generated using the Quikchange Site Directed Mutagenesis kit (Stratagene) (24, 39, 42). The sense strand of the oligonucleotide sequence used in mutating the LXR/RXR recognition motif was 5′-CCGTGAattCTGCTTgatCTATATG-3′ (mutated bases in boldface letters), and the mutation was verified by EcoRI and Sau3A1. The pRL-simian virus 40 (SV40) plasmid containing the Renilla luciferase gene driven by the SV40 promoter was obtained from Promega. Expression plasmids for RXRα, RARα, HSL, and SREBP-1c have been previously described (3, 19, 43). All plasmids were confirmed by either endonuclease digestion or sequencing on a PE Biosystems 310 Genetic Analyzer (PerkinElmer) at the Texas Tech University Biotechnology Core Facility.

MA-10 mouse Leydig tumor cells (44) were cultured in HEPES-buffered Weymouth MB/752 (Sigma-Aldrich) medium supplemented with 15% horse serum containing antibiotics (19, 45). For transfection studies, cells were cultured in either 6- or 12-well plates to 65%–75% confluency and were transfected using Lipofectamine 2000 (Invitrogen) transfection reagent (26, 46). Transfection efficiency was normalized by cotransfecting 10–20 ng pRL-SV40 vector. The amount of DNA used in transfections was equalized with an empty expression vector.

Luciferase activity in the cell lysates was determined by the dual-luciferase reporter assay system (Promega) (24, 45). Briefly, cells were washed with 0.01 M PBS and 300 μL of the reporter lysis buffer was added to the cells. Cellular debris was pelleted by centrifugation at 12,000 × g for 10 minutes at 4°C, and the supernatant was measured for relative light units (luciferase/Renilla) using a TD 20/20 Luminometer (Turner Designs).

Silencing of RARα and RXRα

Knockdown studies associated with RARα, RXRα, and HSL were performed with small interfering RNAs (siRNAs) using Lipofectamine 2000 transfection reagent (Invitrogen) under optimized conditions (19, 41, 46). Briefly, silencer negative control, RARα (5′-CCAACACGACGCAGGAAAU-3′), RXRα (5′-CCAACACGACGCAGGAAAU-3′), and HSL (5′-CCAACACGACGCAGGAAAU-3′) siRNAs were obtained as annealed oligos from Ambion. MA-10 cells were transfected with different siRNAs at 100 nM. Following 48 hours of transfection, cells were used in treatments.

Immunoblotting

Immunoblotting studies were carried out using total cellular protein (19, 26, 41). In brief, cells were homogenized in lysis buffer, and equal amounts of protein were solubilized in sample buffer and loaded onto 10%–12% SDS-PAGE (Bio-Rad Laboratories, Inc). The proteins were electrophoretically transferred onto Immuno-Blot PVDF membranes (Bio-Rad). The membranes were probed with specific antibodies that recognize RARα, RXRα, P-HSL (Ser600), HSL, StAR, P-StAR (Ser194), CYP11A1, 3β-hydroxy steroid dehydrogenase (HSD), and β-actin. Following overnight incubation with primary antibodies at 4°C, the membranes were washed and incubated with appropriate horseradish peroxidase-conjugated secondary antibodies for 1 hour at room temperature. Upon washing, the immunodetection of specific proteins was determined with the Chemiluminescence Imaging Western Lightning Kit (PerkinElmer). The intensity of immunospecific bands was quantified using a computer-assisted image analyzer (Quantity One Software, Bio-Rad Laboratories).

Quantitative real-time PCR and RT-PCR

Total RNA was extracted using Trizol reagent (GIBCO-BRL). Semiquantitative real-time PCR was used for determining StAR and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNAs using an ABI 7000 (Applied Biosystems) (19, 46). The following oligonucleotides were used as primers and probes: StAR (forward), 5′-CCGGGTGGATGGGTCAA-3; StAR (reverse), 5′-CACCTCTCCCTGCTGGATGTA-3′; StAR (Taqman), 5′-CGACGTCGGAGCTCTCTGCTTGG-3′; and GAPDH (forward), 5′-GCAGTGGCAAAGTGGAGATTG-3′; GAPDH (reverse), 5′-GTGAGTGGAGTCATACTGGAACATG-3′; and GAPDH (Taqman), 5′-TCAACGACCCCTTCATTGACCTC-3′. Quantitative PCR data were normalized against GAPDH and evaluated using the comparative Ct method (19, 46).

A quantitative RT-PCR procedure was employed for amplifying mouse StAR, RARs, RXRs, and L19 cDNAs, under optimized conditions (18, 26, 47). Reverse transcription (RT) and PCR were run sequentially in the same assay, which included [α³²P]-dCTP (PerkinElmer) in the deoxynucleotide triphosphate mixture. The primer pairs utilized were: StAR (forward), 5′-GACCTTGAAAGGCTCAGGAAGAAC-3′; StAR (reverse), 5′-TAGCTGAAGATGGACAGACTTGC-3′; RARα (forward), 5′-AACTACCTGCCAGATGTTTGCCTG-3′; RARα (reverse), 5′-CGTAGTGTACTTGCCCAGCTGGC-3′; RARβ (forward), 5′-CCTAGAGGATAAGCACTTTTGC-3′, RARβ (reverse), 5′-TATCCAAGCAGGCGGCTTTGAGC-3′; RARγ (forward), 5′-CCTGCTGCAGAGTCCAAGGGATTC-3′, RARγ (reverse), 5′-CAGATCCGCAGCATTAGGATGTC-3′; RXRα (forward), 5′-GCGCTGCCGCCCTGCTGCTCCG-3′; RXRα (reverse), 5′-ACAGGGTCATTTGGTGAGCTGGC-3′; RXRβ (forward), 5′-AGCGCGGCTCTTGAGTCGCGCTGCCACAG-3′; RXRβ (reverse), 5′-GCGACAGTACTGACAGCGATTCC-3′; RXRγ (forward), 5′-CACTGAAGCATGCTCTTGTCGTG-3′; RXRγ (reverse), 5′-CATCTGGGTTAAACAGCACGATGGC-3′; L19 (forward), 5′-GAAATCGCCAATGCCAACTC-3′; and L19 (reverse), 5′-TCTTAGACCTGCGAGCCTCA-3′. RT-PCR products amplified for RARs and RXRs were: RARα (678 bp), RARβ (721 bp), RARγ (766 bp), RXRα (859 bp), RXRβ (881 bp), and RXRγ (870 bp), respectively. The molecular sizes of StAR, RAR, and RXR subtypes, and L19 cDNAs were determined on 1.2% agarose gels, and their levels were quantified using an image analyzer (Quantity One Software). All PCR products were verified by sequencing.

