The A_2A Adenosine Receptor Is a Dual Coding Gene

Background: Adora2a encodes A_2A adenosine receptor (A_2AR) and a new protein (uORF5) translated from an out-of-frame AUG.

Results: uORF5 exists in tissues where the Adora2a transcript is detected and is up-regulated by A_2AR activation. uORF5 suppresses AP1-mediated transcription.

Conclusion: Adora2a encodes two distinct proteins (A_2AR and uORF5) in an A_2AR-dependent manner.

Significance: uORF5 may participate in the functions of A_2AR during pathophysiological conditions.

Abstract

The A_2A adenosine receptor (A_2AR) is a G protein-coupled receptor and a major target of caffeine. The A_2AR gene encodes alternative transcripts that are initiated from at least two independent promoters. The different transcripts of the A_2AR gene contain the same coding region and 3′-untranslated region and different 5′-untranslated regions that are highly conserved among species. We report here that in addition to the production of the A_2AR protein, translation from an upstream, out-of-frame AUG of the rat A_2AR gene produces a 134-amino acid protein (designated uORF5). An anti-uORF5 antibody recognized a protein of the predicted size of uORF5 in PC12 cells and rat brains. Up-regulation of A_2AR transcripts by hypoxia led to increased levels of both the A_2AR and uORF5 proteins. Moreover, stimulation of A_2AR increased the level of the uORF5 protein via post-transcriptional regulation. Expression of the uORF5 protein suppressed the AP1-mediated transcription promoted by nerve growth factor and modulated the expression of several proteins that were implicated in the MAPK pathway. Taken together, our results show that the rat A_2AR gene encodes two distinct proteins (A_2AR and uORF5) in an A_2AR-dependent manner. Our study reveals a new example of the complexity of the mammalian genome and provides novel insights into the function of A_2AR.

Introduction

To optimize the usage of short coding sequences (1), the translation of multiple proteins using different reading frames within the same gene is commonly observed in prokaryotic organisms, including single-stranded DNA phages and Escherichia coli (2–4), and in mitochondria (5, 6). In eukaryotic systems, two genes that produce mRNAs with alternative reading frames (e.g. XLαs/ALEX (7) and prion protein/alternative prion protein (8)) have been reported. The differences in the function and regulation of distinct proteins translated from the same transcript are largely unclear. Recent bioinformatic analyses suggest that the number of dual coding genes in the mammalian genome is probably underestimated (9–11).

Adenosine regulates a variety of physiological functions by activating four different adenosine receptors (A₁, A_2A, A_2B, and A₃). The A_2A adenosine receptor (A_2AR),³ which is encoded by the Adora2a gene, is one of the most well studied G protein-coupled receptors because it is a major target of caffeine and a drug target for several brain disorders (12–15). Previous studies have shown that A_2AR is widely expressed throughout the body, with the highest level of expression in the striatum (16–20). The expression of A_2AR was shown to be markedly up-regulated during several pathological conditions (e.g. inflammation (21), acute lung injury (16), and hypoxia (22)), suggesting that A_2AR plays an important role in stress. Consistent with this notion, agonists of A_2AR have been shown to attenuate pathological inflammatory responses (23–27). Stimulation of A_2AR triggers multiple signaling pathways, including the cAMP-protein kinase A (PKA)-dependent pathway (28), and regulates a wide variety of downstream targets, such as the cAMP-regulated element-binding protein, nuclear factor-κB, and hypoxia-inducible factor 1, that mediate its effect (29–31).

The expression of the A_2AR gene is tightly regulated. We previously demonstrated that the rat A_2AR gene contains at least two independent promoters (P1 and P2), which drive the expression of multiple transcripts that contain the same coding region and 3′-untranslated region (UTR) and different 5′-UTRs (U1, 514 bp, initiated from P1; U2, 243 bp, initiated from P2). Both 5′-UTRs negatively suppress the translation of the A_2AR protein via an out-of-frame AUG codon (designated uAUG-5), which is located upstream of the start codon of the A_2AR protein (20). In the present study, we report that uAUG-5 is a functional start codon of an open reading frame (ORF) that overlaps with the A_2AR ORF in the rat Adora2a gene. This upstream ORF encodes a novel 134-amino acid (aa) protein (designated uORF5). The expression of uORF5 was found to moderately suppress the activity of the transcription factor activator protein 1 (AP1) and to regulate expression of several proteins that have been implicated in the MAPK pathway. Because the stimulation of A_2AR significantly enhanced the expression of uORF5 in a PKA-dependent manner, uORF5 might contribute to the pathophysiological function of A_2AR.

MATERIALS AND METHODS

Reagents

All reagents were purchased from Sigma except where otherwise specified. Forskolin (FK), CGS21680 (CGS), and KT5720 were from Tocris Biosciences (Bristol, UK). SCH58261 was obtained from Sigma/RBI (Natick, MA). Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), and horse serum were purchased from Invitrogen. H89 was from BIOMOL Research Laboratories (Plymouth Meeting, PA). Nerve growth factor (NGF) was obtained from Alomone Labs (Jerusalem, Israel).

Animals and Cell Culture

Rat brain tissues were collected from 12-week-old Sprague-Dawley rats. The experimental procedures were approved by the Institutional Animal Care and Utilization Committee of Academia Sinica (Taiwan).

Rat pheochromocytoma cells (PC12) and human embryonic kidney cells (HEK293T) were obtained from the American Type Culture Collection (Manassas, VA). The PC12 cells were grown in DMEM supplemented with 5% FBS plus 10% horse serum in an incubator at 37 °C and 10% CO₂. The A123 cell line, a PKA-deficient variant of PC12 cells (32), was a gift from Dr. J. A. Wagner (Cornell University Medical College). The A123 cells were grown in DMEM supplemented with 5% FBS plus 10% horse serum in an incubator at 37 °C and 10% CO₂. The HEK293T cells were grown in DMEM supplemented with 100 units/ml penicillin, 0.1 mg/ml streptomycin, and 10% FBS in an incubator at 37 °C and 5% CO₂. For the hypoxia treatment, the cells were placed in a hypoxic incubator (Coy Laboratory Products Inc., Grass Lake, MI) and maintained in a constant environment of 5% O₂ and 5% CO₂ (balanced with N₂) for the specified exposure periods. The oxygen concentration in the chamber was monitored with an oxygen meter and electrode (Coy Laboratory). The medium was preincubated in the hypoxia chamber for 12 h before being used in the hypoxia experiments. For the sorting of transfected PC12 cells, the cells were transfected with pIRES-hrGFP-1a or pIRES-uORF:hrGFP-1a for 48 h. The cells were then suspended in DMEM at a density of 5 × 10⁶ cells/ml and sorted for hrGFP-positive cells using a FACSVantage flow cytometer (BD Biosciences) equipped with an argon ion laser (488 nm, 100 milliwatts). The striatal progenitor ST14A and STHdh^Q7 cell lines were kindly provided by Dr. Elena Cattaneo (University of Milan) (33). These cells were grown in DMEM supplemented with 100 units/ml penicillin, 0.1 mg/ml streptomycin, 1 mm sodium pyruvate, 2 mm l-glutamine, and 10% FBS in incubator at 33 °C and 5% CO₂ (66).

