Abstract
Background
The Chinese population has undergone rapid transition to a high-fat diet. Furthermore, monosodium L-glutamate (MSG) is widely used as a daily food additive in China. Little information is available on the effects of oral MSG and dietary fat supplementation on the amino acid balance in tissues. The present study aimed to determine the effects of both dietary fat and MSG on amino acid metabolism in growing pigs, and to assess any possible interactions between these two nutrients.
Methods and Results
Four iso-nitrogenous and iso-caloric diets (basal diet, high fat diet, basal diet with 3% MSG and high fat diet with 3% MSG) were provided to growing pigs. The dietary supplementation with fat and MSG used alone and in combination were found to modify circulating and tissue amino acid pools in growing pigs. Both dietary fat and MSG modified the expression of gene related to amino acid transport in jejunum.
Conclusions
Both dietary fat and MSG clearly influenced amino acid content in tissues but in different ways. Both dietary fat and MSG enhance the absorption of amino acids in jejunum. However, there was little interaction between the effects of dietary fat and MSG.
Introduction
As an umami flavor, monosodium L-glutamate (MSG) has been widely used as a food additive. The worldwide production and consumption of MSG has recently increased, and it is even expected to further increase in the next years (http://www.ihs.com/products/chemical/planning/ceh/monosodium-glutamate.aspx). MSG is considered as safe among food additives by the Joint Expert Committee on Food Additives of the United Nations Food and Agriculture Organization and World Health Organization [1]. When MSG is consumed, L-glutamate (Glu) is released in the small intestine lumen and metabolized notably by the enterocytes [2]. The regular daily consumption of MSG presumably modify the metabolism of nutrients, notably the metabolism of AAs in the body [3], and protein synthesis regulation and proteolysis [4], [5]. Only few studies have reported the effects of daily oral MSG supplementation on AA metabolism.
The Chinese population, including children and adolescents, has been undergoing a rapid transition to a high-fat diet. This change has occurred faster than that in western children over the last century [6], [7]. MSG is also currently widely added to food on a daily basis in China. Thus, it would be interesting to evaluate the metabolic effects of the combination of dietary fat and MSG. Pigs are considered to be a suitable animal model for studying human nutrition due to their apparent similarities with humans; i.e., both species are omnivorous, and they share nutritional and digestive characteristics [8]. In the present study, MSG was provided to growing pigs at a dose that was only slightly higher than that found in human food, without or with a plausible amount of dietary fat content. The aim of the present study was to determine the effect of dietary supplementation with MSG on the AA balance in tissues and to clarify whether the interaction between fat and MSG influence AA metabolism.
Methods and Materials
Experimental design, animals, and diets
Since rodents may be more sensitive to MSG than humans [9], the pig model was used in the present study. A total of 32 growing pigs (crossbred population composed of York, maternal Landrace, paternal Landrace, and Duroc breeds; average body weight 25±1.3 kg) from 4 litters in a pig farm located in Changsha were used. The pigs were randomly divided into four groups (8 animals per group with half males and half females). Pigs were raised in individual cages and provided with water and four different diets containing different amounts of fat and MSG (basal diet, high fat diet, basal diet with 3% MSG and high fat diet with 3% MSG). The basal diet group was used as control. According to previous experiments [10], the four diets were prepared to be iso-caloric and alanine was used to allow iso-nitrogenous content of all diets [11], [12]. The dose of MSG and dietary fat contents were designed according to the NRC 1998 and the consumption in human food. The detailed composition of the four diets are shown in Table 1 . The total AAs in each diet were determined and the results are shown in Table 2 . The four diets were provided to the pigs ad libitum. In the day time, natural light was provided, and in the dark period, fluorescent lamps were used and turned down at 8:00 pm. Water was provided freely during the entire experiment. Blood samples were firstly collected into 10-mL heparin-coated tubes, and then centrifuged (3,000×g for 10 min at 4°C). The supernatants (plasma) were immediately separated and stored at −70°C until analysis. The sampled pigs were sacrificed by jugular puncture under general anaesthesia via the intravenous injection of 4% sodium pentobarbital solution (40 mg/kg BW) and immediately eviscerated. Samples of the longissimus dorsi, liver, kidney and segments of the intestine including the duodenum, jejunum, ileum and colon (cleaned by ice-cold normal saline) were collected, immediately frozen in liquid nitrogen and stored at −70°C until analysis. All experimental procedures used in the present study were approved by the Animal Care and Use Committee of the Chinese Academy of Sciences [13].
Table 1. Composition of experimental diets.
Item | Basal diet (BD) | High fat diet (HF) | Basal diet + 3% MSG (BDM) | High fat diet + 3% MSG (HFM) |
Ingredient composition (%) | ||||
Corn | 71.37 | 59.80 | 70.30 | 59.58 |
Soybean meal | 19.20 | 21.27 | 16.80 | 21.50 |
Corn starch | 0.00 | 7.00 | 0.00 | 5.00 |
Corn Gluten Meal | 5.00 | 2.50 | 7.00 | 3.10 |
MSG | 0.00 | 0.00 | 3.00 | 3.00 |
Alanine | 1.58 | 1.58 | 0.00 | 0.00 |
L-Lysine monohydrochloride | 0.15 | 0.15 | 0.20 | 0.12 |
Soybean oil | 0.00 | 5.00 | 0.00 | 5.00 |
Premixa | 2.70 | 2.70 | 2.70 | 2.70 |
Calculated analysis | ||||
DE, Mj/kg | 13.98 | 13.92 | 13.87 | 13.98 |
CP, % | 17.93 | 17.88 | 17.95 | 17. 91 |
Fat, % | 4.35 | 9.39 | 4.51 | 9.45 |
Ca, % | 0.60 | 0.59 | 0.58 | 0.59 |
P, % | 0.45 | 0.48 | 0.44 | 0.46 |
Composition (%): CaHPO4, 27.78; Mountain flour, 24.07; NaCl, 11.11; Medical stone, 12.33; Powdered rice hulls, 18.81; FeSO4, 0.74; ZnSO4, 0.74; Selenium powder (1%), 0.15; Iodine powder (1%), 0.15; CuSO4, 0.37; MnSO4, 0.30; Choline chloride, 2.22; Growth pig multidimensional, 1.11; Antioxidants (Ethoxyquin 66%), 0.11.
Table 2. Analyzed AA composition of the experimental diets (%, as-fed basis).
Item | Treatment | |||
BD* | HF* | BDM* | HFM* | |
Indispensable AAs | ||||
Arginine (Arg) | 1.25 | 1.00 | 1.01 | 1.01 |
Histidine (His) | 1.28 | 1.32 | 1.06 | 1.04 |
Isoleucine (Ile) | 0.80 | 0.63 | 0.61 | 0.65 |
Leucine (Leu) | 1.82 | 1.70 | 1.49 | 1.56 |
Lysine (Lys) | 0.73 | 0.60 | 0.56 | 0.55 |
Phenylalanine (Phe) | 0.83 | 0.88 | 0.77 | 0.84 |
Threonine (Thr) | 1.17 | 1.01 | 0.78 | 0.82 |
Tyrosine (Tyr) | 0.49 | 0.54 | 0.52 | 0.54 |
Valine (Val) | 0.96 | 0.84 | 0.76 | 0.75 |
Dispensable AAs | ||||
Alanine (Ala) | 2.26 | 1.90 | 0.82 | 0.91 |
Aspartate (Asp) | 1.24 | 1.31 | 1.03 | 1.17 |
Glutamate(Glu) | 2.53 | 2.55 | 3.61 | 4.09 |
Glycine (Gly) | 0.77 | 0.88 | 0.73 | 0.83 |
Proline (Pro) | 3.63 | 3.69 | 3.30 | 3.81 |
Serine (Ser) | 1.16 | 1.27 | 0.88 | 0.98 |
Abbreviations: BD, Basal diet; HF, High fat diet; BDM, Basal diet +3% monosodium L-glutamate; HFM, High fat diet +3% monosodium L-glutamate.
Serum analyses
Plasma total concentrations of albumin, alanine transaminase, aspartate aminotransferase, γ-glutamyl transpeptidase, creatine kinase, total protein and serum urea were determined with an automatic analyzer (Beckman Instruments, Inc., Fullerton, CA) using reagents purchased from Beijing Leadman Biochemistry Co., LTD.
Determining of AA concentrations using the stable isotope dilution HPLC–electrospray ionization (ESI)–MS/MS method
To determine contents of AAs in experimental diet, 5 g samples of diets were dissolved in hydrochloric acid solution (6 mol/L) at a concentration equal to 20 mg/ml, and hydrolized for 24 h, before centrifugation at 13200 rpm for 5 min. The supernatants were filtered with hydrophilic membrane, diluted 40 folds with methanol, and then were dried under nitrogen at 50°C. The samples were finally dissolved in 100 µl methanol solution (v/v = 1∶1) for the derivatization procedure. Ten µl of the extracted solution were transferred to a new centrifuge tube, and mixed with 90 µl of the stable isotope solution (the stable isotope being dissolved with methanol), vortexed and then centrifuged at 13,200 rpm for 5 min. The supernatants were transferred into a new centrifuge tube, dried under nitrogen at 50°C, mixed with 60 µl Hydrochloric acid/n-butyl alcohol derivative liquid, vortexed and then centrifuged at 13,200 rpm for 5 min. The supernatants were transferred into a new centrifuge tube and kept at 65°C for 15 min, dried under nitrogen at 50°C, and dissolved in 100 µl acetonitrile solution (v/v = 4∶1), vortexed and then centrifuged at 13,200 rpm for 5 min. The supernatants were used for the analysis of AAs by LC/mass spectrometer (HPLC Ultimate 3000, Dionex; 3200 Q TRAP LC-MS/MS, AB) with gas chromatography using a capillary column (AAA C18 5 µM 150×4.6 mm). The column temperature was 50°C. The sample size was 10 µl. The other parameters were as follows: moving phase (A: 1% formic acid solution, B: 1% formic acid dissolved with acetonitrile); CUR, 20.00; CAD, Medium; CXP, 5.00; IS, 5500.00; DP, 35.00; GS1, 55.00; GS2, 60.00; TEM, 580.00; EP, 10.00. The mass spectrometry detection gradient solutions were as follow: Step 0: time, 0 min; Flow rate, 800; A (%), 98; B (%), 2. Step 1: time, 10 min; Flow rate, 800; A (%), 72; B (%), 28. Step 2: time, 10.1 min; Flow rate, 800; A (%), 0; B (%), 100. Step 3: time, 16 min; Flow rate, 800; A (%), 0; B (%), 100. Step 4: time, 16.1 min; Flow rate, 800; A (%), 98; B (%), 2. Step 5: time, 25 min; Flow rate, 800; A (%), 98; B (%), 2. The determination of free AA concentrations in tissues was done using the method described above but without the steps of acidolysis. The whole processing was done in Beijing Amino Medical Research CO., LTD.