Chromatin immunoprecipitation (ChIP) assay

ChIP assays were carried out using a kit (Upstate/Chemicon) following the manufacturer's instructions, as described previously (24, 26, 45). Briefly, cells were incubated with formaldehyde (1%) for 10 minutes at 37°C to cross-link DNA and its associated proteins. Cells were washed, scraped, collected, and resuspended in lysis buffer and then sonicated for 7–9 cycles of 10-second pulses using a Tekmar Sonic Disruptor (Fisher Scientific). The supernatant containing chromatin was cleared with a protein A agarose/salmon sperm DNA 50% slurry for 30 minutes at 4°C with agitation. After centrifugation, the supernatant was immunoprecipitated with 4 μg of antibodies specific to P-CREB, CBP, RARα, and RXRα for 16 hours at 4°C, followed by incubation with Protein A agarose/salmon sperm for an additional 1 hour. After washing, protein-DNA complexes were eluted with freshly made elution buffer (1% sodium dodecyl sulfate, 0.1 M NaHCO₃). NaCl (5 M) was added to the eluate that was then incubated at 65°C for 4 hours to reverse the formaldehyde cross-linking. The resulting samples were treated with 0.5 M EDTA, 1 M Tris-HCl, pH 6.5, and 10 mg/mL proteinase K (10 mg/mL) for 1 hour at 45°C, and the purified DNA samples were used for PCR using [α³²P]-dCTP in the deoxynucleotide triphosphate mixture. PCR was performed with approximately 100 ng of DNA and the mouse StAR promoter proximal (forward, 5′-GTCTACTTTAGAGAAGCTAT-3′ (bases −255/−227), and reverse, 5′-GAAGGCTGTGCATCATCACTTGAG-3′ (bases −62/−39) or distal (forward, 5′-CAGAGTTTCTGAAGACACATCTCAG-3′ (bases −3522/−3504), and reverse, 5′-GGCCACTTTAAATGTAAGACC-3′ (bases −3326/−3304) primers, respectively (26, 48). PCR products were determined on 2% agarose gels, which were vacuum dried, exposed to X-ray film (Phoenix Research Products) for 1–3 hours, and the resulting signals were visualized.

Preparation of RARα and RXRα proteins

RARα and RXRα proteins were prepared by in vitro transcription and translation using the TNT Coupled Reticulocyte Lysate System (Promega), according to the manufacturer's instructions, under optimized conditions (24). In vitro transcribed/translated RARα and RXRα proteins were analyzed by 10% SDS-PAGE, transferred to nitrocellulose membranes, and their identities were confirmed with specific antibodies and used in gel retardation assays.

EMSAs

EMSA experiments were performed using nuclear extracts (NEs) and in vitro transcribed/translated RARα and RXRα proteins (24, 40, 41). The sense strands of the oligonucleotide sequences used were: LXR/RXR (−200/−185 bp), 5′-GGTGACCCCTGCTTTCCC-3′; LXR/RXR (−200/−185 bp) mutant (LXR/RXRMut), 5′-GGTGAattCTGCTTgatC-3′; RARE-DR5, GGAGGGTTCACCGAAAGTTCACTCGCA (49); Sp1 (−153/−136 bp), 5′-GGCAGTCTGCTCCCTCCCAC-3′; C/EBP (−121/−102 bp), 5′-GGCAGGATGAGGCAATCATTCC-3′; SF-1/3 (−106/−92 bp), 5′-GGATTCCATCCTTGACC-3′; CRE2/AP-1 (−83/−67 bp), 5′-GGAATGACTGAAGTATTTT-3′; GATA (−71/−52 bp),5′-GGA CTTTTTTATCTCAAGTGAT-3′; and SREBP (−63/−46), 5′-GGTCTCAAGTGATGATGCAC-3′.

The 5′-GG overhangs in the doubled-stranded oligonucleotides were end-labeled with [α³²P]-dCTP (PerkinElmer) using Klenow (Promega) fill-in reaction, and protein-DNA binding assays were carried out (24, 40). Briefly, NE (10–15 μg) or in vitro transcribed/translated RARα or RXRα (2 μg) was incubated for 15 minutes at room temperature in a 20 μL reaction buffer (25 mM Tris-HCl, 1 mM EDTA, 4% Ficoll, 10 mM dithiothreitol, 2 μg polydeoxyinosinic deoxycytidylic acid, 40 ng/μL BSA, and 12 mM MgCl₂, pH 7.9) before the addition of a ³²P-labeled probe either alone or in the presence of unlabeled oligonucleotides. When antibodies were used, the reactions were carried out for an additional 45 minutes on ice. Reactions were then subjected to electrophoresis on 5% PAGE gels in 0.5 ×Tris-borate-EDTA buffer (90 mM Tris-borate, 2 mM EDTA, pH 8.3). The gels were dried, exposed to X-ray film (Phoenix Research Products), and bands representing protein-DNA complexes were analyzed.

Statistical analysis

All experiments were repeated 3–6 times. Statistical analysis was performed by ANOVA using Statview (Abacus Concepts, Inc.) followed by Fisher's protected least significant differences test. Data presented are the mean ± SE, and P < .05 was considered statistically significant.

Results

Assessment of retinoid signaling in the regulation of StAR expression and steroidogenesis

The molecular events involved in retinoid-mediated regulation of StAR expression and steroid biosynthesis were explored. MA-10 cells treated with atRA (0–30 μM) for 6 hours demonstrated dose-dependent increases in StAR mRNA (Figure 1A), StAR protein (Figure 1B), and progesterone synthesis (Figure 1C). The optimal responses observed at 10 μM atRA were 4.3 ± 0.6 (StAR mRNA), 3.5 ± 0.4 (StAR protein), and 11 ± 3 (progesterone) fold, over their respective basal values. The expression of CYP11A1 and 3β-HSD proteins was unaltered. The induction of StAR protein and progesterone levels by atRA reached a maximum by 6–8 hours and decreased thereafter with time, but remained elevated over basal levels at 24 hours (data not shown). Both dose- and time-dependent responses of StAR expression to atRA directly correlated with those of progesterone levels.

Figure 1.