Plasmids and Cell Transfection

To create the uORF5-V5 and A_2AR-V5 expression constructs, DNA fragments containing the Kozak sequence and the coding sequence of A_2AR (−65 to +1233, with +1 denoting the translational start site of A_2AR; Fig. 1A) or uORF5 (−65 to +340) were amplified from cDNA prepared from the rat striatum using PCR and subcloned into the pcDNA3.1/V5-His-TOPO vector (Invitrogen) following the manufacturer's instructions. Mutation of the translational start codon of uORF5 (uAUG-5, -65m) (20) was created using a two-step PCR approach (34). To prepare the uORF5:hrGFP expression construct, the DNA fragment encoding rat uORF5 was amplified from rat brain cDNA and subcloned into the SacI/XhoI sites of pIRES-hrGFP-1a (Agilent Technologies). The A_2AR knockdown constructs were produced by subcloning the 19-nucleotide shRNA sequence of the rat A_2AR gene (Adora2a) (Adora2a shRNA-1, 5′-TTACATGGTTTACTACAAC-3′; Adora2a shRNA-2, 5′-GATCATCCGAACCCACGTC-3′) into the pSUPER.neo+gfp vector. The pFA-CMV-GAL4-uORF5 construct was created by subcloning the coding region of uORF5 into the HindIII/KpnI sites of the pFA-CMV vector (Stratagene). 5′-UTR1- and 5′-UTR2-uORF5^(HA)-A_2AR^(V5) were generated from rat striatal cDNA using a two-step RT-PCR approach and subcloned into the pcDNA3.1/V5-His-TOPO vector. The pFA-CMV vector and GAL4-f-luciferase reporter were obtained from Stratagene. The AP1-Luc reporter was obtained from Clontech. The CRE-Luc reporter (35) and the p21-Luc reporter (36) were generous gifts from Dr. Jeffrey J. Y. Yen (Institute of Biomedical Sciences, Academia Sinica) and Dr. Sheau-Yann Shieh (Institute of Biomedical Sciences, Academia Sinica), respectively. The sequences of primers utilized in the generation of the above constructs are listed in Table 1.

FIGURE 1.

Two overlapping open reading frames coexist in the A_2AR gene. A, the major mRNA of the Adora2a gene (GenBank^TM accession number BC081727) that contains 5′-UTR (−243/−1) and coding regions for both A_2AR (solid box, +1 reading frame) and uORF5 (dashed line box, +2 reading frame). The translation start site of A_2AR is located at +1 (AUG), and the translation start site of uORF5 is located at −65 (uAUG5). The asterisks mark the stop codons of A_2AR (+1233) and uORF5 (+340). B, translation start sites are underlined. The asterisk marks the stop codon of uORF5. The overlapping region of uORF5 and A_2AR is 340 nucleotides. The entire aa sequence of uORF5 and the first 134 aa of A_2AR are shown below the DNA sequence. C, alignment of the predicted aa sequences of the human (CA307692), chimpanzee (XM_003953847), rat (BC081727), and mouse (AC137067) uORF5 proteins. Amino acid identity was as follows: rat versus human, 75%; rat versus chimpanzee, 75%; rat versus mouse, 84%.

TABLE 1.

Primer list for plasmid construction

Constructs	Primers (5′ → 3′)
(−65/+340)	CTGCAGCTAT GGACCGAG
	TCACCAAGCC ATTGTACC
(−65/+1233)	CTGCAGCTAT GGACCGAG
	TCAGGAAGGG GCAAACT
((−65/+1233)m)	CTGCAGCTTT GGACCGAG
	TCAGGAAGGG GCAAACT
5′-UTR1-uORF5(HA)-A2AR(V5) 5′	CTAAGCTTACAGGTCAGTGACAAATC
	AGCGTAATCTGGAACATCGTATGGGTACCAAGCCATTGTACC
5′-UTR2-uORF5(HA)-A2AR(V5) 5′	CTAAGCTTGTATCTCAGAACCCTGAA
	AGCGTAATCTGGAACATCGTATGGGTACCAAGCCATTGTACC
5′-UTR1 & 5′UTR2-uORF5(HA)-A2AR(V5) 3′	TACCCATACGATGTTCCAGATTACGCTTGACAGGTGTGAGGG
	GGAAGGGGCAAACTCTG
A2AR-V5	CTCCCACCATGGGCTCCT
	GGAAGGGGCAAACTCTGA
DBD-uORF5	TGAGCTCATGGACCGAGAGCTG
	CAGGTACCTCACCAAGCCATTGT
uORF5-V5	CTGCAGCTATGGACCGAG
	CCAAGCCATTGTACCGG

For transient transfection, cells were seeded onto poly-l-lysine (Sigma)-coated plates or coverslips 12–18 h before transfection. Cells at 50–70% confluence were transfected using Lipofectamine 2000 (Invitrogen) following the manufacturer's protocol. Protein and RNA were extracted from the transfected cells at 48 h post-transfection. The results were obtained from experiments using at least two different plasmid preparations.

Preparation of the Anti-uORF5 Antibody

The DNA sequence encoding uORF5 was amplified from cDNA prepared from the rat striatum using PCR and subcloned into the pET11d vector using standard molecular biology techniques. The resultant plasmid (pET11d-uORF5) was transformed into E. coli BL21-DE3 for the expression of the recombinant uORF5 protein and its subsequent purification using nickel-coupled beads (Novagen, GE Healthcare). The purified recombinant uORF5-His was used to raise a polyclonal antibody in rabbits using standard procedures (37). The resulting antiserum was designated as anti-uORF5. Affinity purification of anti-uORF5 was conducted using a standard procedure in which recombinant uORF5 was bound to polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA). In brief, purified uORF5-His was resolved by 15% SDS-PAGE and transferred to PVDF membranes using standard Western blotting procedures. uORF5-His was visualized on the membranes by light staining with Ponceau S. The membranes were cut into small pieces after extensive washing with TBST (500 mm NaCl, 20 mm Tris (pH 7.4), 0.1% Tween 20), blocked in TBST containing 3% BSA for 1 h at room temperature, and incubated with the anti-uORF5 serum with gentle shaking at room temperature overnight. The bound anti-uORF5 antibody was eluted using an acidic glycine buffer (50 mm glycine (pH 2.3), 150 mm NaCl) and neutralized with 1× PBS containing 0.2 m Tris (pH 8). After absorption with the PVDF membranes containing recombinant uORF5, the unbound serum was saved and used as a control (designated as anti-uORF5-absorp).

