Down-Regulation of sidB Gene by Use of RNA Interference in Aspergillus nidulans

Abstract

Background: Introduction of the RNA interference (RNAi) machinery has guided the researchers to discover the function of essential vital or virulence factor genes in the microorganisms such as fungi. In the filamentous fungus Aspergillus nidulans, the gene sidB plays an essential role in septation, conidiation and vegetative hyphal growth. In the present study, we benefited from the RNAi strategy for down-regulating a vital gene, sidB, in the fungus A. nidulans. Methods: The 21-nucleotide small interfering RNA (siRNA) was designed based on the cDNA sequence of the sidB gene in A. nidulans. Transfection was performed through taking up siRNA from medium by 6 hour-germinated spores. To evaluate the morphologic effects of siRNA on the fungus, germ tube elongation was followed. Moreover, total RNA was extracted and quantitative changes in expression of the sidB gene were analyzed by measuring the cognate sidB mRNA level by use of a quantitative real-time RT-PCR assay. Results: Compared to untreated-siRNA samples, a significant inhibition in germ tube elongation was observed in the presence of 25 nM of siRNA (42 VS 21 µM). In addition, at the concentration of 25 nM, a considerable decrease in sidB gene expression was revealed. Conclusion: Usage of RNAi as a kind of post-transcriptional gene silencing methods is a promising approach for designing new antifungal agents and discovering new drug delivery systems.

INTRODUCTION

RNA silencing is a comprehensive term that has been used to describe RNA interference (RNAi) in animals, post-transcriptional gene silencing in plants, and quelling in fungi, which are all similar forms of RNAi from mechanism aspect [1]. Introduction of RNA silencing machinery in fungi is recently considered to be one of the promising approaches in knocking down essential genes responsible for vital as well as virulence factors [2]. A homology-dependent gene silencing phenomenon termed “quelling” was first noted in the fungus Neurospora crassa. Quelling was recognized during attempts to increase the production of orange pigment expressed by the gene al1 of N. crassa [3]. RNAi mechanism is actually a natural process involves in using short double-stranded RNA molecules, named small interfering RNA (siRNA). In this mechanism, double-stranded RNA or hairpin RNA is cleaved by RNaseIII-type enzyme called dicer into siRNA duplex of 21–26 nucleotides, which silence the expression of complementary target RNA by inducing RNA cleavage and subsequent reduction in protein expression levels [4-7]. RNAi has changed researcher’s conception in the field of gene function in many diverse model systems. Moreover, it has tangible applications for tissue/cell engineering and human therapeutics [8-10].

In fungi, cytokinesis or septation results in a cross-wall formation known as the septum. In Schizo-saccharomyces pombe, it has been revealed that the septation initiation network is a kinase cascade which triggers the narrowing of the actomyosin ring and consequently the assembly of the septum [11, 12]. In S. pombe central players of septation initiation network, there are cascaded kinases of Cdc7p, Sid1p, and Sid2p. These kinases and their associated proteins exhibit dynamic localization patterns during the cell cycle [13]. It is strongly possible that a signaling network resembling the septation initiation network in fission yeast regulates septation in the filamentous fungi. Moreover, a similar signaling network, known as the mitotic exit network, has been characterized in Saccharomyces cerevisiae [14, 15].

Over the past 50 years, Aspergillus nidulans (A. nidulans( has been elevated to the status of a model organism and a number of methods have been developed to facilitate the efficient analysis of gene function in this filamentous fungus [16, 17]. Orthologues of Cdc7p and Sid2p, known as sepH and sidB, play an essential role in septation in A. nidulans [13, 18]. In addition to its essential function in septation and conidiation, sidB also played a role in vegetative hyphal growth [18]. In the present study, for the first time, we evaluated the utility of RNAi technology to inhibit the formation of vegetative hyphal growth in the filamentous funus A. nidulans via down-regulating of sidB gene.

MATERIALS AND METHODS

Fungal strain and spore collection. A. nidulans wild type strain PTCC 5014 was cultured on potato dextrose agar medium plates (Merck, Germany) and incubated at 37°C for 14 days. Fungal spores were collected on plates by surface scrapping of the colony with a pipette tip, suspended in stilled dH₂O and filtered through glass wool to remove any remaining mycelia fragments. The spores were finally re-suspended in sterile dH₂O at a concentration of 1 × 10⁸ spore ml^-1 using heamocytometery method.