Effect of atRA on StAR mRNA, StAR protein, CYP11A1, 3β-HSD, and progesterone synthesis. MA-10 cells were treated with increasing doses of atRA (0–30 μM) for 6 hours (A–C). Following treatment, cells were processed for either total RNA extraction or cellular protein preparation. A, mRNA levels of StAR were determined by a quantitative RT-PCR analysis. A representative autoradiogram illustrates expression of StAR mRNA in different groups using 1 μg of total RNA. Integrated optical density (IOD) value of each StAR band was quantified and normalized with the corresponding L19 bands and presented below the autoradiogram (A). Representative immunoblots illustrate expression of StAR, CYP11A1, and 3β-HSD using 20–30 μg of total protein (B). β-Actin expression was assessed as a loading control. Autoradiogram and immunoblots shown are representative of 4–6 independent experiments. IOD values of StAR, CYP11A1, and 3β-HSD in each band were quantified, and compiled data from 4 independent experiments are presented (C). Accumulation of progesterone in the media was determined from different treatment groups and expressed as nanograms/mg protein (C), which represent the mean ± SE of 5 independent experiments. *, P < .05; **, P < .01; ***, P < .001 vs control.

Whereas atRA (10 μM) increased (P < .01) StAR protein and progesterone levels, P-StAR at Ser194 was undetectable in control and atRA-treated cells (Figure 2). Additional experiments were performed using atRA and a suboptimal dose of (Bu)₂cAMP (0.1 mM). In dose-response studies in MA-10 cells, 0.1 mM (Bu)₂cAMP produces 5%–10% of maximal StAR expression and progesterone production whereas 1.0 mM produces 100% stimulation of these parameters. Addition of 0.1 mM (Bu)₂cAMP, to the atRA incubation, synergistically enhanced StAR (8.7 ± 0.9-fold over basal), P-StAR (4.1 ± 0.5-fold), and progesterone (354 ± 27-fold over basal) levels. The magnitude of induction mediated by atRA and (Bu)₂cAMP (0.1 mM) is similar to that achieved with a maximally stimulating dose of (Bu)₂cAMP (1.0 mM) (Figure 2A). Inhibition of PKA activity by H-89 (20 μM; References 18, 19, 45) decreased (P < .001) atRA and atRA plus (Bu)₂cAMP stimulated steroidogenic responsiveness. Furthermore, MA-10 cells treated individually with type I (25 μM AHA-cAMP + 100 μM PIP-cAMP) and type II (25 μM MBC-cAMP + 100 μM PIP-cAMP) PKA analog pairs (50), elevated (P < .05) StAR protein and progesterone production, over their respective basal values (Figure 2B). Coincubation of atRA with either type I or type II PKA pairs, markedly increased StAR, P-StAR, and progesterone levels. These results confirm the involvement of cAMP/PKA signaling in the synergistic activation of atRA-responsive StAR expression and steroid biosynthesis.

Figure 2.

Role of atRA in cAMP/PKA-stimulated StAR, P-StAR, and progesterone synthesis. MA-10 cells were pretreated without or with a PKA inhibitor H-89 (20 μM) for 45 minutes and then incubated with atRA (10 μM) in the absence or presence of (Bu)₂cAMP (0.1 or 1.0 mM) for an additional 6 hours, as indicated (A). Treatment with atRA was also carried out in the presence of PIP-cAMP (100 μM) along with either AHA-cAMP (25 μM), to activate type I PKA, or MBC-cAMP (25 μM), to activate type II PKA (B). Representative immunoblots (n = 3–5) show StAR and P-StAR levels in different groups using 25–30 μg of total cellular protein. β-Actin expression was assessed as loading control. Accumulation of progesterone in the media from different treatment groups was determined and expressed as nanograms/mg protein (A and B; bottom panels). Results represent the mean ± SE of 4 independent experiments. Different letters above the bars indicate that these groups differ significantly from each other at least at P < .05.

RT-PCR analysis revealed that MA-10 cells express all 3 RAR and RXR mRNA subtypes in various amounts (Figure 3). Expression of the RARα, RXRα, and RXRβ mRNAs was found to be higher than that of RARβ, RARγ and RXRγ subtypes under basal conditions. Among these subtypes, the relevance of retinoid-induced StAR expression and steroid synthesis was further gauged with siRNAs specific to mouse RARα and RXRα to diminish their endogenous expression. Transfection of MA-10 cells with 100 nM of either RARα (Figure 3B) or RXRα (Figure 3C) siRNA demonstrated an approximately 70% decrease in endogenous target receptor levels when compared with negative control siRNA (scrambled). Knockdown of these retinoid receptors did not alter the expression of CYP11A1 protein, indicating the specificity of RARα and RXRα silencing. In scrambled siRNA-treated cells, 9-cis RA (10 μM) moderately, but consistently, increased (P < .05) both RARα and RXRα protein levels and resulted in 3.1 ± 0.3 and 9 ± 2-fold increases in StAR protein and progesterone synthesis over their respective basal values (Figure 3, B–D). Depletion of RARα and RXRα affected basal and 9-cis RA-induced StAR and progesterone levels between 41 and 53%, suggesting the importance of these subtypes in regulating the steroidogenic response in MA-10 mouse Leydig cells.

Figure 3.

Expression of RAR and RXR subtypes, and knockdown of RARα and RXRα in MA-10 cells and their relevance to 9-cis RA-induced StAR, CYP11A1, and progesterone levels. Levels of RARα, RARβ, RARγ, RXRα, RXRβ, and RXRγ mRNAs (in duplicate) were determined by using a quantitative RT-PCR analysis. Representative autoradiograms illustrate expression of RAR and RXR mRNAs using 1 μg of total RNA (A). Cells were transfected with 100 nM of a negative control (scrambled), RARα (B), and RXRα (C) siRNAs. Following 48 hours of transfection, cells were treated without or with 9-cis RA (10 μM) for an additional 6 hours, and cells were then subjected to cellular protein preparation. β-Actin expression was assessed as loading control. Representative immunoblots illustrate expression of RARα, RXRα, StAR, and CYP11A1 in different treatment groups using 20–30 μg of total cellular protein (B and C). Immunoblots are representative of 3–5 independent experiments. Accumulation of progesterone in the media was determined (n = 5, ± SE) and expressed as nanograms/mg protein (D). Different letters above the bars indicate that these groups differ significantly from each other at least at P < .05.