SDS-PAGE and Western Blotting

Cells were harvested by gentle scraping and then washed with ice-cold PBS. Cell pellets were resuspended in ice-cold radioimmune precipitation assay buffer (10 mm sodium phosphate (pH 7.2), 1% Triton X-114, 0.5% sodium deoxycholate, 150 mm NaCl, and 200× protease inhibitor mixture). Cell fractionation was conducted using a ProteoJet cytoplasmic and nuclear protein extraction kit (Fermentas Inc., Glen Burnie, MD). Briefly, the cells were rinsed twice with PBS and scraped off of the culture dishes in PBS, followed by a centrifugation step at 500 × g for 5 min. Cell pellets were lysed in ice-cold cell lysis buffer containing 1 μm DTT and 1× protease inhibitor mixture (Cell Signaling Technology Inc., Danvers, MA) on ice for 10 min. The lysate was subjected to centrifugation at 500 × g for 7 min, followed by an additional centrifugation step at 20,000 × g for 15 min. The supernatant was collected as the cytoplasmic fraction. The pellet, which contained the nuclei, was washed once with the same buffer, set on ice for 2 min, and then centrifuged at 500 × g for 7 min. The supernatant was removed, and the pellet was suspended in nuclei storage buffer containing 1 μm DTT and 1× protease inhibitor mixture, lysed with nuclei lysis reagent at 4 °C for 15 min, and centrifuged at 20,000 × g for 5 min. The resulting supernatant was collected as the nuclear fraction. Both the cytoplasmic and nuclear fractions were stored at −80 °C until further analysis.

To prepare the brain lysates, brain tissues were homogenized with a glass homogenizer in ice-cold RIPA buffer. The protein concentration was determined by a Bradford assay (Bio-Rad) using bovine serum albumin as the standard. The proteins were resolved using 12 or 15% SDS-PAGE and electrotransferred onto PVDF membranes. The membranes were blocked with 5% nonfat dry milk in TBS containing 0.1% Tween 20 (TBST) for 1 h at room temperature and incubated with the desired primary antibody (anti-A_2AR, 1:1000, Santa Cruz Biotechnology, Inc.; anti-uORF5, 1:100; anti-actin, 1:1000, Sigma-Aldrich; anti-tubulin, 1:5000, Sigma-Aldrich; anti-V5, 1:5000, Invitrogen; anti-lamin A/C, 1:1000, GeneTex, Hsinchu City, Taiwan; and anti-HA, 1:1000, GeneTex). Detection of the protein signal was carried out using enhanced chemiluminescence (PerkinElmer Life Sciences).

RNA Purification and Reverse Transcription Quantitative PCR (RT-qPCR)

RNA purification and complementary cDNA synthesis were performed using TRIzol (Invitrogen) and Superscript III (Invitrogen), respectively, following the manufacturer's protocols. RT-qPCR was performed using SYBR Green PCR Master Mix (Applied Biosystems, Invitrogen) on an ABI 7900HT fast real-time PCR system in 384-well plates following the manufacturer's instructions. For each experiment, the cDNA preparation and RT-qPCR analysis were performed at least in triplicate. The expression level of each transcript was normalized to that of the reference gene (glyceraldehyde-3-phosphate dehydrogenase, Gapdh). The sequences of the primers used in this analysis are listed in Table 2.

TABLE 2.

Primer list for RT-qPCR

Gene name	Primer sequence (5′ → 3′)
Mouse B2m	TGTCTCACTGACCGGCCTGTA
	CAGTTCAGTATGTTCGGCTTC
Mouse Dck	CGAGCCCAGCTAGCCTCTCT
	TGGTCCACTCTGTTTCATTCA
Mouse Gapdh	TGACATCAAGAAGGTGGTGAA
	AGAGTGGGAGTTGCTGTTGAAG
Mouse Gas1	CAGTCCGCAACTTCTTCACC
	GCTTCTGCTCTCGCATCTCA
Mouse Kif2a	CCAATAATGCACCATCCACC
	ACCTGCTCTTCCATCTCTACC
Mouse Lrrn3	AGCAGTGAGGGTGAGCACA
	AGAGGTTGATTAGAGGAGGGTA
Mouse Npm1	ATTACACCACCTGTGGTCTTAC
	CGTCCTCCTCATCTTCATCTTC
Mouse Pdzd2	ATTGTTTGCCAGTCTTTCCTC
	TCTGTGCCACTTGGTGCTCT
Mouse Rsal2	TCATCACCAGCAACTACACCA
	CATCACCAAGTCAGTCAGAAA
Mouse Rshl1	TGCCCATTGTTGGAGAGGT
	TCATACAGGCTGAGGTTGC
Mouse Spag9	TAAAGGTTCAAGCACTCCCAC
	TCATCCACATCTCCAATAAGG
Mouse Thbs1	ACAGCCTCAACAACAGATGC
	TCACCACAGGTCACAGAACAG
Mouse Tnrc6b	TTGAGAGGCAGAAGCAAGTG
	GATGTTGTGGGACGTTTAGAG
Rat A2AR	GTCCTGGTCCTCACGCAGAGTTCCATC
	AGCCATTGTACCGGAGTGGA
Rat Gapdh	TGACATCAAGAAGGTGGTGAA
	AGAGTGGGAGTTGCTGTTGAAG
Rat Lrrn3	AGTATTTGTGGCCTGCGTTG
	GTTGGCTTGTGACAGTGGTT
Rat Pdzd2	ATGCTCAGATGGTCAGGAGTG
	ATGTTTGTCAGGATGGATGGA
Rat Rasal2	TGTTCCTTCAGAGGGTCAGT
	GAGAGGTATTCGCAGTGTCC
Rat Rshl1	TGGATGATAGCGGGATGTTG
	TGTGGCCTGGCTGAATGTGT
uORF5(HA)-A2AR(V5)	GTCCTGGTCCTCACGCAGAGTTCCATC
	AGCGTAATCTGGAACATCGT

Immunocytochemistry

Cells were fixed with 4% paraformaldehyde in PBS at room temperature for 30 min, washed three times with PBS, and permeabilized with 0.05% Nonidet P-40/PBS for 10 min. After extensive washing with PBS, the permeabilized cells were blocked in PBS containing 2% BSA and 2% goat serum and stained with the desired primary antibodies (anti-V5, 1:200, Invitrogen; anti-V5, 1:200, Genetex; anti-FLAG 1:160, Sigma; anti-sodium potassium ATPase (Na⁺/K⁺-ATPase), 1:200, Abcam Inc., Cambridge, MA), which were reconstituted in PBS containing 1% goat serum and 0.05% Nonidet P-40 at 4 °C for 14–16 h. After extensive washing with PBS, the cells were incubated with the corresponding secondary antibodies conjugated to Alexa Fluor 488 or Alexa Fluor 568 at room temperature for 2 h. The cell nuclei were stained with DAPI. The slides were mounted using Vectashield (Vector Laboratories Ltd., Cambridgeshire, UK). Antibody staining was analyzed using laser confocal microscopy (MRC-1000; Bio-Rad; LSM510, Carl Zeiss, Oberkochen, Germany).