Small interfering RNA. The 21-nucleotide siRNA was designed on the basis of the cDNA sequence of the sidB gene of A. nidulans. The sense strand siRNA having sequence (5´→3´) GGGUGAGGAAUACGAC UUUDTDT, antisense strand siRNA (5´→3´) AAAGUCGUAUUCCUCACCCDTDT and unrelated (negative control) siRNA sense sequence (5´→3´) UACAUUUAACAGCGUAAAAUGDTDT, antisense sequence (5´→3´) CAUUUUACGCUGUUAAAUGU ADDTDT were synthesized. (Metabion, Germany). Sense/antisense annealing was performed in annealing buffer (30 mM HEPES–KOH [pH 7.4], 100 mM KCl, 2 mM MgCl₂, and 50 mM NH₄Ac) accordance to the procedure for siRNA annealing (http://www.metabion.com/downloads/siRNAannealing.pdf) to generate siRNA duplex with symmetric 2-nt 3′ overhang.

Spore germination and germ tube growth. Spores were germinated in potato dextrose agar medium at 1200 ×g at 37°C for 6 h, and then siRNA was added to get a final concentration of 25 nM [19], and finally spores were incubated for another 12 h. Germinating spores were then fixed using 5% gluteraldehyde in order to calculate the spore germination percentage as well as length of germ tube. These experiments were repeated three times with three replicates in each experiment. Positive/negative controls (untreated/25 nM unrelated siRNA-treated samples) were also run along with the test samples.

RNA extraction and quantitative real-time RT-PCR assay. The cognate sidB mRNA was quantified in A. nidulans by quantitative real-time RT-PCR. Germinated spores were incubated for 18 h with siRNA, and then total RNA was extracted from both siRNA-treated (sidB-specific and unrelated siRNA) as well as untreated cells using GeneJET RNA Purification Kit (Fermentas, Germany) according to manufacturer's protocol. RNA concentrations and purity were determined via spectrophotometer methods (Eppendorf BioPhotometer, Germany). An equal amount of RNA (1 μg) was subjected to cDNA synthesis by using RevertAid™ First Strand cDNA Synthesis Kit (Fermentas, Germany). The actin gene (actA) was used as endogenous reference gene. sidB and actA primers were designed on the bases of published sequences of the sidB (Accession No. BN001303), and actA (Accession No. BN001301 REGION: 1833364…1835708) genes in NCBI (http:// www.ncbi.nlm.nih.gov/pubmed/). The sequences of forward and reverse primers have been shown in Table 1. Real-time RT-PCR was performed with a StepOne-Plus^TM real-time PCR System (Applied Biosystems, USA) and SYBR^® Premix Ex Taq™ II was used as a reagent specifically designed for real- time PCR using SYBR Green I. All PCR reaction mixtures contained 10 μl SYBR^® Premix Ex Taq^TM II (2×), 2 μl first strand cDNA, 0.4 μM each primer, 0.4 μl ROX Reference Dye (50×), and dH₂O up to the final volume of 20 μl. The program for amplification was 95°C for 30 s as initial denaturation step, followed by 40-cycle PCR consisting of 95°C for 5 s and 60°C for 30 s. Negative controls (water as template) were included in each run. Expression of each investigated gene was normalized to the housekeeping actA gene and analyzed using StepOne Software v.2.0. sidB gene expression was normalized to the housekeeping gene actA and analyzed by using REST (2008 V2.0.7) software. The software uses the comparative Ct method (ΔΔCt) to analyze data. Each experimental condition was performed in triplicate and each experiment was repeated twice on two different days for reproducibility.

Table 1.

PCR primers for real-time RT-PCR analysis

Primer name	Sequence (5'-3')	RT-PCR product size (bp)
sidB_F	FAAgAgATggCTgAgCgTgAT	136
sidB_R	gTACCAAAgTCCTCggTTgg
actA_F	gAAgTCCTACgAACTgCCTgATg	91
actA_R	AAgAACgCTgggCTggAA

RESULTS

Spore germination and germ tube growth. After 12 h of incubation, the length of hypha was measured. Comparing with the control sample, a significant inhibition of hyphal elongation was revealed in 25 nM siRNA-treated germinated spores. About 50% of germinated spores were failed to be extended. In addition, the length of germ tubes in elongated spores was less than that in control samples. Figure 1 indicates the inhibition of hyphal elongation in siRNA-treated samples compared with untreated ones. Table 2 shows the inhibitory effect of sidB down-regulation on germ tube elongation.

Fig. 1.

Effect of sidB-specific siRNA on germ tube elongation in the fungus A. nidulans. The response of germinated spores to siRNA under in vitro conditions after 12 h of incubation. (a) untreated spores, (b) 25 nM unrelated siRNA-treated spores, (c) 25 nM siRNA-treated spores

Table 2.