Cooperation of RARs and RXRs in StAR expression and steroid biosynthesis

The functional cooperation of RARs and RXRs in stimulating StAR expression and steroidogenesis was studied next. As determined by real-time PCR, MA-10 cells treated with atRA and 9-cis RA for 6 hours demonstrated 4.7 ± 0.5 and 3.6 ± 0.4-fold increases in StAR mRNA levels over untreated cells, respectively (Figure 4A). Coincubation of atRA and 9-cis RA additively enhanced (8.8 ± 1.1-fold) StAR mRNA expression. (Bu)₂cAMP (0.1 mM) resulted in an approximately 2-fold increase in StAR mRNA expression over basal. Addition of (Bu)₂cAMP to either atRA, 9-cis RA, or atRA plus 9-cis RA strongly increased StAR mRNA levels, suggesting that RARs and RXRs cooperate in influencing steroidogenesis. To better understand these events, cells were treated with selective analogs with affinities to both RAR (TTNPB) and RXR (SR11233). As illustrated in Figure 4B, treatment with TTNPB (1 μM) or SR11233 (1 μM) for 6 hours increased (P < .05) StAR protein, but not P-StAR, and progesterone synthesis over untreated cells. These agonists resulted in 2- to 4-fold and 7- to 11-fold increases in StAR protein and progesterone production over basal levels, respectively. Both TTNPB and SR11233 each synergistically elevated (Bu)₂cAMP-stimulated StAR, P-StAR, and progesterone levels. To gain more insight into these mechanisms, MA-10 cells were transfected with pCMX-RARα, pCMX-RXRα, and pCMX-RARα plus pCMX-RXRα expression plasmids and the −254/−1 StAR luciferase segment, which includes the retinoid-responsive elements (shown below), in the presence of pRL-SV40 vector (Figure 4C). Cells treated with either 9-cis RA or (Bu)₂cAMP significantly increased (P < .05) StAR promoter-driven luciferase activity in mock-transfected (pCMX) cells. Overexpression of either pCMX-RARα or pCMX-RXRα slightly augmented basal but elevated 9-cis RA-treated StAR reporter activity approximately 2 fold, over the responses seen with mock controls. Cells overexpressing pCMX-RARα and pCMX-RXRα together further increased (P < .01) 9-cis RA-treated StAR promoter responsiveness. Coincubation of 9-cis RA and (Bu)₂cAMP markedly enhanced StAR reporter responsiveness in all of these groups (Figure 4C), demonstrating the importance of cAMP/PKA in retinoid-mediated steroidogenesis. These data indicate that both RARs and RXRs act functionally to up-regulate StAR expression and steroid biosynthesis by activating transcription of the StAR gene.

Figure 4.

Cooperation of RAR and RXR on StAR mRNA, StAR protein, StAR promoter activity, P-StAR, and progesterone synthesis in MA-10 cells. Cells were treated without or with atRA (10 μM), 9-cis RA (10 μM), or a combination of them, in the absence or presence of (Bu)₂cAMP (0.1 mM) for 6 hours, as indicated (A). Cells were also treated with TTPNB (1 μM), SR11233 (1 μM), (Bu)₂cAMP (0.1 mM), or their combination (B). Following treatments, cells were processed for either total RNA extraction (A) or total cellular protein preparation (B). A, StAR mRNA levels were determined by real-time PCR and reported (n = 4) as fold changes over basal. B, Representative immunoblots show StAR and P-StAR levels in different groups using 20–30 μg of total protein. β-Actin expression was assessed as a loading control. Similar results were obtained from 3–5 independent experiments. Accumulation of progesterone in the media of different treatment groups was determined and expressed as nanograms/mg protein (B, bottom panel), which represent the mean ± SE of 5 independent experiments. C, MA-10 cells were transfected with pCMX, pCMX-RARα, pCMX-RXRα, and pCMX-RARα plus pCMX-RXRα (2.0 μg), within the context of the −254/−1-bp StAR reporter segment (1.0 μg), in the presence of pRL-SV40. Following 36 hours of transfection, cells were treated without (Basal) or with 9-cis RA (10 μM), (Bu)₂cAMP (0.1 mM), and a combination of them, for an additional 6 hours (C). Luciferase activity in the cell lysates was determined and expressed (n = 3) as StAR promoter activity RLU (luciferase/Renilla).

Assessment of retinoid-response elements in the 5′-flanking region of the StAR gene

To identify retinoid-responsive elements, various StAR promoter luciferase segments (−966 bp, −426 bp, −254 bp, −151 bp, and −68 bp) were studied utilizing MA-10 cells (Figure 5A). The proximal approximately 1.0-kb StAR promoter provides a comparable response to that of the full-length promoter (∼3.5 kb) to cAMP signaling (22, 39). Cells transfected with the −966-bp StAR segment demonstrated a 2.9 ± 0.3-fold increase in reporter activity in response to atRA. Deletion of the −966 to −426 bp moderately reduced (10%–15%) basal and atRA-induced StAR promoter activity. The −254-bp segment resulted in reporter activity similar to that of the −966-bp segment, indicating that element(s) responsive to atRA remained within this region. Both basal and atRA-treated luciferase activities decreased by 57% when cells were transfected with the −151-bp StAR segment. Truncation to −68 bp further attenuated (P < .05) basal and atRA-induced StAR promoter activity. These findings indicate that the elements responsive to atRA reside within the −254-bp region of the StAR promoter. Several elements within this region were assessed for atRA responsiveness by generating mutations in each of the putative recognition motifs. The elements studied were: an LXR/RXR site, an Sp1 site, an SF-1 site, a C/EBP site, a CRE2/AP-1 site, a GATA site, and an SREBP site (20, 22, 33, 51). MA-10 cells transfected with wild-type −254/−1-bp StAR segment demonstrated a 2.8-fold increase in reporter activity in response to atRA (Figure 5B). Mutation of the LXR/RXR site decreased basal (P < .05) and resulted in a 62% reduction in atRA-mediated StAR reporter activity. Additionally, whereas mutation in the SF-1/3 site decreased basal and atRA-induced StAR promoter activity by 47%, mutation of the Sp1 site had no apparent effects. Mutation in the CRE2/AP-1 site diminished atRA-stimulated StAR promoter activity by 50%. Alteration of bases in the C/EBP, GATA, and SREBP sites decreased basal StAR promoter responses by 36%, 22%, and 31%, respectively, but did not affect atRA-induced luciferase activity, indicating that multiple elements mediate retinoid-responsive StAR transcription, but that LXR/RXR appears to play the most important role. In additional studies, MA-10 cells transfected with the −254/1-bp wild-type StAR segment (LXR/RXRWt) demonstrated 2.4- and 3.0-fold increases in reporter activity in response to TTNPB (1 μM) and SR11233 (1 μM), respectively, over untreated cells (Figure 5C). Addition of (Bu)₂cAMP (0.1 mM) to either TTNPB or SR11233 incubation markedly enhanced StAR reporter responsiveness, when compared with their responses individually. Conversely, cells transfected with the −254/1-bp StAR segment containing the mutant LXR/RXR sequence (LXR/RXRMut) demonstrated approximately 60% decrease in basal reporter activity. The decrease in basal response was coordinately associated (P < .01) with TTNPB, SR11233, and TTNPB/SR11233 plus (Bu)₂cAMP-induced StAR promoter activities. These findings corroborate the data presented in Figure 4B and demonstrate that the LXR/RXR element is integral to retinoid-responsive StAR gene transcription.