Quantitative real-time reverse transcription-polymerase chain reaction
Total RNA was extracted from samples using TRIzol® Reagent (Invitrogen-Life Technologies, CA, USA) following the manufacturer's suggested protocol and finally dissolved in DEPC-treated water. Quality and concentration of the extracted RNA were checked by spectrophotometry using NanoDrop® ND2000 (NanoDrop Technologies Inc., DE, USA), respectively. Then, 1.0 µg of total sample RNA was incubated with DNase I (Fermentas), and reverse-transcribed with oligo dT and random primers using reverse transcription using First-Strand cDNA Synthesis Kit according to the manufacturer's instructions (TAKARA, Dalian, China). Finally, the cDNAs were stored at −70°C before further processing. qPCR was performed with an ABI PRISM 7900 HT (Applied Biosystems, USA) using 384-well plates. Duplicate sample analysis was routinely performed in a total volume of 10 µl using SYBR®Premix Ex TaqTM II (TAKARA, Dalian, China). The primers were designed using Primer 5.0 software and be listed in Table 3. Data were analyzed using the ABI 7900 SDS software (version 2.3, Applied Biosystems).
Table 3. Primers used in this study.
Gene | Gene Bank NO. | Sequence | Product length | Reference |
β-ACTIN | XM_003357928.1 | Sense: 5′ GGACTTCGAGCAGGAGATGG 3′Anti-sense: 5′ GCACCGTGTTGGCGTAGAGG 3′ | 233 bp | In this study |
CaR | XM_003132642.1 | Sense: 5′ GGGACCAGGAAAGGAATCAT 3′Anti-sense: 5′ CACGGCAAAGAGGGTGAGT 3′ | 219 bp | In this study |
GPRC6A | XM_003480266.1 | Sense: 5′ CTTGAGAAAATCATAGCAGAAGCC 3′Anti-sense: 5′ GGAATGGTAGTTATCTTGGTGGC 3′ | 161 bp | In this study |
T1R1 | XM_003356140.1 | Sense: 5′ TCCCTGGGCTTCATACTGG 3′Anti-sense: 5′ TTCTCTGGCAAGTCCTTACCC 3′ | 92 bp | In this study |
EAAC1 | NM_001164649.1 | Sense: 5′ GGCACCGCACTCTACGAAGCA 3′Anti-sense: 5′ GCCCACGGCACTTAGCACGA 3′ | 177 bp | In this study |
LAT1 | NM_001110421.1 | Sense: 5′ TTTGTTATGCGGAACTGG 3′Anti-sense: 5′ AAAGGTGATGGCAATGAC 3′ | 155 bp | In this study |
B0,+ | NM_001110171.1 | Sense: 5′ GAACCCAAGACCACAAATC 3′Anti-sense: 5′ ACCCAGTGTCGCAAGAAT 3′ | 180 bp | In this study |
ASCT2 | XM_003127238.1 | Sense: 5′ GATTGTGGAGATGGAGGATGTGG 3′Anti-sense: 5′ TGCGAGTGAAGAGGAAGTAGATGA 3′ | 128 bp | In this study |
PEPT1 | NM_214347.1 | Sense: 5′ CATCGCCATACCCTTCTG 3′Anti-sense: 5′ TTCCCATCCATCGTGACATT 3′ | 143 bp | In this study |
Statistical analyses
The data regarding gene expression were expressed as means ± SEM, and those regarding AA concentrations were expressed as means ± SD. Differences between groups were assessed by ANOVA. Statistical analyses were performed with SAS 9.2 (SAS Institute Inc., North Carolina, USA). The difference were considered as statistically significant at P<0.05.
Results
MSG and fat modify serum biochemical parameters
Serum albumin was firstly tested, and the results are shown in Fig. 1A . Dietary fat clearly increased the serum albumin concentration (p = 0.0228), while MSG had no effect, and there was no interaction between the effect of dietary fat and MSG on serum albumin. To clarify the changes in AA metabolism, the activities of serum alanine transaminase and aspartate aminotransferase were measured, and the results are shown in Fig. 1B and Fig. 1C . Dietary fat significantly reduced the activity of aspartate aminotransferase (p<0.0001). Dietary fat and MSG synergistically reduced the activities of serum alanine transaminase (p = 0.0510) and aspartate aminotransferase (p = 0.0359). There were no significant differences between treatments for the other serum biochemical parameters, including creatine kinase, total protein and serum urea.
Figure 1. Dietary fat and MSG supplementation for one month effect the concentrations of serous biochemical parameters in growing pigs (n = 8).
Abbreviation, ALB: Albumin, ALT: Alanine transaminase, AST: Aspartate aminotransferase.
MSG and fat modify serum AA profiles
Serum is the main circulating AA pool and the serum AA profile is often used as an index for the diagnosis of several diseases [14]. To determine the effects of fat and MSG on serum AAs, the AA profile was measured and the results are shown in Table 4 . Dietary fat clearly reduced the concentrations of Thr (p = 0.0212), Val (p = 0.0246), Tyr (p = 0.0022), Cit (p = 0.0378), Gln (p = 0.0224), Orn (p = 0.0013) and Ala (p = 0.0100), while elevated the concentration of Gly (p = 0.0393). MSG obviously lessen the concentrations of 3-methyl-histidine (3MHis) (p = 0.0242), while increasing the concentrations of Hyp (p = 0.0322). Dietary fat and MSG had opposite effects on Cit (p<0.0001), Gln (p = 0.0004) and Pro (p = 0.0321). There were no changes in other AA concentrations, including Glu.
Table 4. Effect of dietary fat and MSG and their interaction on serous AA concentrations in growing pigs (n = 8).
AA | Measurements (Mean±SD) µmol/L | P values | |||||
BD* | HF* | BDM* | HFM* | Fat Effect | GSM Effect | Interaction | |
Arg | 368.30±33.00 | 361.47±54.12 | 343.07±52.55 | 334.55±81.14 | 0.7482 | 0.2823 | 0.9718 |
His | 226.3±17.30 | 210.00±28.99 | 225.93±31.45 | 231.80±34.08 | 0.6351 | 0.3746 | 0.3238 |
Ile | 184.44±48.39 | 177.91±21.61 | 176.88±16.10 | 166.29±30.45 | 0.5148 | 0.4659 | 0.8766 |
Leu | 361.26±82.58 | 339.21±31.51 | 368.51±51.99 | 314.35±53.01 | 0.1215 | 0.7125 | 0.5034 |
Lys | 251.77±29.66 | 209.05±32.41 | 226.94±29.21 | 222.34±44.08 | 0.0810 | 0.7419 | 0.1725 |
Phe | 108.70±10.63 | 105.89±5.34 | 115.07±17.24 | 111.77±14.81 | 0.6064 | 0.2308 | 0.9610 |
Thr | 115.74±32.51 | 85.94±20.59 | 107.07±18.03 | 85.81±23.18 | 0.0212 | 0.6275 | 0.6916 |
Trp | 34.96±3.80 | 37.34±3.80 | 41.28±6.25 | 36.15±6.65 | 0.3976 | 0.1982 | 0.0919 |
Val | 362.01±86.70 | 294.35±32.44 | 409.11±58.13 | 317.01±55.94 | 0.0046 | 0.1793 | 0.6311 |
Gly | 908.97±98.31 | 1007.76±146.57 | 924.94±145.06 | 1080.74±195.79 | 0.0393 | 0.4701 | 0.6169 |
Ser | 168.48±19.04 | 166.87±18.36 | 166.73±23.31 | 151.33±33.34 | 0.3672 | 0.3932 | 0.4718 |
Tyr | 201.09±26.10 | 167.63±24.32 | 199.69±39.08 | 147.41±32.36 | 0.0022 | 0.3516 | 0.4429 |
Asn | 108.42±11.86 | 110.92±22.43 | 113.86±14.29 | 115.57±26.15 | 0.5296 | 0.7860 | 0.9597 |
Asp | 26.33±3.69 | 25.46±3.49 | 31.13±8.26 | 23.88±2.81 | 0.0625 | 0.4439 | 0.1369 |
Cit | 116.59±10.90 | 76.77±11.35 | 86.18±4.11 | 111.73±9.25 | 0.0378 | 0.8562 | <0.0001 |
Glu | 420.64±45.12 | 413.02±19.81 | 453.14±45.68 | 417.33±77.27 | 0.3112 | 0.3890 | 0.5078 |
Gln | 79.15±7.49 | 57.04±5.88 | 68.02±10.06 | 74.34±8.12 | 0.0224 | 0.5778 | 0.0004 |
Orn | 173.79±20.70 | 148.24±9.78 | 206.57±39.09 | 157.14±19.39 | 0.0013 | 0.0515 | 0.0515 |
Cys | 1.65±0.50 | 1.59±0.85 | 1.17±0.69 | 1.40±0.77 | 0.7198 | 0.2690 | 0.6172 |
Ala | 810.03±106.61 | 625.86±161.16 | 741.42±88.53 | 662.43±86.93 | 0.0100 | 0.6972 | 0.2616 |
Hyp | 433.80±126.73 | 309.90±61.85 | 461.44±74.49 | 444.31±65.65 | 0.0589 | 0.0322 | 0.1451 |
1MHis | 4.87±0.90 | 4.59±0.77 | 4.62±0.58 | 4.99±0.56 | 0.9074 | 0.8509 | 0.2741 |
3MHis | 7.93±0.68 | 9.02±1.72 | 7.23±1.63 | 6.96±1.52 | 0.5196 | 0.0242 | 0.2291 |
Pro | 508.47±75.95 | 539.44±110.13 | 584.58±67.54 | 479.85±55.18 | 0.2837 | 0.6557 | 0.0321 |
Abbreviations: BD, Basal diet; HF, High fat diet; BDM, Basal diet +3% monosodium L-glutamate; HFM, High fat diet +3% monosodium L-glutamate.