Luciferase Assays

Cells were lysed in the 1× lysis buffer of the Dual-Luciferase Reporter Assay System (Promega, Madison, WI) and centrifuged at 15,000 rpm for 5 min to remove insoluble material. The firefly luciferase activity was determined using a TD-20/20 luminometer (Promega) following the manufacturer's protocol and normalized to the Renilla luciferase activity in the lysate, whose expression was driven by the thymidine kinase promoter. At least three independent replicates were performed for each experiment.

Microarray

RNA was harvested from STHdh^Q7 cells transfected with the uORF5:hrGPF expression construct or the empty vector pIRES-hrGFP-1a for 48 h. The presence of DNA contamination was assessed by agarose gel electrophoresis. The RNA quality was evaluated using the Agilent RNA 6000 nanoassay kit (Agilent Technologies, Mississauga, Canada). Only the RNA preparations with an RNA integrity number of >7.0 and an A260/280 absorbance ratio of >1.8 were used in further experiments. The RNA was converted to double-stranded cDNA and amplified using in vitro transcription with the MessageAmp aminoallyl-RNA (aRNA) kit (Ambion, Austin, TX). aRNA probes were labeled with NHS-Cy5 (GE Healthcare) and fragmented using the aRNA fragmentation reagent (Ambion). The labeled probes were hybridized at 50 °C for 16 h to the Mouse Whole Genome OneArray version 4.3 (Phalanx Biotech Group, Hsinchu, Taiwan), which contains 30,968 well characterized genes, in duplicate. Three independent experiments were conducted. The array was then subjected to stepwise washing (wash I, 5 min at 42 °C; wash II, 5 min at 42 °C; wash III, 5 min at 25 °C), exposed to a phosphorimaging cassette, scanned using an Axon 4000B Scanner (Molecular Devices), and analyzed with Genepix software (Molecular Devices, Sunnyvale, CA). The data were processed by global scale normalization.

Statistical Analysis

The results are expressed as the means ± S.E. Each experiment was repeated at least three times. Unless stated otherwise, the statistical analyses were conducted using Student's unpaired t test for comparisons between two groups and one-way analysis of variance followed by a post hoc Holm-Sidak test for comparisons among multiple groups.

RESULTS

The Adora2a Gene Contains Overlapping Alternative ORFs

We previously demonstrated that the rat A_2AR gene has an upstream, out-of-frame translation start site (uAUG5) that is conserved among species (20). As shown in Fig. 1A, uAUG5 is located 65 nucleotides upstream of the start codon of A_2AR. Because uAUG5 is flanked by a nearly perfect Kozak consensus sequence, it is likely to be a functional start codon for an ORF that encodes a novel 134-aa protein (uORF5; Fig. 1B). Because the 5′-UTR of the A_2AR gene is conserved across species (Fig. 2) (20), this additional ORF may be present in the Adora2a genes of other species. The mouse uORF5 protein, which is encoded by the new ORF found in the mouse Adora2a gene, shares 84% aa identity with rat ORF5 (Fig. 1C). A shorter uORF5-like protein, which might be encoded by an alternative ORF found in the human and chimpanzee Adora2a genes, shares 75% aa identity with rat uORF5 (Fig. 1C).

FIGURE 2.

Cross-species sequence comparisons of the Adora2a gene. A partial sequence alignment of the Adora2a mRNAs from four different species is presented. The predicted start site and stop site of the uORF5 proteins are boxed. The translational start site of the A_2AR protein is underlined. The accession numbers of the human, chimpanzee, rat, and mouse Adora2a genes are CA307692, XM_003953847, BC081727, and AC137067, respectively. Asterisks mark the nucleotides that are identical across these four species.

uORF5 Exists in Vivo as a Product of the Adora2a Gene

To investigate whether rat uORF5 exists in vivo, we generated a rabbit polyclonal antibody against recombinant uORF5 prepared in E. coli. This anti-uORF5 antibody detected a protein of the predicted size (∼16 kDa) of uORF5 in HEK293 cells transfected with a vector containing the coding sequence of uORF5 (−65/+340) or both ORFs of uORF5 and A_2AR (−65/+1233) (Fig. 3A). When the translational start site of uORF5 (uAUG-5) was mutated ((−65/+1233)m), only A_2AR (and not uORF5) was detected (Fig. 3A). In the PC12 cell line, which expresses endogenous Adora2a transcripts (28), the anti-uORF5 antibody recognized a band at ∼16 kDa (Fig. 3B). A significant amount of the A_2AR protein was also detected in the PC12 cells (Fig. 3B). The transient transfection of two independent shRNAs against the Adora2a transcript effectively eliminated the expression of both the A_2AR and uORF5 proteins (Fig. 3B), suggesting that the A_2AR and uORF5 proteins are translated from the Adora2a transcripts. Similarly, a 16-kDa protein was detected in the rat striatum, where Adora2a was highly expressed (Fig. 3C) (20). The absorption of anti-uORF5 using the antigen (uORF5-His) bound on PVDF membranes completely eliminated the immunoreactivity of this 16-kDa protein. Taken together, these results suggest that the anti-uORF5 antibody specifically detects uORF5 in a Western blot analysis. In addition, consistent with the expression level of the Adora2a gene, uORF5 is expressed in PC12 cells and the striatum.

FIGURE 3.

uORF5 is endogenously expressed in PC12 cells, which endogenously express A_2AR, and the rat striatum. A, HEK293 cells were transfected with the indicated constructs for 48 h. The total lysates were assessed by Western blot analysis (WB) using the indicated antibodies. B, PC12 cells were transfected with the indicated constructs for 48 h. Total lysates were harvested and analyzed by Western blot analysis. C, tissues were collected from 12-week-old SD rats. Total lysates of the cortex, hippocampus, striatum, and cerebellum were harvested to analyze the expression levels of A_2AR, uORF5, and tubulin (loading control) by Western blot analysis. D, the cytosolic and nuclear fractions of the PC12 cells were prepared and analyzed by Western blot analysis. E, PC12 cells were transfected with the indicated construct(s) for 48 h, fixed, and subjected to immunofluorescent staining using the indicated antibodies. Arrows mark the transfected cells. The nuclei were labeled with DAPI (blue). F, PC12 cells were subjected to normoxia or hypoxia (5%) for the indicated periods of time. Total cell lysates were collected at the indicated time points and analyzed by Western blot analysis. The data are the means ± S.E. of at least three independent experiments. ***, p < 0.001, compared with the control cells (normoxia).

