In Table 1, regarding the allele op468, the correct breakpoints are as follows:
5': AAATCAATATTTCAGCAATCG
3': AAGAGTTCATTTAGCTGTAT
Footnotes
Competing Interests: No competing interests declared.
. 2014 Jan 17;9(1):10.1371/annotation/439d7826-5008-437d-9b41-5afb31c704a1. doi: 10.1371/annotation/439d7826-5008-437d-9b41-5afb31c704a1
Correction: A Network of HSPG Core Proteins and HS Modifying Enzymes Regulates Netrin-Dependent Guidance of D-Type Motor Neurons in Caenorhabditis elegans
Stephan Gysi
, Christa Rhiner
, Stephane Flibotte
, Donald G Moerman
, Michael O Hengartner
Stephan Gysi
Find articles by Stephan Gysi
Christa Rhiner
Find articles by Christa Rhiner
Stephane Flibotte
Find articles by Stephane Flibotte
Donald G Moerman
Find articles by Donald G Moerman
Michael O Hengartner
Find articles by Michael O Hengartner
Collection date 2014.
© 2014 Public Library of Science
This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are properly credited.
PMCID: PMC3897310
This corrects the article "A Network of HSPG Core Proteins and HS Modifying Enzymes Regulates Netrin-Dependent Guidance of D-Type Motor Neurons in Caenorhabditis elegans
" in volume 8, e74908.