Dietary supplementation with both fat and MSG can influence the expression of AA-sensing genes
To document the effects of dietary fat and MSG on AA-related gene expression, the expression of a broad spectrum of AA-sensing genes in the kidney, liver and muscle were determined. The results are shown in Fig. 2 . Dietary fat can significantly up-regulated the expression of taste receptor type 1 member 1 (T1R1) in the kidney (p = 0.0036), and down-regulated its expression in muscle (p = 0.0434), and G-protein-coupled receptor family C member 6A (GPRC6A) in the liver (p = 0.0342). MSG significantly up-regulated the expression of T1R1 in the kidney (p = 0.0007), and down-regulated the expression of T1R1 in the liver (p = 0.0447). MSG also down-regulated the expression of extracellular Ca2+-sensing receptor (CaR) in the muscle (p = 0.0213), and significantly down-regulated the expression of GPRC6A in the liver (p = 0.002) and muscle (p = 0.0191).
Figure 2. Dietary fat and MSG supplementation changed the express profiles of free AA-sensing genes, T1R1 (A), CaR (B) and GPRC6A (C) (n = 8).
The results were normalized by the expression of β-actin. Abbreviations, T1R1: Taste receptor type 1 member 1, CaR: Ca2+-sensing receptor and GPRC6A: G-protein-coupled receptor family C member 6A.
Dietary supplementation with fat and MSG modify AA pools in liver and muscle
The free AA profiles in the liver and muscle were determined, and the results are shown in Table 5 and Table 6 . Dietary fat increased the concentrations of Ser (p = 0.0078), Tyr (p = 0.0046), Asn (p = 0.0347), and Cys (p = 0.0493) in the liver, and also increased the concentrations of Gly (p = 0.0155) and Ala (p = 0.0441) in the muscle. MSG had no effect on AA pool in the liver and muscle. Dietary fat and MSG had opposite effects on the concentrations of Cit (p = 0.0004) in the liver and Hyp (p = 0.0092) in the muscle. Interestingly, while dietary fat and MSG each tended to reduce homocysteine (Hcy) in muscle, their combination increased the concentration of Hcy in muscle (p = 0.0258).
Table 5. Effect of dietary fat and MSG and their interaction on free AA concentrations in liver of growing pigs (n = 8).
AA | Measurements (Mean±SD) µmol/g | P values | |||||
BD* | HF* | BDM* | HFM* | Fat Effect | GSM Effect | Interaction | |
Arg | 0.1327±0.0625 | 0.1207±0.0163 | 0.1282±0.0543 | 0.1799±0.0569 | 0.4508 | 0.3029 | 0.2347 |
His | 1.0052±0.1216 | 1.1551±0.1327 | 0.9871±0.1716 | 1.0373±0.1093 | 0.1661 | 0.3367 | 0.4769 |
Ile | 0.3963±0.0789 | 0.4216±0.0714 | 0.4013±0.0890 | 0.4540±0.0610 | 0.3237 | 0.6316 | 0.7240 |
Leu | 1.1294±0.2158 | 1.2604±0.2027 | 1.2220±0.3047 | 1.2276±0.1119 | 0.5456 | 0.7903 | 0.5787 |
Lys | 0.6742±0.1122 | 0.6991±0.0956 | 0.7286±0.2360 | 0.7209±0.0581 | 0.9057 | 0.6014 | 0.8221 |
Met | 0.4915±0.0869 | 0.6358±0.1377 | 0.6213±0.1634 | 0.6552±0.0423 | 0.1546 | 0.2275 | 0.3652 |
Phe | 0.6607±0.0572 | 0.7973±0.1195 | 0.7074±0.1360 | 0.7396±0.0616 | 0.1168 | 0.9139 | 0.3163 |
Thr | 0.7792±0.1203 | 0.7580±0.1297 | 0.7707±0.1005 | 0.7800±0.0310 | 0.8349 | 0.9740 | 0.8457 |
Trp | 0.7012±0.0579 | 0.6848±0.0579 | 0.6366±0.0689 | 0.6981±0.0961 | 0.5427 | 0.4896 | 0.3002 |
Val | 0.7513±0.1277 | 0.7403±0.1243 | 0.8316±0.2750 | 0.7751±0.0637 | 0.6931 | 0.5037 | 0.7899 |
Gly | 8.1919±1.0939 | 8.2064±0.7118 | 7.5550±0.8290 | 8.1158±0.7070 | 0.5113 | 0.4088 | 0.5325 |
Ser | 1.3655±0.0725 | 1.6652±0.2807 | 1.2590±0.2177 | 1.5622±0.1080 | 0.0078 | 0.2897 | 0.9856 |
Tau | 0.0064±0.0015 | 0.0053±0.0014 | 0.0083±0.0030 | 0.0063±0.0014 | 0.1423 | 0.1647 | 0.7110 |
Tyr | 0.7390±0.0815 | 0.8699±0.1010 | 0.7633±0.0537 | 0.8872±0.0428 | 0.0046 | 0.5813 | 0.9249 |
Asn | 1.1393±0.2034 | 1.3602±0.1799 | 1.2127±0.1462 | 1.3881±0.1252 | 0.0347 | 0.5543 | 0.7889 |
Asp | 0.3810±0.0106 | 0.3913±0.0182 | 0.3407±0.0459 | 0.4145±0.0669 | 0.0678 | 0.6910 | 0.1561 |
Cit | 0.0472±0.0073 | 0.0338±0.0036 | 0.0276±0.0067 | 0.0468±0.0085 | 0.4078 | 0.3386 | 0.0004 |
Glu | 0.8486±0.0750 | 0.8031±0.0639 | 0.7822±0.0739 | 0.8632±0.1003 | 0.6634 | 0.9374 | 0.1373 |
Gln | 4.0030±0.5849 | 3.8702±0.6666 | 4.2568±1.5683 | 4.2900±0.3983 | 0.9158 | 0.4793 | 0.8602 |
Orn | 1.3427±0.2769 | 1.3010±0.0676 | 1.2007±0.1506 | 1.2474±0.1450 | 0.9783 | 0.2899 | 0.6257 |
Cys | 0.6053±0.2061 | 1.1140±0.5901 | 0.4992±0.3967 | 0.9324±0.4406 | 0.0493 | 0.5168 | 0.8638 |
Hcy | 0.0208±0.0022 | 0.0208±0.0023 | 0.0244±0.0071 | 0.0230±0.0030 | 0.7421 | 0.1940 | 0.7492 |
Abu | 0.0821±0.0352 | 0.0693±0.0130 | 0.0773±0.0274 | 0.0866±0.0473 | 0.9192 | 0.7125 | 0.5175 |
Ala | 2.8986±0.4294 | 2.8738±0.5048 | 2.3693±0.2375 | 2.7685±0.7133 | 0.4694 | 0.2294 | 0.4140 |
Car | 0.0075±0.0051 | 0.0096±0.0032 | 0.0128±0.0037 | 0.0094±0.0013 | 0.7192 | 0.1809 | 0.1488 |
Hyp | 0.4738±0.0911 | 0.4424±0.0834 | 0.4089±0.1271 | 0.3948±0.1804 | 0.7256 | 0.3912 | 0.8938 |
1MHis | 0.0555±0.0058 | 0.0543±0.0023 | 0.0701±0.0238 | 0.0640±0.0129 | 0.6078 | 0.1056 | 0.7258 |
3MHis | 0.0028±0.0009 | 0.0028±0.0006 | 0.0028±0.0011 | 0.0028±0.0005 | 0.9767 | 0.9979 | 0.9557 |
Pro | 1.9254±0.4203 | 1.8970±0.3312 | 1.9873±0.2364 | 1.9755±0.2394 | 0.9009 | 0.6646 | 0.9588 |
Abbreviations: BD, Basal diet; HF, High fat diet; BDM, Basal diet +3% monosodium L-glutamate; HFM, High fat diet +3% monosodium L-glutamate.
Table 6. Effect of dietary fat and MSG and their interaction on free AA concentrations in muscle of growing pigs (n = 8).