We next tested the subcellular localization of the uORF5 protein by cell fractionation and immunoblotting. Endogenous uORF5 was detected in both the cytosolic and nuclear PC12 cell fractions (Fig. 3D); lamin A/C and α-tubulin served as markers for the nuclear and cytosolic fractions, respectively. Immunostaining of PC12 cells also confirmed that uORF5 was expressed in the cytoplasm and nuclei but not in the plasma membrane that was labeled by the expression of Na⁺/K⁺-ATPase (a plasma membrane marker (38)). Conversely, A_2AR was located in the Na⁺/K⁺-ATPase-positive plasma membrane (Fig. 3E). Consistent with our hypothesis that the expression of the uORF5 protein is driven by the transcript of the Adora2a gene, the level of the uORF5 protein was markedly elevated in PC12 cells, similar to that of the A_2AR protein, upon hypoxia (5% O₂, 5% CO₂, and balance N₂) (Fig. 3F), which was previously shown to up-regulate the Adora2a transcript (22).

The Different 5′-UTRs of Adora2a mRNA Influence the Expression of the uORF5 Protein

We previously showed that the rat Adora2a gene contains at least two independent promoters, which drive the expression of two transcripts that contain the same coding regions for A_2AR and uORF5 and 5′-UTRs of different lengths (5′-UTR1 and 5′-UTR2). To test whether different 5′-UTRs influence the translation of the uORF5 protein, we created a set of constructs with an in-frame HA tag inserted at the 3′-end of the uORF5 ORF (+2 reading frame) (Fig. 4A) and an in-frame V5 tag at the 3′-end of the A_2AR ORF (+1 reading frame) (Fig. 4A). These two constructs are designated as 5′-UTR1- and 5′-UTR2-uORF5^(HA)-A_2AR^(V5), respectively. The expression of uORF5-HA and A_2AR-V5 in PC12 cells transfected with the indicated construct were detected by Western blot analysis using anti-HA and V5 antibodies (Fig. 4B). RT-qPCR analyses revealed that the levels of the mRNAs derived from 5′-UTR1- and 5′-UTR2-uORF5^(HA)-A_2AR^(V5) were similar (Fig. 4C). As reported previously, no detectable difference in the effects of 5′-UTR1 and 5′-UTR2 on the protein level of A_2AR-V5 was found (Fig. 4B). Surprisingly, compared with 5′-UTR2, 5′-UTR1 appeared to exert a negative effect on the expression of the uORF5 protein in PC12 cells (Fig. 4B). This inhibitory effect might be due to the additional uAUG (−335/−186) of a small ORF (150 bp) that is located in the 5′-UTR1-specific region of the Adora2a gene (AF107208) (20). During translational initiation, the small subunit of the ribosome binds to the 5′-cap of the mRNA and recognizes the first AUG, which promotes the assembly of the mature ribosome and initiates translation (39). Thus, the upstream uORF that is located in the 5′-UTR1 can be inhibitory for the translation of the downstream uORF5 cistron (40, 41), as has been observed for the 5′-UTRs of many genes (42–44). Interestingly, this inhibitory effect of the upstream uORF in 5′-UTR1 affected only the expression of the uORF5 protein but not that of the A_2AR protein (Fig. 4B). This finding suggests that the expressions of the uORF5 and A_2AR proteins are regulated independently.

FIGURE 4.

The expression of uORF5 is repressed by 5′-UTR1. A, schematic of the constructs harboring 5′-UTR1 (−514/−1) or 5′-UTR2 (−243/−1) fused to a dual expression fragment (uORF5^(HA)-A_2AR^(V5)) that encodes both the uORF5 (uORF5^(HA)) and A_2AR (A_2AR^(V5)) proteins. The HA sequence (YPYDVPDYA) was inserted in-frame with the C terminus of uORF5 (+2 reading frame) but not with A_2AR (+1 reading frame). The V5 sequence (GKPIPNPLLGLDST) was cloned in-frame with the C terminus of A_2AR. PC12 cells were transiently transfected with the indicated constructs for 48 h. B, cells were harvested to analyze the protein levels of A_2AR and uORF5 by Western blot analysis (WB). The A_2AR and uORF5 protein levels were normalized to that of actin (loading control). C, cells were collected for RNA preparation. The level of the Adora2a transcript was determined by RT-qPCR and normalized to gapdh (reference gene). ***, p < 0.001, cells transfected with 5′-UTR1-uORF5^(HA)-A_2AR^(V5) versus 5′-UTR2- uORF5^(HA)-A_2AR^(V5). The values represent the means ± S.E. (error bars) of at least three independent experiments.

uORF5 Suppresses AP1-mediated Promoter Activity

We next characterized the function of uORF5. Functional annotation of the uORF5 protein using LALIGN suggests that uORF5 shares 31.5% aa identity with the N terminus (aa 1–89) of c-Fos, where an activation domain (HOB1-N) is known to reside (Fig. 5A) (45). To examine whether uORF5 modulates transcription, we subcloned the coding sequence of uORF5 (−62 to +340) into the pFA-CMV vector so that uORF5 was fused to the C terminus of the GAL4 DNA-binding domain (DBD) (23). Cotransfection of the resultant construct (pFA-CMV-DBD:uORF5) with a GAL4-responsive luciferase reporter in the striatal progenitor cell line ST14A showed that DBD:uOF5, when compared with DBD alone, markedly suppressed the GAL4 promoter activity (Fig. 5B). Thus, uORF5 might possess the ability to regulate the transcription machinery. Given its similarity to the N terminus of c-Fos, we next assessed whether uORF5 modulates the activity of AP1 (i.e. the c-Fos·c-Jun complex) (46). Consistent with the above finding, the expression of uORF5 suppressed the activity of the AP1, but not the CRE or p21, luciferase reporter in ST14A cells (Fig. 5C). To confirm whether uORF5 modulates AP1 activity, PC12 cells were treated with NGF to activate AP1 (47). Promoter analyses showed that NGF enhanced the promoter activities mediated by AP1, CRE, and p21 in PC12 cells (data not shown). The elevated expression of uORF5 selectively reduced the NGF-induced AP1-mediated, but not the CRE- or p21-mediated, promoter activity (Fig. 5D). Collectively, these data suggest that uORF5 might, at least partially, function as a modulator of AP1-dependent transcription.

