Abstract
Multidrug-resistant Acinetobacter baumannii (MDRAB) is an increasing problem worldwide. Prevalence of carbapenem resistance in Acinetobacter spp. due to acquired carbapenemase genes is not known in Finland. The purpose of this study was to examine prevalence and clonal spread of multiresistant A. baumannii group species, and their carbapenemase genes. A total of 55 Acinetobacter isolates were evaluated with repetitive PCR (DiversiLab) to analyse clonality of isolates, in conjunction with antimicrobial susceptibility profile for ampicillin/sulbactam, colistin, imipenem, meropenem, rifampicin and tigecycline. In addition, a new real-time PCR assay, detecting most clinically important carbapenemase genes just in two multiplex reactions, was developed. The assay detects genes for KPC, VIM, IMP, GES-1/-10, OXA-48, NDM, GIM-1, SPM-1, IMI/NMC-A, SME, CMY-10, SFC-1, SIM-1, OXA-23-like, OXA-24/40-like, OXA-58 and ISAbaI-OXA-51-like junction, and allows confident detection of isolates harbouring acquired carbapenemase genes. There was a time-dependent, clonal spread of multiresistant A. baumannii strongly correlating with carbapenamase gene profile, at least in this geographically restricted study material. The new carbapenemase screening assay was able to detect all the genes correctly suggesting it might be suitable for epidemiologic screening purposes in clinical laboratories.
Introduction
Acinetobacter baumannii is a hospital-acquired pathogen which commonly causes pneumonia, bloodstream infections, meningitis, wound infections and urinary tract infections, especially in patients with impaired host defences. A. baumannii isolates are resistant to many antimicrobial classes: fluoroqinolones, tetracyclines, cephalosporines and aminoglycosides [1]. However, today carbapenem resistance is more frequently encountered [1]–[3]. In A. baumannii carbapenem resistance is usually conferred by carbapenem-hydrolyzing class D oxacillinases (CHDLs), including OXA-23-like (bla OXA-23-like), OXA-40-like (bla OXA-40-like), OXA-58-like (bla OXA-58-like), and OXA-143-like (bla OXA-143-like) oxacillinases. Additionally A. baumannii has the intrinsic OXA-51-like (bla OXA-51-like) oxacillinase [4], [5]. Although CHDLs exhibit weak carbapenem hydrolysis, they can confer resistance when overexpressed. This resistance is mediated through a combination of naturally low permeability to β-lactams, efflux pumps and ISAba elements located upstream of the gene, providing a strong promoter activity [6]. In addition, A. baumannii may harbour many other carbapenemases more commonly found among Enterobacteriaceae and Pseudomonas species [7].
To determine genetic and epidemiological relatedness, genomic fingerprinting of clinical isolates is required. One of the most effective method is the repetitive extragenic palindromic sequence-based polymerase chain reaction (rep-PCR), which is commercially available known as the DiversiLab microbial typing system (bioMérieux, Marcy L'Etoile, France) [8]. This system has been proven useful in the typing of A. baumannii and has demonstrated good discriminatory ability, comparable with pulsed-field gel electroproresis (PFGE) and multilocus sequence typing (MLST) [9], [10]. Recently this rep-PCR typing system, DiversiLab, has identified eight carbapenem-resistant A. baumannii clonal lineages (WW1 to WW8) that are distributed worldwide [4]. DiversiLab fingerprints between laboratories were recently tested and clustering was found to be conserved [11].
The carbapenem resistance has recently attracted new interest as a subset among tens of gene families has spread to Enterobacteriaceae [12]–[14], despite a much longer history among Pseudomonas and Acinetobacter species. A. baumannii may harbour most of the acquired carbapenemase genes within Enterobacteriaceae, and Pseudomonas in addition to their characteristics CDHL genes [7].
Recently, new molecular assays have been described to detect most prevalent carbapenemase genes [15], or a subset of A. baumannii selective carbapenemase genes. Due to limited gene set, or technical limitations, most new tests are not suitable for clinical routine monitoring in low prevalence settings [16]. In addition, combinations of other resistance mechanisms, such as reduced permeability due porin mutations, or defect, and efflux pumps in conjunction with ampC β-lactamases are the most common cause of carbapenem resistance in low prevalence areas [14]. Therefore, an imipenem hydrolysis test or dedicated MALDI-TOF [17] and more extensive screening of resistance mechanisms in a reference laboratory are often needed to reliably exclude carbapenemase genes.