Figure 5.

Deletion studies of the 5′-flanking region of the mouse StAR promoter and mutational analyses of elements within the −254/−1-bp region for retinoid responsiveness. A, MA-10 cells were transiently transfected with different StAR reporter plasmids (−966, −426, −254, −151, and −68 bp) in the presence of pRL-SV40 vector. B, Cells were also transfected with either −254/−1 StAR reporter plasmid (wild type) or −254/−1-bp segment containing mutations in the putative binding sites, as indicated. A schematic representation of the StAR reporter plasmids is shown (A and B; bottom panels). C, Cells were also transfected with either −254/−1 StAR segment (LXR/RXRWt) or −254/−1 StAR containing mutation in the LXR/RXR (LXR/RXRMut) site. Thirty-six hours after transfection, cells were treated without (Basal) or with TTNPB (1 μM), SR11233 (1 μM), in the absence or presence of (Bu)₂cAMP (0.1 mM) for an additional 6 hours, as indicated (C). Luciferase activity in cell lysates was determined and expressed as StAR promoter activity RLU (luciferase/Renilla). pGL3-basic (pGL3) was used as a control. Data represent the mean ± SE of 3–5 independent experiments, *, P < .05; **, P < .01.

To further ascertain the involvement of the LXR/RXR motif in retinoid signaling, protein-DNA binding was carried out using EMSA. As shown in Figure 6A, incubation of a ³²P-labeled oligonucleotide probe corresponding to the LXR/RXR region (−200/−185 bp) in the StAR promoter produced a major protein-DNA complex with MA-10 NE (lanes 1–8). The binding was increased with atRA-treated NE (compare lanes 1 and 2), and competitively inhibited with its unlabeled sequence (lane 3). Whereas (Bu)₂cAMP (0.1 mM) had no effect on binding (lane 4), it further increased atRA-mediated protein-DNA complex (lanes 5–8). Protein-DNA binding was markedly repressed by antibodies to both RARα (lane 6) and RXRα (lane 7). In contrast, the binding was unaffected by a mutant LXR/RXR (LXR/RXRMut) unlabeled sequence (lane 8). In additional studies (Figure 6B), 9-cis RA plus (Bu)₂cAMP-stimulated MA-10 nuclear protein binding to the LXR/RXR probe was affected both by unlabeled LXR/RXR and RARE-DR5 sequences (compare lanes 2 and 3–4). Protein-DNA binding was apparently unaffected with unlabeled Sp1 (lane 5), C/EBP (lane 6), SF-1/3 (lane 7), GATA (lane 9), and SREBP (lane 10) binding sites from the StAR promoter. Conversely, the unlabeled CRE2/AP-1 (lane 8) sequence significantly affected (P < .05) protein-DNA binding. Also, the LXR/RXR probe can bind in vitro transcribed/translated RARα (lane 2) and RXRα (lane 3) proteins to different degrees (Figure 6C). Protein-DNA binding was markedly inhibited by RARα (compare lanes 2 and 4) and RXRα (compare lanes 3 and 5) antibodies, revealing the ability of the LXR/RXR motif to bind the RAR and RXR family proteins. In parallel, incubation of a ³²P-labeled RARE-DR5 probe binds in vitro transcribed/translated RARα and RXRα proteins (lanes 2–5), and both RARα (lane 4) and RXRα (lane 5) antibodies nearly abolished protein-DNA binding (Figure 6D). These results indicate that both RARs and RXRs act predominantly through the LXR/RXR element in the StAR promoter.

Figure 6.

Assessment of the LXR/RXR motif in the StAR promoter and RARE-DR5 sequence to MA-10 NE and in vitro transcribed/translated RARα and RXRα protein binding by EMSAs. NE (10–15 μg) obtained from control, atRA (10 μM), (Bu)₂cAMP (0.1 mM), and atRA plus (Bu)₂cAMP-treated MA-10 cells were incubated with the ³²P-labeled LXR/RXR (A–C) and RARE-DR5 (D) probes. A, A major protein-DNA complex was observed with the LXR/RXR probe (lanes 1–8). Protein-DNA binding was challenged with unlabeled LXR/RXR and LXR/RXR mutant (LXR/RXRMut) sequences (lanes 3 and 8). B, Effects of several transcription factor binding sites on binding of the LXR/RXR region to MA-10 NE (lanes 2–10). Unlabeled specific transcription factor binding sequences, ie, LXR/RXR (lane 3) RARE-DR5 (lane 4), Sp1 (lane 5), C/EBP (lane 6), SF-1/3 (lane 7), CRE2/AP-1 (lane 8), GATA (lane 9), and SREBP (lane 10) were challenged with protein-DNA binding. C, Binding of a ³²P-labeled LXR/RXR probe to in vitro transcribed/translated RARα and RXRα proteins (2 μg each) (lanes 2–5). D, Binding of a ³²P-labeled RARE-DR5 probe (lanes 2–5) to in vitro transcribed/translated RARα and RXRα proteins. In both cases, RARα and RXRα protein-DNA binding was challenged with RARα (lane 3, C and D) and RXRα (lane 5, C and D) antibodies, respectively. Cold competitors were used at 100-fold molar excess. Migration of free probes is shown (A). Data are representative of 3–4 independent experiments. Ab, antibody; DR5, direct repeat 5.