FIGURE 5.

uORF5 suppressed AP1-mediated promoter activity. A, alignment of uORF5 and the N terminus (aa 1–105) of rat c-Fos (XP_234422). B, ST14A cells were transfected with vectors encoding the GAL4 DBD or the chimeric DBD:uORF5 protein, a firefly luciferase reporter gene driven by five copies of the GAL4-binding element, and a thymidine kinase promoter-driven Renilla luciferase (as an internal control) for 48 h. The activity of firefly luciferase was measured and normalized to that of Renilla luciferase. ***, p < 0.001, cells with transfected DBD versus DBD-uORF5. C, cells were cotransfected with the uORF5 expression construct or the empty pcDNA3.1 vector and a firefly luciferase reporter driven by six copies of AP1 (AP1-LUC), three copies of CRE (CRE-LUC), or the p21 promoter (p21-LUC) plus an internal control (thymidine kinase promoter-driven Renilla luciferase) at a molar ratio of 5:4:1 for 48 h. The indicated firefly luciferase activity was normalized to the activity of Renilla luciferase. ***, p < 0.001, cells transfected with empty vector versus uORF5. D, PC12 cells were cotransfected with the uORF5 expression construct or the empty pcDNA3.1 vector and AP1-LUC, CRE-LUC, or the p21-LUC plus thymidine kinase promoter-driven Renilla luciferase (as an internal control) for 48 h. The cells were then treated with or without NGF (100 ng/ml) as indicated for 12 h. The AP1-, CRE-, and p21 promoter-mediated expression of firefly luciferase was normalized to the activity of Renilla luciferase. Relative activities of the indicated promoter in the NGF-treated cells to the non-treated cells are shown. *, p < 0.05, cells transfected with empty vector versus uORF5. E, PC12 cells were transiently transfected with hrGFP or uORF5:hrGFP for 48 h. The transfected cells were sorted for the expression of hrGFP and harvested for RNA preparation. The expression of the selected genes was measured by RT-qPCR and normalized to that of gapdh (reference gene). *, p < 0.05; **, p < 0.01, cells transfected with empty vector versus uORF5. The values represent the means ± S.E. (error bars) of at least three independent experiments.

To identify the potential downstream targets of uORF5, microarray gene profiling was performed to identify the genes whose expression was altered in the presence of uORF5. Striatal progenitor cells (STHdh^Q7) were transfected with hrGFP or uORF5:hrGFP for 48 h. The transfected cells were sorted by the expression of hrGFP using flow cytometry and then harvested for RNA preparation and gene profiling by microarray. In three independent experiments, uORF5 altered the expression of only a small number of genes (Table 3). Of the 12 genes selected for further analyses, RT-qPCR was used to validate that the expression levels of five genes (Pdzd2, Lrrn3, Spag9, Rshl1, and Rasal2) were decreased by the expression of uORF5 in the STHdh^Q7 cells (Table 3). Except for Spag9, which was not detected in the PC12 cells, the overexpression of uORF5:hrGFP in PC12 cells also led to the suppression of the previously mentioned uORF5-responsive genes (Pdzd2, Lrrn3, Rshl1, and Rasal2) when compared with cells expressing hrGFP alone (Fig. 5E). Literature mining suggests that these four uORF5-responsive genes might be involved in the regulation of the MAPK pathway (48–52).

TABLE 3.

Overexpression of uORF5-altered gene expression profiles in STHdh^Q7 cells

STHdh^Q7 cells were transfected with an uORF5:hrGFP or hrGFP expression construct for 48 h. The transfected cells were sorted by flow cytometry and harvested for RNA preparation. The RNA was analyzed by microarray and RT-qPCR. Twelve genes whose expression was altered at least ±1.5-fold in two of the three independent microarray experiments were selected for further verification using RT-qPCR. The data are the means ± S.E. of three independent experiments.

Gene	Gene symbol	GenBankTM accession no.	Microarray 1 decrease	Microarray 2 decrease	Real-time PCR
			%	%
β2-Microglobulin precursor	B2m	AK019389	−51.7	−42.6	4.9 ± 10.2
c-Jun-amino-terminal kinase-interacting protein 4	Spag9	AK147431	−59.0	−36.7	−18.4 ± 3.2a
Deoxycytidine kinase	Dck	BC060062	−64.0	−50.7	−2.6 ± 7.3
Growth arrest-specific protein 1 precursor	Gas1	AI595188	−44.2	−33.2	−14.3 ± 8.4
Kinesin-like protein KIF2A	Kif2a	AC154257	−55.3	−35.5	−15.1 ± 8.6
Leucine-rich repeat neuronal protein 3	Lrrn3	AC167364	−63.5	−41.7	−20.6 ± 7.4b
Nucleophosmin 1	Npm1	CA540276	−47.4	−49.4	−7.6 ± 0.0
PDZ domain-containing 2	Pdzd2	AC133282	−68.1	−60.8	−18.7 ± 4.5b
RAS protein activator-like 2	Rasal2	AC119220	−48.6	−40.9	−21.9 ± 5.5b
Radial spoke head-like protein 1	Rshl1	AC170864	−56.6	−52.2	−25.2 ± 11.2b
Thrombospondin-1 precursor	Thbs1	AL845495	251.4	224.1	−0.9 ± 9.2
Trinucleotide repeat-containing gene 6B protein	Tnrc6b	AC125540	−48.9	−73.1	−20.1 ± 10.8

^a p < 0.01, cells transfected with uORF5:hrGFP versus hrGFP.

^b p < 0.05, cells transfected with uORF5:hrGFP versus hrGFP.

A_2AR Activation Increases the Expression of the uORF5 Protein

To investigate whether the uORF5 and A_2AR proteins, which are translated from the Adora2a transcript, are functionally related, we activated A_2AR in PC12 cells using an A_2AR agonist (CGS) for 1–6 h and analyzed the protein levels of A_2AR and uORF5 using a Western blot analysis. The activation of A_2AR did not affect the level of the A_2AR protein during the period of time tested, but it greatly elevated the level of the uORF5 protein (Fig. 6A). Although the level of the Adora2a transcript was also slightly enhanced, the increases in the Adora2a transcript and the A_2AR protein were much lower than that of the uORF protein (Fig. 6B). For example, when compared with those of the control (non-treated) cells (100%), the levels of the Adora2a transcript, A_2AR protein, and uORF5 protein after a 3-h treatment with CGS were 150.1 ± 13.3, 129.2 ± 11.8, and 359.6 ± 56.7% (mean ± S.E., three independent experiments), respectively. This enhancing effect of CGS on uORF5 was mediated by A_2AR because it was found to be blocked by Sch58261 (Sch), an A_2AR-selective inhibitor (Fig. 6C). Because stimulation of the A_2AR is known to activate adenylyl cyclase and the cAMP/PKA pathway, we tested whether inhibition of PKA using H89 or KT5720 affected the enhancing effects of CGS on the uORF5 protein and Adora2a mRNA using an RT-qPCR and Western blot analysis. As shown in Fig. 6, C and D, H89 and KT5720 effectively prevented the enhancing effects of CGS, suggesting that activation of A_2AR increased the protein level of uORF5 and the A_2AR mRNA level of A_2AR through a PKA-dependent pathway.