AA | Measurements (Mean±SD) µmol/g | P values | |||||
BD* | HF* | BDM* | HFM* | Fat Effect | GSM Effect | Interaction | |
Arg | 0.1625±0.0422 | 0.2648±0.0861 | 0.1638±0.0378 | 0.2579±0.1319 | 0.0509 | 0.9463 | 0.9295 |
His | 5.6863±0.4497 | 5.1265±1.4013 | 4.5657±0.7933 | 5.1890±0.6269 | 0.8192 | 0.3341 | 0.2436 |
Ile | 0.0493±0.0429 | 0.0962±0.0306 | 0.0692±0.0032 | 0.0816±0.0257 | 0.1586 | 0.3939 | 0.6978 |
Leu | 0.1501±0.0451 | 0.2082±0.0578 | 0.1749±0.0143 | 0.2132±0.0473 | 0.0668 | 0.5482 | 0.6750 |
Lys | 0.1315±0.0688 | 0.1943±0.1379 | 0.1092±0.0341 | 0.1854±0.0738 | 0.1494 | 0.7484 | 0.8861 |
Met | 0.0755±0.0193 | 0.0631±0.0174 | 0.0612±0.0247 | 0.0916±0.0406 | 0.4978 | 0.5555 | 0.1661 |
Phe | 0.8512±0.2283 | 0.8399±0.1903 | 0.7747±0.1740 | 0.9901±0.2691 | 0.3603 | 0.6941 | 0.3384 |
Thr | 0.1890±0.0285 | 0.1796±0.0457 | 0.1835±0.0588 | 0.2010±0.0897 | 0.8915 | 0.7862 | 0.6858 |
Trp | 0.0792±0.0180 | 0.2138±0.1812 | 0.1138±0.0606 | 0.1111±0.0357 | 0.2537 | 0.4723 | 0.2212 |
Val | 0.1394±0.0214 | 0.1770±0.0158 | 0.1487±0.0203 | 0.1539±0.0338 | 0.1233 | 0.5256 | 0.2219 |
Gly | 1.3442±0.3177 | 2.5352±0.6128 | 1.3873±0.4196 | 1.9597±0.8191 | 0.0155 | 0.3663 | 0.3378 |
Ser | 0.0957±0.0254 | 0.1504±0.0804 | 0.1133±0.0384 | 0.1220±0.0423 | 0.2871 | 0.7981 | 0.4188 |
Tau | 0.0092±0.0021 | 0.0096±0.0035 | 0.0085±0.0026 | 0.0102±0.0031 | 0.4764 | 0.9876 | 0.6876 |
Tyr | 0.1120±0.0213 | 0.1435±0.0142 | 0.1300±0.0210 | 0.1446±0.0475 | 0.2665 | 0.7228 | 0.7587 |
Asn | 0.0736±0.0127 | 0.1130±0.0773 | 0.0836±0.0198 | 0.0860±0.0270 | 0.3991 | 0.6750 | 0.4402 |
Asp | 0.0211±0.0055 | 0.0336±0.0174 | 0.0309±0.0115 | 0.0299±0.0181 | 0.5162 | 0.7433 | 0.3947 |
Cit | 0.0615±0.0250 | 0.1068±0.0628 | 0.0775±0.0170 | 0.0701±0.0263 | 0.3865 | 0.5441 | 0.2118 |
Glu | 0.0969±0.0201 | 0.2595±0.2180 | 0.1383±0.0753 | 0.1295±0.0488 | 0.2714 | 0.4436 | 0.2089 |
Gln | 0.7110±0.3139 | 0.7705±0.0907 | 0.6290±0.1048 | 1.3935±0.7380 | 0.0773 | 0.1937 | 0.1303 |
Orn | 0.0803±0.0332 | 0.1423±0.0394 | 0.0885±0.0504 | 0.1324±0.0672 | 0.0705 | 0.9543 | 0.7373 |
Hcy | 0.0243±0.0058 | 0.0208±0.0062 | 0.0154±0.0021 | 0.0261±0.0061 | 0.1493 | 0.6501 | 0.0258 |
Abu | 0.0252±0.0071 | 0.0397±0.0169 | 0.0280±0.0054 | 0.0532±0.0372 | 0.1090 | 0.4616 | 0.6480 |
Ala | 2.8870±0.6440 | 3.8679±0.5953 | 2.8727±0.5401 | 3.4975±0.8887 | 0.0441 | 0.5730 | 0.6265 |
Car | 2.7300±0.1985 | 2.6436±0.8156 | 2.2378±0.4714 | 3.1036±0.6674 | 0.2046 | 0.9493 | 0.1611 |
Hyp | 4.5922±0.3088 | 6.1164±0.7317 | 5.4785±0.7462 | 5.1129±0.2452 | 0.1113 | 0.6689 | 0.0092 |
1MHis | 0.7288±0.1544 | 0.8554±0.3061 | 0.6892±0.1155 | 0.8374±0.2182 | 0.2351 | 0.8069 | 0.9252 |
3MHis | 0.0538±0.0029 | 0.0537±0.0066 | 0.0498±0.0083 | 0.0658±0.0145 | 0.1235 | 0.3587 | 0.1302 |
Pro | 0.1387±0.0541 | 0.2443±0.0602 | 0.1902±0.0572 | 0.1897±0.0503 | 0.1179 | 0.8482 | 0.0944 |
Abbreviations: BD, Basal diet; HF, High fat diet; BDM, Basal diet +3% monosodium L-glutamate; HFM, High fat diet +3% monosodium L-glutamate.
The free AA pool in the kidney is markedly altered by supplementation with MSG
The kidney plays a major role in the homeostasis of AA pools leading us to determine the free AA profile in this tissue. The results are shown in Table 7 . Dietary fat had little effect on the free AA pool in the kidney, and significantly reduced only the Car concentration (p = 0.0257). MSG significantly increased the concentrations of His (p = 0.0086), Ile (p = 0.0080), Leu (p = 0.0040), Met (p = 0.0004), Thr (p = 0.0038), Val (p = 0.0007), Ser (p = 0.0213), Tyr (p = 0.0194) and Ala (p = 0.0093) in the kidney. Dietary fat enhances the effects of MSG on the renal concentrations of His (p = 0.0309) and Ser (p = 0.0353), and weakens the effects of MSG on the renal concentrations of Phe (p = 0.0191) and Glu (p = 0.0316).
Table 7. Effect of dietary fat and MSG and their interaction on free AA concentrations in the kidney of growing pigs (n = 8).
AA | Measurements (Mean±SD) µmol/g | P values | |||||
BD* | HF* | BDM* | HFM* | Fat Effect | GSM Effect | Interaction | |
Arg | 0.9470±0.3111 | 0.7981±0.0820 | 0.9481±0.1123 | 1.0189±0.1422 | 0.6799 | 0.2525 | 0.2569 |
His | 0.6691±0.1667 | 0.5335±0.0496 | 0.7075±0.1089 | 0.8434±0.0854 | 0.9979 | 0.0086 | 0.0309 |
Ile | 0.5304±0.1158 | 0.4364±0.0598 | 0.6663±0.1484 | 0.6465±0.0918 | 0.3164 | 0.0080 | 0.5089 |
Leu | 1.3014±0.2530 | 1.1243±0.1220 | 1.6947±0.4033 | 1.6257±0.1118 | 0.3481 | 0.0040 | 0.6756 |
Lys | 0.8814±0.2154 | 0.5983±0.0896 | 0.8761±0.1650 | 0.9079±0.1702 | 0.1567 | 0.0922 | 0.0826 |
Met | 0.8680±0.2067 | 0.6548±0.0743 | 1.1503±0.2656 | 1.2547±0.1046 | 0.5570 | 0.0004 | 0.1032 |
Phe | 1.1766±0.1318 | 1.0300±0.1052 | 1.0678±0.0525 | 1.1884±0.0884 | 0.7975 | 0.6244 | 0.0191 |
Thr | 0.8093±0.1059 | 0.7107±0.0375 | 1.0033±0.1970 | 0.9747±0.1181 | 0.3396 | 0.0038 | 0.5939 |
Trp | 0.7526±0.1921 | 0.5886±0.0499 | 0.6731±0.0896 | 0.7382±0.0529 | 0.3952 | 0.5433 | 0.0634 |
Val | 0.9515±0.1755 | 0.7763±0.0779 | 1.1244±0.1325 | 1.1519±0.0723 | 0.2499 | 0.0007 | 0.1228 |
Gly | 9.4363±1.9458 | 10.5489±1.9435 | 10.5423±1.2747 | 11.7677±1.1523 | 0.1749 | 0.1772 | 0.9457 |
Ser | 1.7530±0.5085 | 1.3867±0.1570 | 1.7950±0.2530 | 2.1508±0.1540 | 0.9730 | 0.0213 | 0.0353 |
Tau | 0.0081±0.0023 | 0.0066±0.0024 | 0.0080±0.0015 | 0.0064±0.0004 | 0.1283 | 0.8243 | 0.9759 |
Tyr | 0.8383±0.1475 | 0.6935±0.1395 | 0.9365±0.1931 | 1.0319±0.1617 | 0.7650 | 0.0194 | 0.1633 |
Asn | 1.2405±0.3099 | 1.0318±0.2082 | 1.3488±0.2205 | 1.4050±0.1131 | 0.5091 | 0.0527 | 0.2601 |
Asp | 0.4706±0.0688 | 0.4303±0.0607 | 0.6204±0.0933 | 0.7142±0.0957 | 0.5212 | 0.0002 | 0.1240 |
Cit | 0.0628±0.0151 | 0.0554±0.0112 | 0.0793±0.0135 | 0.0733±0.0213 | 0.4092 | 0.0488 | 0.9351 |
Glu | 0.9042±0.2090 | 0.7012±0.0522 | 0.8124±0.0796 | 0.9003±0.0667 | 0.3543 | 0.3869 | 0.0316 |
Gln | 6.5259±1.7905 | 4.5891±0.7030 | 6.8564±1.9451 | 6.0344±1.1389 | 0.0873 | 0.2538 | 0.4663 |
Orn | 0.8699±0.0395 | 0.7463±0.1696 | 1.0106±0.0727 | 0.9056±0.2414 | 0.1614 | 0.0739 | 0.9052 |
Cys | 1.3090±0.3987 | 1.0198±0.2387 | 0.9840±0.1491 | 1.1123±0.3494 | 0.6016 | 0.4537 | 0.1895 |
Hcy | 0.0309±0.0038 | 0.0253±0.0031 | 0.0316±0.0059 | 0.0303±0.0043 | 0.1411 | 0.2218 | 0.3508 |
Abu | 0.3091±0.0263 | 0.2770±0.0675 | 0.3468±0.0587 | 0.3103±0.0808 | 0.2882 | 0.2723 | 0.9451 |
Ala | 3.2054±0.3749 | 3.3173±0.3605 | 3.9954±0.5641 | 3.7758±0.2491 | 0.7937 | 0.0093 | 0.4272 |
Car | 0.0162±0.0040 | 0.0104±0.0037 | 0.0206±0.0086 | 0.0123±0.0044 | 0.0257 | 0.2764 | 0.6604 |
Hyp | 0.4988±0.1545 | 0.4851±0.1848 | 0.4316±0.1025 | 0.4100±0.1874 | 0.8300 | 0.3940 | 0.9620 |
1MHis | 0.1959±0.1090 | 0.1877±0.0668 | 0.2080±0.0604 | 0.2183±0.0625 | 0.9786 | 0.5907 | 0.8146 |
3MHis | 0.0057±0.0025 | 0.0053±0.0004 | 0.0052±0.0007 | 0.0049±0.0020 | 0.6686 | 0.5875 | 0.8731 |
Pro | 2.8357±0.4855 | 2.5139±0.6752 | 3.3902±0.7130 | 3.2030±0.4328 | 0.4044 | 0.0564 | 0.8231 |
Abbreviations: BD, Basal diet; HF, High fat diet; BDM, Basal diet +3% monosodium L-glutamate; HFM, High fat diet +3% monosodium L-glutamate.