Involvement of atRA on CREB signaling, and recruitment of P-CREB, CBP, RARα, and RXRα to the StAR promoter

CREB is activated via diverse signaling pathways (23), and this event is required for the recruitment of CBP to induce CREB-mediated transactivation. The results presented in Figure 7A reveal that MA-10 cells treated with atRA for 0–360 minutes enhanced P-CREB at Ser133 by 15 minutes (P < .05), reached maximal levels between 30 and 60 minutes, decreased thereafter with time, but remained elevated over basal at 360 minutes. The optimal activation of CREB was 3.1 ± 0.3-fold over untreated cells. Cells treated with atRA for 6 hours exhibited a 2.3 ± 0.2-fold increase in P-CREB (Figure 7B). (Bu)₂cAMP (0.1 mM) also enhanced (P < .05) P-CREB. Coincubation of atRA and (Bu)₂cAMP (0.1 mM) yielded a 5.6 ± 0.5-fold increase in P-CREB, a level similar to that seen in response to 1 mM (Bu)₂cAMP (Figure 7B and Reference 45). No alteration in the amounts of CREB protein was observed in any of these treatments. To determine whether induction of P-CREB recruits CBP to the StAR promoter, we performed ChIP assays. Treatment with atRA (0–30 μM) for 1 hour increased P-CREB association with the proximal, but not with the distal, region of the StAR promoter in a dose-dependent manner (Figure 7C). The association of CBP in response to atRA was concurrent with that of P-CREB, demonstrating the presence of both P-CREB and CBP on the StAR promoter and point to an involvement of CREB signaling in retinoid-regulated StAR gene transcription. Additionally, both RARα and RXRα were associated with the proximal StAR promoter. Association of RARα and RXRα was not observed with the distal StAR promoter region (not illustrated). Treatment with 9-cis RA had no apparent effects on the association of these subtypes when compared with untreated controls (Figure 7D), demonstrating that both RARα and RXRα associate with the StAR proximal promoter and that their association is not influenced in response to 9-cis RA.

Figure 7.

Effect of atRA on phosphorylation/expression of CREB, and association of CBP, RARα, and RXRα with the StAR promoter. MA-10 cells were treated without or with atRA either at a fixed (10 μM) or increasing dosage (0–30 μM) for varying (0–360 minutes; A) or fixed (6 hours; B) time periods. atRA was also incubated in the presence of 0.1 mM (Bu)₂cAMP (B). Cells were also treated with atRA or 9-cis RA (10 μM) for 1 hour (C and D). Following treatments, cells were analyzed for P-CREB and CREB levels using 25–30 μg of total cellular protein. Representative immunoblots show P-CREB and CREB levels in response to atRA and/or (Bu)₂cAMP (A and B). Integrated optical density (IOD) values of P-CREB and CREB in each band were quantified, and compiled data (n = 4) are presented in terms of fold response (A, lower panel). Immunoblots shown are representative of 4 independent experiments. ChIP assays were carried out as described in Materials and Methods (C and D). Cross-linked sheared chromatin obtained from different treatment groups was immunoprecipitated (IP) without or with anti-P-CREB, anti-CBP, anti-RXRα (in duplicate), and anti-RARα (in duplicate) antibodies. Recovered chromatin was subjected to PCR analysis using primers specific to either the proximal (−255/−39 bp) or the distal (−3522/−3304 bp) region of the mouse StAR promoter. Representative autoradiograms illustrate the association of P-CREB, CBP, RARα, and RXRα with the StAR promoter. Data shown are representative of 3–4 independent experiments.

Functional relevance of HSL in retinoid-mediated steroidogenesis

HSL plays an important role in regulating steroidogenesis (19, 36, 37). MA-10 cells treated with atRA for 6 hours showed increases in phosphorylation of HSL (P-HSL) at Ser660 (2.6 ± 0.3-fold) and HSL protein (1.9 ± 0.2-fold) over untreated cells (Figure 8A). P-HSL and HSL appeared as a doublet, with 83-KDa major and 81-kDa minor species. Whereas (Bu)₂cAMP (0.1 mM) had no effect on HSL protein level, it did increase (P < .05) P-HSL. (Bu)₂cAMP enhanced atRA-stimulated P-HSL and HSL levels, concomitant with StAR protein and progesterone production (Figure 8, A and B). Cells pretreated with CAY10499 (10 μM; a potent inhibitor of HSL; Reference 19 suppressed (P < .01) both atRA and atRA plus (Bu)₂cAMP-stimulated P-HSL and HSL levels, effects associated with 52 ± 7% and 64 ± 9% decreases in StAR protein and steroid synthesis, respectively (Figure 8, A and B). These results indicate that CAY10499 inhibited the hydrolytic activity of HSL and consequently affected atRA and atRA plus (Bu)₂cAMP-induced StAR expression and steroid synthesis. In additional approaches, MA-10 cells transfected with an HSL siRNA decreased HSL protein levels by approximately 80% when compared with a negative control siRNA (scrambled) (Figure 8C). atRA showed a 3.7-fold increase in StAR protein level over basal in scrambled siRNA-treated cells but did not alter CYP11A1 protein expression. Depletion of HSL in cells affected atRA-induced StAR protein level approximately 50%, suggesting a link between HSL function and steroidogenesis. Knockdown of HSL markedly affected HSL activity, increased cholesteryl ester levels, and decreased free cholesterol content (data not shown; Reference 19), demonstrating that interference of HSL diminishes cholesterol availability for steroid biosynthesis. To gain more insight into these events, the role of HSL in retinoid-mediated steroidogenesis was evaluated in conjunction with SREBP-1c (Figure 8D). MA-10 cells transfected with the −2.7 kb/+1 SREBP-1c luciferase reporter plasmid demonstrated increases in T0901317 (T1317; an LXR agonist, 0.5 μM) and 9-cis RA (5 μM)-induced SREBP-1c promoter activity by 2.4 ± 0.3 and 1.9 ± 0.2-fold over untreated cells, respectively. Cotreatment with T1317 and 9-cis RA resulted in a 4.6-fold increase in SREBP-1c reporter activity. Cells overexpressing pcDNA3-HSL significantly enhanced (P < .05) basal response and coordinately augmented T1317, 9-cis RA, and T1317 plus 9-cis RA-mediated SREBP-1c reporter responsiveness by 2- to 3-fold when compared with mock (pcDNA3) controls, indicating that HSL enhances oxysterol production and thereby the efficacy of these ligands in steroidogenesis. Altogether, these findings demonstrate that HSL, through its action on the hydrolysis of cholesteryl esters, plays an important role in retinoid-mediated regulation of StAR expression and steroid biosynthesis, which involve LXR signaling, in mouse Leydig cells.

Figure 8.