The aim of this study was to investigate the carbapenemase genes of A. baumannii and the correlation between these genes and clonal lineages. The feasibility of a new real-time PCR assay was tested for screening of most important carbapenemase genes detected among A. baumannii, Enterobacteriaceae, and Pseudomonas species.
Materials and Methods
Bacterial strains and culture conditions
A total of 55 Acinetobacter isolates from 44 patients were detected. 51 isolates with reduced susceptibility to carbapenem from HUSLAB (Laboratory of Helsinki University Central Hospital) between Jun 18th 1993 and Jan 18th 2008 were collected and four Acinetobacter isolates suscebtible to carbapenems were included as controls. Helsinki University Hospital is responsible for the secondary and tertiary care of app. 1.5 million people. The culture samples from this area received by HUSLAB are both from these hospitals as well as from outpatients of this geographical area, the Helsinki and Uusimaa district in southern Finland. The culture samples in this study were from patients treated in nine different hospitals (Table S1).
Acinetobacter isolates were cultured in aerobic atmosphere on chocolate and cysteine lactose electrolyte deficient (CLED) agar and incubated at 35°C for 18 h. Colonies with typical morphology and biochemistry were identified as A. baumannii complex. Identification with the VITEK 2 (bioMérieux, Marcy L'Etoile, France) system with GN card was performed, as well. 16S rRNA gene sequencing was performed when biochemical identification was equivocal. In addition a house-keeping OXA-51-like (bla OXA-51-like) gene was detected separately within all the clinical isolates with reduced susceptibility to carbapenems, whereas carbapenem susceptible control strains did not harbour OXA-51-like genes.
Antimicrobial susceptibility testing was performed by the disk diffusion method according to the CLSI guidelines (http://www.clsi.org). MICs for ampicillin/sulbactam, colistin, imipenem, meropenem, rifampicin and tigecycline by E-test (AB BIODISC, Solna, Sweden) were determined on Mueller-Hinton agar according to manufacturer's instructions.
Design of multiplex Real-Time carbapenemase gene screening assay
The assay was designed to detect most clinically relevant carbapenemase genes described within A. baumannii, Pseudomonas aeruginosa, and Enterobacteriaceae species. The design was performed using AlleleID software (http://www.premierbiosoft.com), taking into account all the globally known sub-variants in NCBI data base. For practical purposes, the assay was divided in two multiplex reactions consisting of nine and eight gene families, respectively. The assay was validated in vitro using 43 positive control strains (Table 1), which were confirmed at National Institute for Health and Welfare, Turku, Finland [14]. Since the target primer regions were fully conserved in silico, it was considered adequate to demonstrate PCR performance with one or more control species representing all the gene variants. In addition, synthetic gene constructs for SFC, CMY-1/10, SIM, SME, OXA-25, and OXA-58 genes containing a partial, non-functional resistance gene in E. coli plasmid (pIDTsmart), including the amplicon and app. 20 bp upstream and downstream sequence (Integrated DNA Technologies Inc, CA, USA). The plasmid was then transfected into the TOP10 strain according to manufacturer's instructions. The construct was ordered from IDT using pSMART plasmid, blunt-ended, containing a kanamycin resistance gene. The SFC, and SIM the control strains were obtained later (as a kind gift from Dr. Correia and Dr. Yunsop Chong and Kyungwon Lee, consequently). All the gene products were confirmed by sequencing with reference primers, or the gene specific primers alone, when published reference primers were not available. For additional species identification, OXA-51 gene (bla OXA-51-like), with or without ISAbaI, was detected separately, using F_oxa51_001 AATTTATTTAACGAAGCACACACTACGG, and R_oxa51_001 GCACGAGCAAGATCATTACCATAGC primers and the PCR program shown below.
Table 1. Description of validation isolates.