Both dietary fat and MSG can modify the expression of the AA transporters in the jejunum
To better understand AA absorption, the expressions of AA transporters in different intestinal segments was measured, and the results are shown in Fig. 3. These AA transporters include: Excitatory amino-acid carrier 1, EAAC1, which is the most abundant Glu and Asp transporter in the intestine; L-type AA transporter 1 (LAT1) and B0+ AA transporter (B0+), which can transport neutral and alkaline AAs; ASC-like Na+-dependent neutral AA transporter 2 (ASCT2), which can transport neutral AAs; and intestinal H+/peptide co-transporter (PEPT1), which mainly transports peptides in the intestine. While dietary fat had no effect on the expression of AA transporters, MSG significantly reduced the expression of EAAC1 (p = 0.0009) in the duodenum. The expression of B0+ in the duodenum was synergistically down-regulated by dietary fat and MSG (p = 0.0268). In the jejunum, dietary fat significantly increased the expression of EAAC1 (p = 0.0057), LAT1 (p = 0.0411), B0+ (p = 0.0066) and ASCT2 (p = 0.0106), while MSG enhanced the expression of EAAC1 (p = 0.0008), LAT1 (p = 0.0215), and ASCT2 (p = 0.0362). There was no interaction between the effects of dietary fat and MSG on the expression of AA transporters in the jejunum. In the ileum, dietary fat reduced the expression of LAT1 (p = 0.0040) and ASCT2 (p = 0.0033), while MSG reduced the expression of LAT1 (p = 0.0014) and PEPT1 (p = 0.0125). Dietary fat and MSG had synergistic effects on the expression of LAT1 (p = 0.0093). Although the colonic epithelial cells do not transport AAs, except in the neonatal period, amino acid transporter expression in the large intestine was also measured. Dietary fat had no effect on the expression of AA transporters in the colon, while MSG significantly reduced the expression of EAAC1 (p = 0.0199). To determine the consequence of the altered expression of AA transporters, free AA concentrations were measured. The disturbed AA balance in intestinal wall ( Tables 8 – 10 ) suggests that dietary fat and MSG may modify the absorption and metabolism of AAs in the jejunum mucosa.
Figure 3. Dietary fat and MSG supplementation changed the express profiles of AA and peptide transporters in intestine: Duodenum (A), Jejunum (B), Ileum (C) and Colon (D) (n = 8).
The results were normalized by β-actin. Abbreviation, EAAC1: Excitatory amino-acid carrier 1, LAT1: L-type AA transporter 1, B0+: B0+ AA transporter, ASCT2: ASC-like Na+-dependent neutral AA transporter 2 and PEPT1: Intestinal H+/peptide co-transporter.
Table 8. Effect of dietary fat and MSG and their interaction on free AA concentrations in the duodenum of growing pigs (n = 8).
AA | Measurements (Mean±SD) µmol/g | P values | |||||
BD* | HF* | BDM* | HFM* | Fat Effect | GSM Effect | Interaction | |
Arg | 0.8846±0.1367 | 0.7097±0.1640 | 0.7525±0.1574 | 0.6874±0.1975 | 0.1967 | 0.3538 | 0.5664 |
His | 0.3046±0.0210 | 0.3024±0.0480 | 0.3227±0.0776 | 0.3052±0.0478 | 0.7519 | 0.6910 | 0.8025 |
Ile | 0.2694±0.0270 | 0.3595±0.0748 | 0.2960±0.0694 | 0.2948±0.0823 | 0.3616 | 0.7875 | 0.2391 |
Leu | 0.7975±0.0734 | 0.9642±0.1791 | 0.8155±0.1410 | 0.7860±0.2040 | 0.6471 | 0.4859 | 0.2766 |
Lys | 0.7229±0.1480 | 0.5414±0.1231 | 0.6232±0.2073 | 0.4996±0.0768 | 0.0787 | 0.3762 | 0.7387 |
Met | 0.4428±0.0547 | 0.4713±0.0753 | 0.4339±0.0870 | 0.3806±0.1118 | 0.5694 | 0.4003 | 0.4177 |
Phe | 0.9920±0.0629 | 1.0577±0.0378 | 0.9670±0.0774 | 1.0587±0.1337 | 0.1441 | 0.7790 | 0.8061 |
Thr | 0.5293±0.0597 | 0.5315±0.0901 | 0.5484±0.1140 | 0.4721±0.0749 | 0.3385 | 0.7997 | 0.4355 |
Trp | 0.6741±0.0770 | 0.6070±0.0079 | 0.6276±0.1181 | 0.6653±0.0343 | 0.9283 | 0.8970 | 0.2787 |
Val | 0.5238±0.0849 | 0.5087±0.0390 | 0.5781±0.1052 | 0.4881±0.1383 | 0.3538 | 0.6852 | 0.5441 |
Gly | 5.1799±0.2854 | 4.2509±0.4071 | 4.8394±0.7070 | 5.0408±0.7832 | 0.4987 | 0.7460 | 0.1297 |
Ser | 1.0356±0.0902 | 0.9338±0.2577 | 1.0818±0.3422 | 0.9192±0.2074 | 0.3216 | 0.8709 | 0.8248 |
Tau | 0.0082±0.0020 | 0.0064±0.0004 | 0.0065±0.0018 | 0.0070±0.0014 | 0.5380 | 0.3977 | 0.2392 |
Tyr | 0.4923±0.0570 | 0.5040±0.1507 | 0.4469±0.1118 | 0.3879±0.0981 | 0.4419 | 0.2060 | 0.5388 |
Asn | 0.6531±0.0456 | 0.8194±0.2039 | 0.6251±0.1138 | 0.5776±0.1130 | 0.7580 | 0.0935 | 0.1179 |
Asp | 0.2602±0.0417 | 0.2321±0.0099 | 0.2554±0.0637 | 0.27204±0.0112 | 0.9676 | 0.5835 | 0.3655 |
Cit | 0.2171±0.0480 | 0.1505±0.0404 | 0.2059±0.0289 | 0.1743±0.0459 | 0.0724 | 0.9059 | 0.4690 |
Glu | 0.8416±0.0889 | 0.7514±0.0126 | 0.7617±0.1445 | 0.8063±0.0321 | 0.7952 | 0.6276 | 0.2316 |
Gln | 5.2678±1.1395 | 3.3681±0.5563 | 3.8318±2.0290 | 2.9714±0.7052 | 0.0742 | 0.1957 | 0.5047 |
Orn | 0.2860±0.0282 | 0.2402±0.0548 | 0.2660±0.0614 | 0.2120±0.0365 | 0.0506 | 0.3726 | 0.8739 |
Cys | 0.4577±0.2494 | 0.4586±0.0528 | 0.4052±0.2292 | 0.1950±0.1143 | 0.1916 | 0.2320 | 0.3592 |
Hcy | 0.0324±0.0083 | 0.0275±0.0038 | 0.0296±0.0058 | 0.0229±0.0039 | 0.0718 | 0.3216 | 0.7919 |
Abu | 0.4467±0.2345 | 0.4229±0.1655 | 0.2714±0.0624 | 0.2292±0.1940 | 0.5124 | 0.0905 | 0.9278 |
Ala | 2.0632±1.3648 | 2.5732±0.7331 | 1.0084±0.2518 | 1.1637±0.2711 | 0.8274 | 0.0222 | 0.7030 |
Car | ND | ND | ND | 0.0023±0.0046 | - | - | - |
Hyp | 1.2359±0.1014 | 1.1934±0.2419 | 1.1894±0.1548 | 1.1761±0.1428 | 0.7100 | 0.6789 | 0.8645 |
1MHis | 0.0608±0.0087 | 0.0493±0.0021 | 0.0636±0.0111 | 0.0611±0.0157 | 0.4389 | 0.3384 | 0.5014 |
3MHis | 0.0019±0.0015 | 0.0020±0.0003 | 0.0023±0.0003 | 0.0033±0.0010 | 0.1869 | 0.2036 | 0.4324 |
Pro | 1.1299±0.1135 | 1.2034±0.4353 | 1.1805±0.3533 | 0.8084±0.1438 | 0.1533 | 0.3872 | 0.1532 |
Abbreviations: BD, Basal diet; HF, High fat diet; BDM, Basal diet +3% monosodium L-glutamate; HFM, High fat diet +3% monosodium L-glutamate.