FIGURE 6.

Activation of A_2AR leads to increased expression of the uORF5 protein. A and B, PC12 cells were pretreated with adenosine deaminase (ADA; 1 unit/ml) for 6 h and then treated with CGS (100 nm) for the indicated periods of time. A, Total cell lysates were harvested for the measurement of A_2AR and uORF5 by Western blot analysis. B, The levels of the A_2AR and uORF5 proteins were normalized to that of actin (loading control). Total RNA was collected for the determination of the Adora2a mRNA level by RT-qPCR. The level of Adora2a mRNA was normalized with that of gapdh (reference gene). *, p < 0.05; **, p < 0.01, compared with the control (0 h). C and D, PC12 cells were pretreated with adenosine deaminase for 6 h, incubated with or without the indicated inhibitor (H89, 1 μm; KT5720, 1 μm; Sch58261, 1 μm) for 1 h, and then treated for 3 h with CGS (100 nm). C, total cell lysates were harvested for the measurement of uORF5 protein by Western blot analysis. D, the uORF5 protein level was normalized to that of actin (loading control). Total RNA was collected for the determination of the Adora2a mRNA level by RT-qPCR. The level of Adora2a mRNA was normalized with that of gapdh (reference gene). ***, p < 0.001; **, p < 0.01. E, to evaluate the stability of the uORF5 protein, PC12 cells were transfected with uORF5-V5 for 48 h. The transfected cells were pretreated with adenosine deaminase for 6 h and treated with CGS or FK for 1 h. Cycloheximide (100 μg/ml) was then added to the medium to block protein synthesis. Total lysates were collected at the indicated times. The level of uORF5-V5 was measured by Western blot analysis and normalized with that of α-tubulin (internal control). The values represent the means ± S.E. (error bars) of at least three independent experiments.

To validate that PKA regulates uORF expression, we next tested whether activation of PKA through the direct stimulation of adenylyl cyclase using FK altered the protein level of uORF5. After a 3-h incubation, FK dose-dependently increased expression levels of the uORF5 protein, A_2AR protein, and Adora2a mRNA (Fig. 7, A and B). At a low dosage of FK (1 μm), only the uORF5 protein was enhanced. No effect on levels of the A_2AR protein or Adora2a mRNA was found. However, at a high dosage of FK (10 μm), slight increases in levels of Adora2a mRNA and the A_2AR protein were detected. When compared with those of control (non-treated) cells (100%), levels of the Adora2a transcripts, A_2AR protein, and uORF5 protein after a 3-h treatment with FK at 10 μm were 143.9 ± 8.2, 140.7 ± 9.1, and 382.1 ± 23.2% (mean ± S.E., three independent experiments), respectively. Such enhancing effects of FK at 3 μm were mediated by PKA because they were blocked by both H89 and KT5760 (Fig. 7, C and D). In addition, we showed that neither CGS nor FK enhanced the protein level of uORF5 in a PKA-deficient PC12 mutant (A123 cells; Fig. 7E), further suggesting that PKA mediates expression of the uORF5 protein.

FIGURE 7.

PKA regulates expression of the uORF5 protein. A and B, PC12 cells were pretreated with adenosine deaminase (ADA; 1 unit/ml) for 6 h and then treated with FK of the indicated concentration. A, total cell lysates were harvested for the measurement of A_2AR and uORF5 protein by Western blot analysis. B, levels of the A_2AR and uORF5 proteins were normalized to that of actin (loading control). Total RNA was collected for the determination of the Adora2a mRNA level by RT-qPCR. The level of Adora2a mRNA was normalized with that of gapdh (reference gene). *, p < 0.05; **, p < 0.01; ***, p < 0.001, compared with the control (0 μm). C and D, PC12 cells were pretreated with adenosine deaminase for 6 h, incubated with or without the indicated inhibitor (H89, 10 μm; KT5720, 1 μm) for 1 h, and then treated for 3 h with FK (3 μm). C, total cell lysates were harvested for the measurement of uORF5 protein by Western blot analysis. D, the uORF5 protein level was normalized to that of actin (loading control). Total RNA was collected for the determination of the Adora2a mRNA level by RT-qPCR. The level of Adora2a mRNA was normalized with that of gapdh (reference gene). ***, p < 0.001; **, p < 0.01. E, A123 cells were pretreated with adenosine deaminase for 6 h and then treated with the indicated drug (CGS, 100 nm; FK, 3 μm). Total cell lysates were harvested for the measurement of uORF5 protein by Western blot analysis. The uORF5 protein level was normalized to that of actin (loading control). The data are the means ± S.E. (error bars) of at least three independent experiments.

To determine whether A_2AR increases the level of the uORF5 protein by altering its stability, uORF5-V5 was exogenously expressed in PC12 cells treated with CGS or FK, as indicated. The stability of the uORF5 protein was determined by treating the cells with cycloheximide (100 μg/ml) to block new protein synthesis. The protein level of uORF5 was assessed by Western blot analysis and normalized to that of α-tubulin (internal control). As shown in Fig. 6E, uORF5 has a short half-life of ∼1 h. The protein degradation curves of the uORF5 protein in all of the conditions tested were similar, suggesting that the activation of A_2AR or the PKA pathway did not affect the protein stability of uORF5. Therefore, the enhancing effect of A_2AR signaling on the uORF protein is likely to occur at the post-translational level.