| Target | Species | Isolation site | Travel history |
| GES-1 | P. aeruginosa | wound | no |
| GES-14 | K. pneumoniae | trachea | n/a |
| GES-5 | P. aeruginosa | incision wound | no |
| GES-5 | P. aeruginosa | incision wound | no |
| IMI-1 | E. cloacae | stool | Thailand |
| IMI-2 | E.cloacae | wound | no |
| IMP-15 | P. aeruginosa | blood | no |
| IMP-15 | P. aeruginosa | wound | no |
| IMP-15 | P. aeruginosa | incision wound | no |
| IMP-15 | P. aeruginosa | urine | no |
| IMP-15 | P. aeruginosa | urine | n/a |
| IMP-15 | P. aeruginosa | incision wound | n/a |
| IMP-15 | P. aeruginosa | urine | n/a |
| ISAbaI-OXA-51 | A. baumannii | stool | Spain |
| ISAbaI-OXA-51 | A. baumannii | stool | no |
| ISAbaI-OXA-51 | A. baumannii | trachea | no |
| KPC | K. pneumoniae | stool | US |
| KPC-2 | K. pneumoniae | stool | Greece |
| KPC-2 | K. pneumoniae | wound | Italy |
| KPC-2 | K. pneumoniae | urine | no |
| KPC-2 | K. pneumoniae | blood | Mexico/US |
| KPC-2 | K. pneumoniae | urine | no |
| NDM-1 | K. pneumoniae | stool | n/a |
| OXA-23 | A. baumannii | blood | n/a |
| OXA-23 | A. baumannii | wound | no |
| OXA-23 | A. baumannii | trachea | Thailand |
| OXA-48 | E. coli | stool | Syria |
| OXA-48 | K. pneumoniae | stool | Turkey |
| OXA-48 | A. baumannii | stool | n/a |
| OXA-58 | A. baumannii | stool | Tunis |
| OXA-58 | A. baumannii | wound | no |
| OXA-58 | A. baumannii | wound | no |
| OXA-58 | A. baumannii | stool | Greece |
| OXA-58 | A. baumannii | incision wound | n/a |
| OXA-58 | A. baumannii | urine | no |
| SFC-1 | S. fonticola | control strain | Portugal |
| SIM-1 | A. baumannii | control strain | South-Korea |
| SME | S. marcescens | control strain | n/a |
| VIM | P. aeruginosa | stool | Thailand |
| VIM | K. pneumoniae | stool | Spain |
| VIM | K. pneumoniae | stool | Greece |
| VIM | K. pneumoniae | CV cathether | n/a |
| VIM-1 | K. pneumoniae | blood | Greece |
| VIM-2 | P. aeruginosa | trachea | Russia |
| VIM-2 | P. aeruginosa | trachea | Russia |
The specificity was tested with 58 carbapenem susceptible Enterobacteriaceae isolates (Table S2) [18], and 710 isolates with putative reduced susceptibility A. baumannii, P. aeruginosa and Enterobacteriaceae isolated from clinical samples during 2008–2011. These isolates were selected among samples growing on CHROMagar ESBL, or CHROMagar KPC plates (bioMérieux, Marcy L'Etoile, France), or from other culture isolates with disk diffusion diameter <25 mm for ertapenem, or <22 mm for meropenem, or MIC>0,5 mg/l for ertapenem and meropenem.
Validation of multiplex Real-Time PCR assay
Template DNA was extracted from a single colony on CLED plate grown overnight, and re-suspended in 100 µl TE-buffer (0,5 McF) and boiled 15 min. Each 20 µl real time PCR-reaction included 10 µl Maxima SYBR Green qPCR Master Mix (2X) (Scientific Fermentas, Schwerte, Germany), 6 µl Oligomix 1 or 2 (Table 2), IDT (Integrated DNA Technologies, Inc.), 3 µl H20, and 1 µl DNA template. Amplification was performed as follows: 95°C 10 min initial denaturation, 30 cycles with 95°C 20 sec denaturation, 58°C 30 sec annealing and extension, final extension 58°C 1 min and final denaturation 95°C 30 sec (MxPro 3005P, Stratagene, La Jolla, CA, USA). Melting curve was determined between temperatures 58–95°C. Control strains are presented in Table 3.
Table 2. Primers used for amplification of resistance genes by polymerase chain reaction (PCR).