Table 10. Effect of dietary fat and MSG and their interaction on free AA concentrations in the ileum of growing pigs (n = 8).
AA | Measurements (Mean±SD) µmol/g | P values | |||||
BD* | HF* | BDM* | HFM* | Fat Effect | GSM Effect | Interaction | |
Arg | 0.6939±0.1130 | 0.8109±0.0868 | 0.5401±0.0849 | 0.7874±0.1477 | 0.0066 | 0.1364 | 0.2635 |
His | 0.3316±0.0764 | 0.3551±0.0629 | 0.2598±0.0732 | 0.3550±0.0679 | 0.1168 | 0.3264 | 0.3276 |
Ile | 0.3233±0.0412 | 0.2986±0.0694 | 0.2358±0.0268 | 0.3085±0.1092 | 0.5016 | 0.2835 | 0.1846 |
Leu | 0.6796±0.1147 | 0.7178±0.1602 | 0.5576±0.0660 | 0.7690±0.1725 | 0.0895 | 0.6095 | 0.2240 |
Lys | 0.4811±0.1273 | 0.5067±0.0695 | 0.3736±0.0412 | 0.5688±0.1337 | 0.0489 | 0.6606 | 0.1183 |
Met | 0.4474±0.1024 | 0.4372±0.1006 | 0.3573±0.1155 | 0.4587±0.1524 | 0.4604 | 0.5765 | 0.3687 |
Phe | 0.9364±0.0599 | 0.8970±0.1574 | 0.7045±0.1840 | 1.0945±0.1342 | 0.0292 | 0.8123 | 0.0104 |
Thr | 0.4689±0.0866 | 0.5389±0.0951 | 0.5555±0.1901 | 0.4996±0.1241 | 0.9156 | 0.7231 | 0.3534 |
Trp | 0.8627±0.1473 | 0.9510±0.2068 | 0.7798±0.1448 | 0.9439±0.2370 | 0.2047 | 0.6409 | 0.6941 |
Val | 0.4841±0.1224 | 0.4654±0.1393 | 0.3896±0.0841 | 0.5294±0.1290 | 0.3347 | 0.8042 | 0.2127 |
Gly | 7.7682±1.1321 | 9.6239±2.3436 | 7.8509±1.8660 | 10.2757±1.5031 | 0.0323 | 0.6853 | 0.7532 |
Ser | 0.8233±0.1116 | 0.9518±0.1303 | 0.7509±0.1010 | 1.0095±0.2147 | 0.0214 | 0.9218 | 0.3918 |
Tau | 0.0072±0.0022 | 0.0059±0.0010 | 0.0072±0.0013 | 0.0076±0.0016 | 0.5656 | 0.3056 | 0.3315 |
Tyr | 0.4332±0.0794 | 0.4714±0.0981 | 0.3451±0.0735 | 0.4228±0.0760 | 0.1843 | 0.1225 | 0.6388 |
Asn | 0.6599±0.0734 | 0.7309±0.2857 | 0.5373±0.0880 | 0.7789±0.1832 | 0.1065 | 0.6849 | 0.3595 |
Asp | 0.2788±0.0617 | 0.2869±0.0982 | 0.2584±0.0279 | 0.3670±0.0816 | 0.1323 | 0.4249 | 0.1894 |
Cit | 0.1565±0.0804 | 0.1267±0.0232 | 0.1522±0.0835 | 0.1610±0.0445 | 0.7452 | 0.6443 | 0.5527 |
Glu | 1.0496±0.1825 | 1.1395±0.2393 | 0.9287±0.1621 | 1.1383±0.2880 | 0.2050 | 0.5946 | 0.6017 |
Gln | 3.2146±0.6169 | 3.2173±0.4911 | 2.3496±0.1585 | 3.6809±0.9247 | 0.0502 | 0.5248 | 0.0510 |
Orn | 0.2292±0.0296 | 0.2496±0.0671 | 0.2010±0.0610 | 0.2454±0.0949 | 0.3556 | 0.6388 | 0.7276 |
Cys | 0.5306±0.3165 | 0.6121±0.3135 | 0.5298±0.1606 | 0.7811±0.4243 | 0.3157 | 0.6063 | 0.6033 |
Hcy | 0.0222±0.0056 | 0.0237±0.0017 | 0.0218±0.0035 | 0.0265±0.0066 | 0.2149 | 0.641 | 0.5101 |
Abu | 0.3001±0.0747 | 0.3332±0.1107 | 0.2867±0.0425 | 0.2969±0.0296 | 0.5561 | 0.5003 | 0.7542 |
Ala | 1.4250±0.2814 | 1.3568±0.2125 | 0.8878±0.1514 | 1.3909±0.2018 | 0.0679 | 0.0387 | 0.0218 |
Car | 0.0031±0.0036 | 0.0019±0.0039 | 0.0029±0.0034 | ND | - | - | - |
Hyp | 1.4200±0.1535 | 1.4909±0.2934 | 1.2992±0.1903 | 1.1077±0.3018 | 0.6291 | 0.0606 | 0.3022 |
1MHis | 0.0573±0.0154 | 0.0686±0.0116 | 0.0559±0.0140 | 0.0825±0.0247 | 0.0469 | 0.4834 | 0.3885 |
3MHis | 0.0017±0.0013 | 0.0023±0.0016 | 0.0018±0.0013 | 0.0021±0.0015 | 0.5589 | 0.9419 | 0.8053 |
Pro | 0.9811±0.1774 | 1.1048±0.2707 | 0.9695±0.2947 | 1.1710±0.1952 | 0.1997 | 0.8240 | 0.7511 |
Abbreviations: BD, Basal diet; HF, High fat diet; BDM, Basal diet +3% monosodium L-glutamate; HFM, High fat diet +3% monosodium L-glutamate.
Table 9. Effect of dietary fat and MSG and their interaction on free AA concentrations in the jejunum of growing pigs (n = 8).
AA | Measurements (Mean±SD) µmol/g | P values | |||||
BD* | HF* | BDM* | HFM* | Fat Effect | GSM Effect | Interaction | |
Arg | 0.9768±0.1600 | 0.8492±0.1725 | 0.6560±0.1042 | 0.9141±0.5390 | 0.7151 | 0.5720 | 0.2928 |
His | 0.6561±0.1010 | 0.5208±0.1103 | 0.3966±0.0644 | 0.6853±0.4396 | 0.5884 | 0.9017 | 0.1533 |
Ile | 0.4385±0.1167 | 0.3659±0.1328 | 0.2563±0.0454 | 0.4349±0.2899 | 0.6043 | 0.7013 | 0.2336 |
Leu | 1.1097±0.2204 | 1.0109±0.3390 | 0.7045±0.1153 | 1.0974±0.6867 | 0.5444 | 0.6040 | 0.3189 |
Lys | 0.6884±0.2000 | 0.5124±0.1449 | 0.3926±0.1101 | 0.6086±0.3735 | 0.8814 | 0.5909 | 0.1647 |
Met | 0.6478±0.0579 | 0.5336±0.1293 | 0.4855±0.1311 | 0.7460±0.4077 | 0.5892 | 0.6980 | 0.1837 |
Phe | 1.5511±0.2391 | 1.3891±0.1835 | 1.0868±0.2235 | 1.3521±0.2060 | 0.6590 | 0.0788 | 0.0894 |
Thr | 0.5060±0.1187 | 0.4752±0.1338 | 0.4465±0.0563 | 0.5832±0.2495 | 0.5679 | 0.6912 | 0.3717 |
Trp | 0.9805±0.1634 | 0.8243±0.1009 | 0.7504±0.0078 | 1.0201±0.4854 | 0.7165 | 0.9313 | 0.1910 |
Val | 0.6588±0.1331 | 0.6201±0.1207 | 0.4387±0.0720 | 0.7194±0.4921 | 0.4510 | 0.8104 | 0.3251 |
Gly | 7.2757±1.4304 | 7.3174±0.6225 | 6.0244±0.1362 | 8.5587±3.8171 | 0.3066 | 0.8866 | 0.3217 |
Ser | 1.2290±0.0487 | 1.0721±0.1713 | 0.8200±0.1462 | 1.3891±0.8955 | 0.4664 | 0.9830 | 0.2120 |
Tau | 0.0093±0.0019 | 0.0083±0.0012 | 0.0085±0.0012 | 0.0084±0.0014 | 0.4450 | 0.6777 | 0.6002 |
Tyr | 0.6192±0.0511 | 0.5275±0.1390 | 0.4557±0.1132 | 0.6867±0.4375 | 0.6272 | 0.8820 | 0.2730 |
Asn | 1.3506±0.1797 | 1.1752±0.3555 | 0.7827±0.1188 | 1.4689±0.9654 | 0.4274 | 0.8098 | 0.1932 |
Asp | 0.3615±0.0094 | 0.3158±0.0462 | 0.2774±0.0397 | 0.4028±0.2375 | 0.5931 | 0.8516 | 0.2637 |
Cit | 0.2583±0.0226 | 0.2316±0.0743 | 0.1901±0.0559 | 0.2432±0.1289 | 0.7815 | 0.6332 | 0.4100 |
Glu | 1.0359±0.1784 | 0.8849±0.0988 | 0.7696±0.0264 | 1.0561±0.4850 | 0.6670 | 0.9160 | 0.1826 |
Gln | 5.5077±1.4716 | 4.2252±1.3554 | 3.3146±0.6840 | 5.0072±2.8550 | 0.8437 | 0.6337 | 0.1730 |
Orn | 0.3249±0.0188 | 0.3521±0.0950 | 0.2210±0.0236 | 0.3429±0.2298 | 0.3368 | 0.5115 | 0.5363 |
Cys | 0.6648±0.4137 | 1.0199±0.5695 | 0.6940±0.1640 | 0.7729±0.7343 | 0.4790 | 0.6692 | 0.6498 |
Hcy | 0.0299±0.0040 | 0.0240±0.0028 | 0.0265±0.0037 | 0.0269±0.0027 | 0.1439 | 0.9327 | 0.1026 |
Abu | 0.6243±0.1712 | 0.5643±0.1573 | 0.3208±0.0478 | 0.5413±0.3368 | 0.5119 | 0.2484 | 0.2621 |
Ala | 2.8043±1.7161 | 2.1952±0.8293 | 1.1568±0.2406 | 2.1835±1.2608 | 0.7400 | 0.2665 | 0.2110 |
Car | 0.0017±0.0030 | 0.0019±0.0038 | 0.0014±0.0024 | 0.0022±0.0043 | - | - | - |
Hyp | 0.9298±0.1734 | 1.1109±0.1365 | 1.1292±0.1448 | 1.1767±0.1812 | 0.2155 | 0.1811 | 0.4578 |
1MHis | 0.0455±0.0175 | 0.0448±0.0048 | 0.0578±0.0138 | 0.0720±0.0419 | 0.6317 | 0.1528 | 0.5947 |
3MHis | 0.0023±0.0003 | 0.0019±0.0007 | 0.0021±0.0001 | 0.0030±0.0020 | 0.7266 | 0.3932 | 0.3452 |
Pro | 1.2789±0.1242 | 1.3274±0.5428 | 0.9276±0.1379 | 1.3355±0.7179 | 0.4177 | 0.5970 | 0.5206 |
Abbreviations: BD, Basal diet; HF, High fat diet; BDM, Basal diet +3% monosodium L-glutamate; HFM, High fat diet +3% monosodium L-glutamate.