Role of retinoid signaling in P-HSL, HSL, StAR, CYP11A1, and progesterone levels, and its consequences for SREBP-1c promoter activity. MA-10 cells were pretreated without or with CAY10499 (10 μM) for 45 minutes and then incubated in the absence (Basal) or presence of atRA (10 μM), (Bu)₂cAMP (0.1 mM), and atRA plus (Bu)₂cAMP for an additional 6 hours, as indicated (A and B). C, Cells were transfected with 100 nM of a negative control siRNA (scrambled) and HSL siRNA (HSL). Following 48 hours of transfection, cells were treated without or with atRA (10 μM) for an additional 6 hours, and cells were processed for cellular protein preparation. Representative immunoblots illustrate P-HSL (Ser660), HSL, StAR, and CYP11A1 levels in different groups using 20–30 μg of total cellular protein (A and C). Immunoblots shown are representative of 3–5 independent experiments. Accumulation of progesterone in the media was determined (n = 5; ± SE) and expressed as nanograms/mg protein (B). Integrated optical density (IOD) values of HSL, StAR, and CYP11A1 in each band were quantified and compiled data (n = 3; ± SE) are presented (C, bottom panel). D, Cells were also transfected with pcDNA3 and pcDNA3-HSL in the presence of the −2.7 kb/+1 SREBP-1c reporter (−2.7 kb/+1 SREBP-1c-Luc) construct, as described in Materials and Methods. Following 36 hours of transfection, cells were treated without or with T1317 (0.5 μM), 9-cis RA (5 μM), and a combination of them, for an additional 6 hours, as indicated. Luciferase activity in cell lysates was determined and expressed as SREBP-1c promoter activity RLU (luciferase/Renilla), and data represent the mean ± SE of 3 independent experiments. Cells were also determined for HSL expression by immunoblotting. A representative immunoblot (n = 3) illustrates HSL level in different groups using 20–30 μg of total cellular protein (D, top panel). β-Actin expression was assessed as loading control. Different letters above the bars indicate that these groups differ significantly from each other at least at P < .05.

Discussion

Vitamin A (retinol) and its derivatives (collectively referred to as “retinoids”) influence an array of functions, ranging from vision to reproduction (1, 2, 9). Deficiency of vitamin A decreases testosterone biosynthesis and blocks spermatogenesis, phenomena similar to those found in a number of retinoid receptor mutant mice (8, 9). However, systematic administration of RAs reverses most reproductive and developmental blocks in vitamin A-deficient animals (2), indicating that retinoids can restore steroidogenesis. Regulation of steroid biosynthesis is principally dictated by the StAR protein, a rapidly synthesized mitochondrial phosphoprotein the expression, activation, and extinction of which are influenced by both cAMP/PKA-dependent and cAMP/PKA-independent signaling pathways that involve acute and chronic effects on steroidogenesis (12, 13, 16). Using a variety of experimental approaches, the present studies extend previous observations by elucidating the molecular events in which retinoid signaling acts to drive StAR expression and steroid biosynthesis in steroidogenic tissues.

The results of the present findings demonstrate that retinoid signaling, especially RAs, moderately enhanced StAR expression and steroid synthesis in the absence of StAR phosphorylation. The activation of cAMP/PKA signaling, by suboptimal concentrations of either (Bu)₂cAMP or type 1/II PKA analogs, strikingly elevated not only retinoid-mediated StAR expression, but also its phosphorylation, concomitant with increased steroid production, demonstrating that a low level of PKA activity is critical for the induction of steroidogenesis (26, 52). This observation implies that treatment of the cells with atRA/9-cis RA, although able to activate the StAR promoter, does not sufficiently activate the PKA-signaling pathway to phosphorylate StAR. Indeed, as we have previously observed, phosphorylation of StAR is an indispensable event to obtain maximal cholesterol-transferring activity of StAR for steroid biosynthesis (41, 45, 53, 54). Inhibition of PKA activity by H-89 markedly affected atRA and atRA plus (Bu)₂cAMP-stimulated StAR expression and progesterone synthesis, indicating the steroidogenic potential of retinoids is primarily mediated through the cAMP/PKA pathway. In addition, atRA has been shown to stimulate intracellular cAMP production in a number of cellular models (55, 56). In our studies, atRA and 9-cis RA displayed additive effects on StAR expression and progesterone production, suggesting that both RARs and RXRs functionally cooperate to regulate steroidogenesis that may involve discrete mechanisms. We determined that MA-10 Leydig cells were found to express all 3 RAR and RXR subtypes to varying degrees. Among these subtypes, knockdown of the RARα and RXRα in MA-10 cells resulted in approximately 70% declines in endogenous protein levels that were accompanied by 40%–50% reductions in StAR expression and progesterone synthesis, suggesting that other retinoid receptor subtypes might be involved in influencing steroidogenesis. In support of this, mice lacking several retinoid receptor genes, including RARα, RARγ, RXRα, and RXRβ, display profound anomalies in testicular functions, including male sterility and embryonic lethality (2, 9). The increase in the steroidogenic response, by retinoid signaling, was not associated with alterations in CYP11A1 and 3β-HSD proteins, an observation in agreement with previous findings (57, 58), that this acute effect of retinoids does not involve increased transcription/translation of these enzymes. Even so, mRNA levels of cytochrome P450 17α-hydroxylase, CYP11A1, StAR, and steroid biosynthesis do increase with long-term retinoid treatment in human theca cells (27).

Regulation of StAR gene transcription uses enhancer elements that “switch on” and silencer elements that “switch off” expression; thus, a balance between inducer and repressor functions of these factors presumably allows a fine tuning of the steroidogenic machinery (reviewed in References 13, 22, and 59). Using deletion, site-specific mutagenesis, and EMSA analyses, our data provided evidence that retinoid regulation of the StAR gene is essentially mediated by an LXR/RXR interacting motif in the StAR promoter, in which several transactivating factors play permissive roles. Consequently, cross talk between RAR/RXR and many other factors such as GATA, Fos/Jun, Sp1, and SF-1 in the transcriptional regulation of a number of genes has been reported (60–62). The functional relevance of the LXR/RXR sequence was elucidated by different approaches indicating that alteration/inhibition of retinoid binding to this site influences steroid biosynthesis by modulating transcription of the StAR gene. Both LXR and RXR are members of the steroid/thyroid hormone receptor superfamily of transcription factors that heterodimerize with several factors, including RARs, peroxisome proliferator-activated receptors, vitamin D receptors, and thyroid hormone receptors that bind to hexameric half-sites (5, 6, 30, 63). Therefore, it is conceivable that these heterodimers recognize an LXR/RXR motif in the StAR promoter and control its transcription. Recently, we have demonstrated that an interaction between RXR and LXR plays an important role in the regulation of StAR expression and steroid synthesis in mouse Leydig cells (19). Regardless of the transregulatory mechanisms involved, the −254/−1-bp region in the StAR promoter that possesses an LXR/RXR motif, in addition to several transcription factor-binding sites, appears to be the most important region and might function as a retinoid-response unit in the transcriptional regulation of the StAR gene.