DISCUSSION

Other than the rat Adora2a gene, only three other dual coding genes containing alternative reading frames have been reported to date (7, 8, 53). For these three genes, a novel protein product was found to be translated from a transcript that was initially identified for the translation of another protein. For example, Klemke et al. (7) demonstrated that the rat XLαs gene encodes the extra large Gα subunit (XLαs) and a structurally irrelevant protein (ALEX), which is translated from the downstream +1 reading frame of the same mRNA. Intriguingly, ALEX can bind to the XL-domain of XLαs and, therefore, might regulate the function of XLαs. Another well characterized example is the PRNP gene. This gene encodes the prion protein (PrP) and the AltPrP protein that is translated from the +3 frame. AltPrP is detected in the mitochondria of human astrocytoma cell line U-118 and is up-regulated by endoplasmic reticulum stress and proteasomal inhibition (8). No functional interaction between the PrP and AltPrP proteins has been reported. During the preparation of this manuscript, a new dual coding gene (ATXN1) containing alternative reading frames was reported (53). The newly identified Alt-ATXN1 protein is translated from a downstream AUG (+3 frame) of the ATXN1 gene and functions as a novel interacting protein of the ATXN1 protein. In the present study, we showed that the rat Adora2a gene encodes a novel protein (uORF5) using a frame that differs from that used for the A_2AR protein (Fig. 1). The expression of uORF5 was detected in rat tissues where the Adora2a transcript is markedly expressed (Fig. 3C) and under conditions in which Adora2a is up-regulated (e.g. hypoxia) (Fig. 3F). In addition, an ORF for a similar mouse uORF5 protein, which shares 84% aa identity with rat uORF5, was detected in the mouse Adora2a gene. In the human and chimpanzee genomes, the ORF for a shorter uORF5-like protein, which shares 75% aa identity with rat uORF5, was also detected. These uORF5-like proteins in humans and chimpanzees might use an AUG codon, which is flanked by a weak Kozak sequence (39) and is located downstream of the start codon of the A_2AR protein (Figs. 1C and 2). The strength of the Kozak sequence is not a concern because ALEX, one of the two proteins encoded by the dual coding gene XLαs/Gαs, is known to be translated from a downstream AUG codon without an optimal Kozak sequence (7). It was proposed that when the first AUG is surrounded by a weak Kozak motif, the second AUG (with or without an optimal Kozak sequence) can be used to initiate protein translation due to leaky scanning (54). This is important because the AUG of the human A_2AR protein is flanked with an imperfect Kozak sequence (Fig. 2). To determine whether the human uORF5-like protein exists in vivo would require additional tools (e.g. a specific antibody) and is certainly worth further investigation. These uORF5-like proteins from other species are likely to possess functions that are similar to that of the rat uORF5 protein due to their high homology with rat uORF5 (75–84% aa identity). These dual coding genes provide a new layer of complexity and plasticity in eukaryotic proteomes (55).

Database annotations of mammalian genomes suggest that the number of dual coding genes is higher than has been reported (9–11). Specifically, Ribrioux et al. (11) identified 217 potential dual coding genes, which have Kozak sequences located at their start codons and are conserved among the human, mouse, and rat genomes. It would be of great interest to further evaluate whether the proteins translated from these predicted dual coding genes exist in vivo. The functional interaction between two structurally irrelevant proteins that are translated from the same transcript, as demonstrated for the XLαs/ALEX gene (7) and the A_2AR/uORF5 gene (Fig. 6), suggest that these dual coding genes might serve as tightly orchestrated sets of signals for the regulation of cellular functions. For example, through a PKA-dependent pathway (Figs. 6 and 7), the activation of A_2AR increases the expression of the uORF5 protein, which, in turn, regulates the expression of a set of genes (Spag9, Lrrn3, Rasal2, and Rshl1) that are involved in the MAPK pathway (Fig. 5E and Table 3). Specifically, Spag9 is associated with c-Jun NH₂-terminal kinases and may participate in the activation of the p38 MAPK pathway (49). The overexpression of Lrrn3 promotes the epidermal growth factor-induced phosphorylation of MAPK (48). Rasal2 is highly homologous to the GTPase-activating protein-related domain of Ras GTPase-activating proteins, which regulate the activation of Ras and are involved in the Ras-MAPK pathway (52, 56). Rshl1 inhibits the activation of ERK1/2 kinase during cell cycle progression (51). These data suggest that uORF5 may serve as a novel signaling molecule that mediates, at least in part, the functions of A_2AR. Because the uORF5 and A_2AR proteins are translated from the same transcript, we were not able to specifically down-regulate the expression of uORF5 without affecting the level of the A_2AR protein using the standard siRNA approach to test the above hypothesis. Given that the uORF5 protein shares more than 30% amino acid identity with the activation domain of c-Fos (Fig. 5A), the potential role of A_2AR/uORF5 in the regulation of gene transcription mediated by the c-Fos-containing AP1 complex is of great interest. A number of earlier studies showed that the activation of A_2AR alters the level of c-Fos and, therefore, might affect AP1-mediated gene expression in the brain in a spatially dependent manner (57–59). Further investigation is required to determine whether uORF5 contributes to the modulation of AP1 activity by A_2AR in vivo.

The mechanism by which A_2AR/PKA increases the level of the uORF5 protein (Fig. 6C) is currently unknown. Because the stability of the uORF5 protein was not affected by PKA (Fig. 6E) and because the enhanced level of the Adora2a transcript was not sufficient to account for the marked enhancement of the uORF5 protein during A_2AR activation (Fig. 6B), we reasoned that the activation of PKA might increase the translation of uORF5. The alternative usage of start codons present on the same transcript (60, 61) probably does not contribute to the selective enhancement of the uORF protein because the level of the A_2AR protein was not significantly affected (Fig. 6B). For the very same reason, the PKA-mediated increase in the length of the poly(A) tail (62) is unlikely to be the cause for the increase in the uORF protein level. One interesting possibility is the alternative usage of the two A_2AR promoters (P1 and P2), which produce different 5′-UTRs (5′-UTR1 and 5′-UTR2) in the Adora2a transcript (20). However, the expression level of 5′-UTR1 is much lower than that of 5′-UTR2 in PC12 cells, as demonstrated in our previous study (20). Therefore, a promoter switch from P1 to P2 probably does not contribute to the increase in the uORF5 protein by A_2AR activation either. Further experiments are needed to delineate the regulation of uORF5 by A_2AR-mediated cAMP signaling.

Our findings suggest that uORF5 plays a fine-tuning role because the elevated expression of uORF5 only moderately reduced the expression of its target genes (Fig. 5E and Table 3). Moreover, uORF5-mediated A_2AR signaling is likely to function in tissues where the Adora2a transcript is highly expressed (e.g. the striatum) (Fig. 3C) (63) or under conditions in which the Adora2a transcript is significantly up-regulated (e.g. hypoxia) (Fig. 3F) (22). In addition to hypoxia, the expression of Adora2a mRNA is also highly elevated during inflammation (21). It has been well documented that the activation of A_2AR suppresses inflammation in peripheral blood mononuclear cells and neutrophils (18, 64, 65). Because the expression of uORF5 is up-regulated during A_2AR activation (Fig. 6), it is very likely that uORF5 is expressed in these inflamed cells and contributes to the anti-inflammatory effect of A_2AR. Our findings suggest that the rat Adora2a gene encodes not only A_2AR but also a transcriptional regulator, uORF5, in response to A_2AR stimulation (Fig. 5); provide novel insights into our current understanding of the function of A_2AR; and suggest the utility of future investigations into the potential dual coding genes in the mammalian genome.