Discussion
Dietary fat and protein are two of the main macronutrients required for life. Many published work had tested the effects of each nutrients independently, however, a few studies are available on the effect of combination of dietary fat and protein. The metabolism is a systemic network, and it would be misleading to evaluate the effects of one nutrient while ignoring the effects of others in plausible nutritional situation. As early as 1956, Mellinkoff et al. found that a diet that contained very few short-chain saturated fats and relatively abundant long-chain unsaturated fats could significantly reduce Leu and Val and increase Pro, Cys, Arg and Asp in plasma [15]. Dietary fatty acids, particularly n-3 fatty acids, can spare AAs for protein and peptide synthesis [16]. On the contrary, AAs, especially those containing sulfur, can also modulate lipid metabolism [17]. As the Chinese economy is developing, the Chinese population, including children and adolescents, has undergone a rapid transition to a high-fat diet [6]. In parallel with these trends, there has recently been a large increase in the consumption of MSG as an umami food additive in China. MSG can facilitate the gastric emptying of a protein-rich meal, and plays an important role in protein digestion [18]. Conversely, MSG has been shown to increase the stomach antral area in human volunteers fed with a normo-proteic diet [19] and to slow gastric emptying in preterm piglets [20]; suggesting that the effects of MSG on the stomach physiology depends on nutritional conditions. In the present study, the effects of dietary fat and MSG on AA metabolism in growing pigs were determined, along with the interaction between these two factors.
MSG begins to release Glu and sodium in the mouth, while dietary fat begins to be digested in the small intestine. As the alimentary bolus rapidly passes through the duodenum, with dietary fat having little effect there, an increase in the luminal concentration of MSG may be responsible for the reduced expression of EAAC1 in the small intestine mucosa. This may correspond to a regulation of AA transport through the enterocytes. Glu released from MSG, is an important precursor for bioactive molecules, including glutathione (oxidative stress modulator) [21], and this may be related to the down-regulation of PEPT1. However, the mechanisms responsible for the antagonistic effects of dietary fat and MSG on Bo+ remains unclear.
Colonization of the gastrointestinal tract by gut microbiota can influence the absorption and metabolism of nutrients, including AAs. Gut microbiota can incorporate and degrade some available AAs, and can also synthesize AAs [22]; even if the net result of these catabolic and anabolic pathmays remains unknown [22]. Factors that alter the composition of the gut microbiota can also disturb AA metabolism. There have been reports showing that both dietary fat [23], [24] and MSG can influence the composition of the gut microbiota. In the present study, changes in microbiota composition following dietary fat and MSG ingestion were observed [unpublished data]. Changes in the gut microbiota may participate in the up-regulated expression of AA transporters in the jejunum, but further experiments are required to test this hypothesis. Glu is the main oxidative fuel for the gut microbiota in the upper gastrointestinal tract [25]. Even when Glu is provided in higher (4-fold more) amount than normal dietary quantities, most glutamate molecules are either oxidized or metabolized by the mucosa into other nonessential AAs [26]. Thus, both dietary fat and MSG may enhance AA synthesis by the gut microbiota, and this may be related to the effects of dietary fat and MSG on the expression of AA transporters. In the lower gastrointestinal tract, the effects of dietary fat and MSG were weak, and this is presumably related to the higher density of bacteria in these two intestinal segments than in the jejunum, and to the fact that AAs degraded from the residual undigested luminal proteins and peptides cannot be absorbed in the distal intestine [22].
The kidney is an important organ that finely tune the circulating and tissue pools of AAs. Consistent with previous findings that protein intake, in contrast to fat and carbohydrate, can significantly influences renal hemodynamics in healthy animals and humans [27], [28], dietary fat had little effect on the AA profile and could only significantly lower L-carnosine (Car) levels in the kidney were found [29], but no similar change of Car was seen in the liver. In contrast, supplementation with MSG may disturb the renal AA balance and increase the AA pool in the kidney. If glutamate which has not been metabolized by the intestinal mucosa is transported to the kidney, it can be converted to glutamine [30] and then further transformed to other non-essential AAs such as Ser, Tyr and Arg, and exported to other tissues [31]. Unexpectedly, some essential AAs, like His, Ile, Leu, Met, Thr and Val, were also increased, which may be due to the effect of glutamate on the kidney [32], and/or to the sparing effect of glutamate on the utilization of several AAs in tissues including the intestinal mucosa [19]. Indeed, MSG is able to increase Leu in the kidney and muscle [33]–[35]. Another notable change is the increase of Cit in the kidney. Cit is a metabolic substrate for mutual conversion with Arg [36], the latter AA plays multiple roles: it is a precursor of nitric oxide, creatine, agmatine, and other polyamines, and is an intermediate in the urea cycle [37]–[39]. In the present study, Gly was elevated by dietary fat, and this may be related to the fact that fat can reduce the oxidation of AAs.
Under a condition of brief caloric restriction, dietary fat had no effect on the conservation of body proteins and branched-chain AAs, including Leu, Ile and Val [40]. However, under normal conditions, supplementation with dietary fat can reduce the percent of energy provided by other nutrients such as AAs. The results also showed that fat can lower serum levels of glucogenic AAs. Serum Val is a good predictor [41], and serum Val was increased induced by supplementation of dietary fat was found. The results suggest that supplementation with dietary fat can promote the retention of AAs.
An increased level of serum 3MHis in cattle is considered as a measurement of muscle protein degradation [42]. MSG was able to significantly lower serum 3MHis, which indicates that MSG may inhibit protein degradation in muscle, but more experiments might be required to test this hypothesis.
In the present study, the expression of AA-sensing genes and AA transporters in tissues were also measured. While the determination of AA-sensing genes are likely indirectly related to AA concentrations, the results obtained are compatible with the view that AA concentration and gene expression in tissues may influence each other in both directions.
Conclusion
In conclusion, the effects of dietary fat and MSG, both alone and in combination, on the AA in the circulating and tissue pool were determined. Little interaction was found between the effects of dietary fat and MSG. Both dietary fat and MSG enhanced the absorption of AAs in jejunum. Dietary fat can enhance the AA pool in plasma and muscle, while MSG enhances AA pool in the kidney. The results of the present study will help to further uncover the effects of dietary fat and MSG addition on human amino acid metabolism, with predictable consequences for the optimization of animal feeding and human nutrition.