An interesting aspect of the present findings is the activation of CREB in the potentiation of atRA and cAMP/PKA-mediated steroid biosynthesis and, consequently, its increased presence on chromatin and recruitment of CBP to the proximal, but not the distal, StAR promoter. Concomitantly, both RXRα and RARα were found to be associated with the StAR promoter. Recruitment of CBP/p300 has been shown to be required in retinoid-mediated transcriptional regulation (64, 65). In agreement with these observations, retinoids have been shown to activate CREB in human bronchial epithelial (66) and neuronal (67) cells. Transcriptional synergy requires the simultaneous interaction of multiple factors with CBP/p300 or other relevant coactivators involved in the communication between transcription factors and the basal transcriptional machinery (22, 24, 25). CBP/p300 participates in the actions of many transcription factors, including cFos, cJun, C/EBPβ, and GATA-4, and regulates StAR's transactivation potential (21, 24, 26, 45, 68), signifying that CBP/p300 acts as an integrator of diverse signaling pathways. Therefore, it is plausible that RAs activate other transcription factors, in addition to CREB, that have been instrumental in regulating StAR gene expression. It is noteworthy, however, that interference of either CREB or CBP has been shown to affect transcriptional regulation of the StAR gene mediated by cAMP signaling (22, 24, 39), supporting the notion that CREB plays a key role in retinoid-responsive steroidogenesis. Previous studies have reported that retinoid activity is effected by phosphorylation of Ser77 in RARα1 and Ser66/68 in RARγ2, and Ser61, Ser75, and Thr87 in RXRs, by cdk7/cyclin H, which is associated with the general transcription factor TFIIH and MAPKs (69, 70). In fact, retinoids phosphorylate several Ser and Thr residues via receptor-dependent and receptor-independent mechanisms, underlying the complexity of signaling cross talk between nuclear and cell-surface receptors.

HSL plays an essential role in regulating intracellular cholesterol metabolism, and this process contributes to a number of signaling events in cells that utilize cholesterol (19, 36, 71). Hormonal control of HSL activity is primarily mediated by phosphorylation of several Ser residues, including Ser563, Ser565, and Ser660 (sequences corresponding to rat HSL), by cAMP-dependent PKA and other signaling pathways (19, 71, 72). Our present data demonstrate that atRA enhanced phosphorylation of HSL at Ser660 concomitantly with StAR protein expression and steroid biosynthesis. Selective inhibition of HSL action by CAY10499 markedly affected atRA and atRA plus (Bu)₂cAMP-induced StAR and steroid levels. We have recently demonstrated that phosphorylation of HSL at Ser563 and Ser660 increases its hydrolytic activity, and these effects correlate with StAR expression and steroid synthesis in gonadal and adrenal cells (19). Thus, it is not surprising that phosphorylation of Ser660 by atRA increases the hydrolytic activity of HSL, which subsequently plays an important role in regulating steroid biosynthesis. However, the involvement of additional HSL phosphorylation sites, in retinoid-dependent steroidogenesis, which have been shown to influence HSL action in previous studies (19, 37, 72), cannot be excluded. Alternatively, in the present study knockdown of HSL was found to be associated with the repression of retinoid-mediated StAR expression that resulted in an insufficient availability of cholesterol (19). These findings are reminiscent of previous studies which demonstrated that male sterility in mice lacking the HSL gene is, at least in part, due to perturbed retinoid metabolism (36, 37, 73). In a recent study (19), regulation of HSL-mediated StAR expression and steroid synthesis has been shown to primarily involve LXR pathways, especially the induction of SREBP-1c and ABCA1. LXRs (LXRα and LXRβ) bind to oxysterol ligands (oxidative metabolites of cholesterol), activate transcription of many genes including StAR, and play vital roles in controlling intracellular cholesterol trafficking, metabolism, and balance (19, 33, 74). In addition, oxysterols have been shown to be involved in StAR expression and steroidogenesis (19, 33). Our present data demonstrate that an increase in HSL levels was capable of increasing T1317 and/or 9-cis RA-stimulated SREBP-1c promoter activity, an observation in agreement with previous findings (19). This suggests that HSL enhances oxysterol production and thereby the availability of cholesterol in modulating retinoid-mediated steroidogenesis. Even so, retinoids have been shown to induce SREBP-1c expression through RXR/LXR signaling (34, 35). Thus, LXR-regulatory mechanisms appear to play a central role between HSL and retinoids in regulating the steroidogenic response in mouse Leydig cells. Nonetheless, it has been reported that stimulation of cholesteryl ester hydrolysis in macrophages following overexpression of HSL correlates with ABCA1 expression, a key event in cellular lipid transport and atherosclerosis (75). Removal of excess cholesterol from macrophage foam cells has been shown to be critical in limiting plaque stability and progression of atherosclerotic lesions (75, 76). Our present data provide evidence that retinoid signaling strikingly increases cAMP/PKA-mediated StAR and steroid levels to potentially enhance cholesterol clearance from cells, an approach that may be effective in stabilizing and/or regressing cardiovascular disease. The synergistic activation of StAR expression and steroid synthesis by retinoid and cAMP signaling is influenced by following linked regulatory events, ie, retinoids → binding/interacting to RXR/LXR/RAR → increased cAMP/PKA → activation of transcription factor(s) → expression/activation of HSL/LXR/SREBP-1c → StAR transcription → StAR translation → acute steroidogenesis.

Taken together, our observations provide another mechanism in which trophic hormone-stimulated steroidogenesis can be regulated, namely by retinoid-mediated induction of StAR expression and steroid biosynthesis. This represents a novel observation and adds yet another regulatory mechanism to this complex process. Additionally, retinoid-mediated regulation of the steroidogenic response, in vivo, may have broader effects that serve to 1) regulate steroid hormone dependent functions, 2) recapitulate defects associated with vitamin A deficiency, and 3) eliminate cholesterol from cells in order to prevent atherosclerosis and plaque stability. Further studies are necessary to confirm these possibilities.