The inhibitory effect of sidB down-regulation on germ tube elongation in A. nidulans after 12 h incubation

Treatment	Spore germination (%)		Germ tube length (µm)
Positive control (untreated)		85	42 ± 0.97
25 nM unrelated siRNA		85	41 ± 0.76
25 nM gene-specific siRNA		62	21 ± 1.21

Data are presented as mean ± SD, on the basis of three independent experiments

Quantitative real-time RT-PCR assay. sidB and actA mRNA levels were measured after a 18-h period of germinated spore incubation with both unrelated and sidB-specific siRNA. A positive control, untreated A. nidulans germinated spores, was included in each run of the experiment as well. Expression of each gene was indicated as ratio of expression relative to that of untreated logarithmic phase grown fungus. Based on obtained data, the relative quantification of sidB was calculated to be 0.25 after normalization of sidB gene expression to the housekeeping gene actA (1 for relative expression). Figure 2 indicates the relative quantification of sidB gene regulation. A significant decrease in sidB gene expression was observed after the use of 25 nM of sidB-specific siRNA (P<0.05). Table 3 shows the results from data analysis using REST software.

Fig. 2.

Inhibitory effect of sidB-specific siRNA on sidB gene regulation. A significant decrease in sidB mRNA level was observed after the use of 25 nM gene-specific siRNA. From up to bottom: Rate of quantification for sidB gene expression in untreated sample, unrelated siRNA-treated sample and 25 nM gene-specific treated samples

Table 3.

Results for relative expression of the sidB gene using the ΔΔCt method (REST, 2008 V2.0.7

Gene	Type	Reaction efficiency	Expression	Std. error	95% CI	P(H1)	Result
BetaAct	REF	1.0	1.000
sidB	TRG	1.0	0.255	0.215 - 0.303	0.203 - 0.320	0.000	DOWN*
sidB (unrelated siRNA)	TRG	1.0	0.829	0.681 - 1.013	0.642 - 1.071	0.341

*Indicates down-regulation for sidB gene after treating with 25nM of gene-specific siRNA; Std. error, standard error; CI, confidence interval

DISCUSSION

Here, a novel approach was successfully applied to down-regulate the expression of sidB gene in A. nidulans, and the level of sidB mRNA was evaluated by taking advantages of real-time PCR approach. Evaluating of siRNA effectiveness is most often performed by quantifying target mRNA levels using real-time PCR under different conditions, since siRNA degrade their target mRNA. Apparently, different genes have different threshold requirements of knock down to obtain a biological phenotype [8-10]. Based on obtained data, it was revealed that the expression of the sidB gene was effectively decreased by using 25 nM of siRNA. Even this low concentration of SidB-specific siRNA had influence on phenotypic character-istics of the fungi. According to previous studies, the RNAi machinery does exist in this filamentous fungus, therefore, this effective system can be considered to be a new method for combating with Aspergillus pathogenesis [20, 21]. As the obtained results revealed, suppression of sidB gene, as a member of a gene group encoding proteins involved in mycelial septation as well as conidiation, which leads to inhibition of mycelial extension. Our findings represent a novel approach as a promising tool for designing new antifungal agents.

After the discovery of RNAi in 1998 [22], attempts were made to employ this technology for controlling gene expression in a variety of fungal species. Consequently, suppression of gene expression by a double-stranded RNA expressing plasmid or related-system has been shown in many fungal species, including Ascomycota, Basidiomycota and Zygo-mycota as well as the fungus-like Oomycota [23]. In certain species such as A. nidulans, Magnaporthe oryzae, N. crassa, and S. pombe, involvement of typical RNA silencing protein components such as dicer in the silencing phenomena was shown. Moreover, biogenesis of siRNA was detected in V. inaequalis [24], A. nidulans [20], M. oryzae [25], C. neoformans [26], A. fumigatus [21], N. crassa [27], H. capsulatum [28], and Candida albicans [2, 29].

Janbon et al. [30] characterized the role of the RNAi pathway in regulation of many cellular processes in C. neoformans as a model system. Liu et al. [31] demonstrated the silencing effect of RNAi in C. neoformans on expression of genes involved in capsule synthesis and adenine biosynthesis. Rappleye et al. [32] reported the important role of α-(1,3)-glucan in virulence of the fungus H. capsulatum through a plasmid-based RNAi system. In case of A. nidulans, Khatri and Rajem [19] explored the utility of RNAi as a tool for specific silencing of gene expression. In contrast to above researches which applied the vector-based methods for siRNA entrance, Khatri and Rajem [19] suggested that germinating spores are capable of taking up siRNA from the growth medium under in vitro conditions. In the present study, we also apply a simple, a rapid, and an effective method for siRNA to be up taken by growth medium. Although by using this method, the stability of siRNA is reported to be 18 h or more, the exact stability of siRNA in the target cells may be the issue to be concerned in future studies. Furthermore, it is strongly recommended to evaluate the effect of applied siRNA under in vivo condition.