Funding Statement
This work was supported by the Major Program for International Cooperation of the National Natural Science Foundation of China (Grant No. 31110103909), Funds of the Chinese Academy of Sciences for Key Topics in Innovation Engineering (Grant No. KZCX2-EW-412) and Funds of Institute of Subtropical Agriculture, the Chinese Academy of Sciences for field cutting-edge (Grant No. Y151012100). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Jinap S, Hajeb P (2010) Glutamate. Its applications in food and contribution to health. Appetite 55: 1–10. [DOI] [PubMed] [Google Scholar]
- 2. Blachier F, Boutry C, Bos C, Tomé D (2009) Metabolism and functions of L-glutamate in the epithelial cells of the small and large intestines. Am J Clin Nutr 90 3: 814S–821S. [DOI] [PubMed] [Google Scholar]
- 3. Rezaei R, Knabe DA, Tekwe CD, Dahanayaka S, Ficken MD, et al. (2013) Dietary supplementation with monosodium glutamate is safe and improves growth performance in post weaning pigs. Amino acids 44 3: 911–923. [DOI] [PubMed] [Google Scholar]
- 4. Paddon-Jones D, Sheffield-Moore M, Zhang XJ, Volpi E, Wolf SE, et al. (2004) Amino acid ingestion improves muscle protein synthesis in the young and elderly. Am J Physiol Endocrinol Metab 286: E321–E328. [DOI] [PubMed] [Google Scholar]
- 5. Nakashima K, Ishida A, Yamazaki M, Abe H (2005) Leucine suppresses myofibrillar proteolysis by down-regulating ubiquitin-proteasome pathway in chick skeletal muscles. Biochem Biophys Res Commun 336: 660–666. [DOI] [PubMed] [Google Scholar]
- 6. Cui Z, Dibley MJ (2012) Trends in dietary energy, fat, carbohydrate and protein intake in Chinese children and adolescents from 1991 to 2009. Br J Nutr 108: 1292–1299. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Popkin BM (2002) The shift in stages of the nutrition transition in the developing world differs from past experiences!. Public Health Nutr 5: 205–214. [DOI] [PubMed] [Google Scholar]
- 8. van der Laan JW, Brightwell J, McAnulty P, Ratky J, Stark C, et al. (2010) Regulatory acceptability of the minipig in the development of pharmaceuticals, chemicals and other products. J Pharmacol Toxicol Methods 62: 184–195. [DOI] [PubMed] [Google Scholar]
- 9.Schmid RD (2002) Taschenatlas der Biotechnologie und Gentechnik. Weinheim: Wiley-VCH. [Google Scholar]
- 10. Wright JD, Wang CY (2010) Trends in intake of energy and macronutrients in adults from 1999–2000 through 2007–2008. NCHS Data Brief 49: 1–8. [PubMed] [Google Scholar]
- 11. Go G, Wu G, Silvey DT, Choi S, Li X, et al. (2012) Lipid metabolism in pigs fed supplemental conjugated linoleic acid and/or dietary Arginine. Amino Acids 43: 1713–1726. [DOI] [PubMed] [Google Scholar]
- 12. Tan B, Li X, Wu G, Kong X, Liu Z, et al. (2012) Dynamic changes in blood flow and oxygen consumption in the portal-drained viscera of growing pigs receiving acute administration of L -Arginine. Amino Acids 43: 2481–2489. [DOI] [PubMed] [Google Scholar]
- 13. Kong XF, Wu GY, Liao YP, Hou ZP, Liu HJ, et al. (2007) Effects of Chinese herbal ultra-fine powder as a dietary additive on growth performance, serum metabolites and intestinal health in early-weaned piglets. Livest Sci 108: 272–275. [Google Scholar]
- 14. Noguchi Y, Zhang QW, Sugimoto T, Furuhata Y, Sakai R, et al. (2006) Network analysis of plasma and tissue AAs and the generation of an amino index for potential diagnostic use. Am J Clin Nutr 83: 513S–519S. [DOI] [PubMed] [Google Scholar]
- 15. Mellinkoff SM, Frankland M, Schwabe AD, Kellner HC, Greipel M, et al. (1965) Some effects of dietary fat upon steroid and AA metabolism. Am j clin nutr 16: 232–237. [DOI] [PubMed] [Google Scholar]
- 16. Novak EM, Keller BO, Innis SM (2012) Metabolic development in the liver and the implications of the n-3 fatty acid supply. Am J Physiol Gastrointest Liver Physiol 302: G250–G259. [DOI] [PubMed] [Google Scholar]
- 17. Hiroaki O (2006) Functions of Sulfur-Containing amino acids in Lipid Metabolism. J Nutr 136: 1666S–1669S. [DOI] [PubMed] [Google Scholar]
- 18. Zai H, Kusano M, Hosaka H, Shimoyama Y, Nagoshi A, et al. (2009) Monosodium L-glutamate added to a high-energy, high-protein liquid diet promotes gastric emptying. Am J Clin Nutr 89: 431–435. [DOI] [PubMed] [Google Scholar]
- 19. Boutry C, Matsumoto H, Airinei G, Benamouzig R, Tomé D, et al. (2011) Monosodium glutamate raises antral distension and plasma amino acid after a standard meal in humans. Am J Physiol Gastrointest Liver Physiol 300 1: G137–45. [DOI] [PubMed] [Google Scholar]
- 20. Bauchart-Thevret C, Stoll B, Benight NM, Olutoye O, Lazar D, et al. (2013) Supplementing monosodium glutamate to partial enteral nutrition slows gastric emptying in preterm pigs (1–3). J Nutr 143 5: 563–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Reeds PJ, Burrin DG, Stoll B, Jahoor F (2000) Intestinal glutamate metabolism. J Nutr 130 suppl: 978S–82S. [DOI] [PubMed] [Google Scholar]
- 22. Davila AM, Blachier F, Gotteland M, Andriamihaja M, Benetti PH, et al. (2013) Intestinal luminal nitrogen metabolism: role of the gut microbiota and consequences for the host. Pharmacol Res 68 1: 95–107. [DOI] [PubMed] [Google Scholar]
- 23. Moreira AP, Texeira TF, Ferreira AB, Peluzio Mdo C, Alfenas Rde C (2012) Influence of a high-fat diet on gut microbiota, intestinal permeability and metabolic endotoxaemia. Br J Nutr 108: 801–809. [DOI] [PubMed] [Google Scholar]
- 24. Turnbaugh PJ (2012) Microbiology: fat, bile and gut microbes. Nature 487: 47–48. [DOI] [PubMed] [Google Scholar]
- 25. Blachier F, Guihot-Joubrel G, Vaugelade P, Le Boucher J, Bernard F, et al. (1999) Portal hyperglutamatemia after dietary supplementation with monosodium glutamate in pigs. Digestion 60: 349–357. [DOI] [PubMed] [Google Scholar]
- 26. Janeczko MJ, Stoll B, Chang X, Guan X, Burrin DG (2007) Extensive gut metabolism limits the intestinal absorption of excessive supplemental dietary glutamate loads in infant pigs. J Nutr 137: 2384–2390. [DOI] [PubMed] [Google Scholar]
- 27. King AJ, Levey AS (1993) Dietary protein and renal function. J Am Soc Nephrol 3: 1723–1737. [DOI] [PubMed] [Google Scholar]
- 28. Friedman AN (2004) High-protein diets: potential effects on the kidney in renal health and disease. Am J Kidney Dis 44: 950–962. [DOI] [PubMed] [Google Scholar]
- 29. Mong MC, Chao CY, Yin MC (2011) Histidine and carnosine alleviated hepatic steatosis in mice consumed high saturated fat diet. Eur J Pharmacol 653: 82–88. [DOI] [PubMed] [Google Scholar]
- 30. Graham TE, MacLean DA (1998) Ammonia and amino acid metabolism in skeletal muscle: human, rodent and canine models. Med Sci Sports Exerc 30: 34–46. [DOI] [PubMed] [Google Scholar]
- 31. Kopple JD (2007) Phenylalanine and tyrosine metabolism in chronic kidney failure. J Nutr 137: 1586S–1590S. [DOI] [PubMed] [Google Scholar]
- 32. Farombi EO, Onyema OO (2006) Monosodium glutamate-induced oxidative damage and genotoxicity in the rat: modulatory role of vitamin C, vitamin E and quercetin. Hum Exp Toxicol 25: 251–259. [DOI] [PubMed] [Google Scholar]
- 33. Buse MG, Reid SS (1975) Leucine: a possible regulator of protein turnover in muscle. J Clin Invest 56: 1250–1261. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Chua B, Siehl DL, Morgan HE (1979) Effect of leucine and metabolites of branched-chain amino acids on protein turnover in heart. J Biol Chem 254: 8358–8362. [PubMed] [Google Scholar]
- 35. Garlick PJ (2005) The role of leucine in the regulation of protein metabolism. J Nutr 135: 1553S–1556S. [DOI] [PubMed] [Google Scholar]
- 36. Tizianello A, Deferrari G, Gurreri G, Robaudo C (1980) Renal metabolism of amino acids and ammonia in subjects with normal renal function and in patients with chronic renal insufficiency. J Clin Invest 65: 1162–1173. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Owen EE, Robinson RR (1963) Amino acid extraction and ammonia metabolism by the human kidney during the prolonged administration of ammonium chloride. J Clin Invest 42: 263–276. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Tessari P, Garibotto G (2000) Inter-organ amino acid exchange. Curr Opin Clin Nutr Metab Care 3: 51–57. [DOI] [PubMed] [Google Scholar]
- 39. van de Poll MC, Soeters PB, Deutz NE, Fearon KC, Dejong CH (2004) Renal metabolism of AAs: its role in interorgan amino acid exchange. Am J Clin Nutr 79: 185–197. [DOI] [PubMed] [Google Scholar]
- 40. Vazquez JA, Morse EL, Adibi SA (1985) Effect of dietary fat, carbohydrate, and protein on branched-chain amino acid catabolism during caloric restriction. J Clin Invest 76: 737–743. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Young GA, Swanepoel CR, Croft MR, Hobson SM, Parsons FM (1982) Anthropometry and plasma valine, amino acids, and proteins in the nutritional assessment of hemodialysis patients. Kidney Int 21: 492–499. [DOI] [PubMed] [Google Scholar]
- 42. Harris CI, Milne G (1979) Urinary excretion of 3-methyl histidine in cattle as a measure of muscle protein degradation. Proc Nutr Soc 38: 11A. [PubMed] [Google Scholar]