| Primer | Sequence 5′- 3′ | Reference | Oligomix |
| F_ges_001 | ACACCTGGCGACCTCAGAGATAC | This study | 1 |
| R_ges_001 | ACTTGACCGACAGAGGCAACTAATTC | This study | 1 |
| F_gim_001 | CGAATGGGTTGGTAGTTCTGGATAATAATC | This study | 1 |
| R_gim_001 | ATGTGTATGTAGGAATTGACTTTGAATTTAGC | This study | 1 |
| F_imi1_001 | AAACAAGGGAATGGGTGGAGACTG | This study | 1 |
| R_imi1_001 | AAGGTATGCTTTGAATTTGCGTTG | This study | 1 |
| F_imp_10 | AATAATGACGCCTATCTAATTGACACTCC | This study | 1 |
| R_imp_10 | ATTCCACCCGTACTGTCGCTATG | This study | 1 |
| F_imp_11 | TGACGCCTATCTGATTGACACTCC | This study | 1 |
| R_imp_11 | GCTGTCGCTATGGAAATGTGAGG | This study | 1 |
| F_kpc_001 | CAGCGGCAGCAGTTTGTTGATTG | This study | 1 |
| R_kpc_001 | CCAGACGACGGCATAGTCATTTG | This study | 1 |
| F_oxa48_003 | TTACTGAACATAAATCACAGGGCGTAG | This study | 1 |
| R_oxa48_003 | ATTATTCGTAAATCCTTGCTGCTTATTCTC | This study | 1 |
| F_sme_006 | CAGATGAGCGGTTCCCTTTATGC | This study | 1 |
| R_sme_006 | CAGAAGCCATATCACCTAATGTCATACC | This study | 1 |
| F_spm_001 | CCTACAATCTAACGGCGACCAAG | This study | 1 |
| R_spm_001 | AACGGCGAAGAGACAATGACAAC | This study | 1 |
| F_vim_03 | GTGTTTGGTCGCATATCGCAAC | This study | 1 |
| R_vim_03 | GCTGTATCAATCAAAAGCAACTCATC | This study | 1 |
| F_cmy_01 | CAGGTGCTCTTCAACAAG | This study | 2 |
| R_cmy_01 | CGCCCTCTTTCTTTCAAC | This study | 2 |
| F_IS51_01 | GTCATAGTATTCGTCGTTAGA | This study | 2 |
| R_IS51_01 | GTAAGAGTGCTTTAATGTTCATA | This study | 2 |
| F_ndm_01 | CGATCAAACCGTTGGAAG | This study | 2 |
| R_ndm_01 | AAGGAAAACTTGATGGAATTG | This study | 2 |
| F_oxa24_02 | ACTTTAGGTGAGGCAATG | This study | 2 |
| R_oxa24_02 | TAACTTCTTGTACTGGTGTAA | This study | 2 |
| F_oxa27_001 | ATATTTTACTTGCTATGTGGTTGCTTCTC | This study | 2 |
| R_oxa27_001 | TCTCCAATCCGATCAGGGCATTC | This study | 2 |
| F_oxa58_02 | GACAATTACACCTATACAAGAAG | This study | 2 |
| R_oxa58_02 | CGCTCTACATACAACATCTC | This study | 2 |
| F_sfc_01 | CCTGGTGATGATAGAGATAC | This study | 2 |
| R_sfc_01 | ATAATCGTTGGCTGTACC | This study | 2 |
| F_sim_01 | CTGCTGGGATAGAGTGGCTTAATAC | This study | 2 |
| R_sim_01 | TCAATAGTGATGCGTCTCCGATTTC | This study | 2 |
Table 3. Control strains.
| Gene | Bacterium | Ct (50 ng/µl) | T(m) | PCR reaction |
| GES-1 | K. pneumoniae | 23 | 84 | PCR1 |
| GIM-1 | P. aeruginosa | 16 | 80 | PCR1 |
| IMI-2 | E. cloacae | 14 | 78 | PCR1 |
| IMP-15 | P. aeruginosa | 15 | 77 | PCR1 |
| KPC-2 | K. pneumoniae | 17 | 87 | PCR1 |
| OXA-48 | E. coli | 15 | 75 | PCR1 |
| SME | S. marcescens | 11 | 77 | PCR1 |
| SPM-1 | P. aeruginosa | 16 | 80 | PCR1 |
| VIM-1 | K. pneumoniae | 17 | 81 | PCR1 |
| CMY-1/10 | E.coli * | 16 | 88 | PCR2 |
| ISaba1-OXA-51- family | Acinetob. spp | 19 | 72 | PCR2 |
| NDM-1 | K. pneumoniae | 18 | 87 | PCR2 |
| OXA-23- family | Acinetob. spp | 22 | 78 | PCR2 |
| OXA-24/40- family | Acinetob. spp | 17 | 79 | PCR2 |
| OXA-58 | E.coli * | 15 | 76 | PCR2 |
| SFC-1 | E.coli * | 16 | 81 | PCR2 |
| SIM-1 | Acinetob. spp | 21 | 80 | PCR2 |
= gene construct containing the partial, non-functional resistance gene in E. coli plasmid.
The PCR was run as a preformed oligonucleotide mixture with master mixture and template to avoid quality variations between the runs. A new oligonucleotide mixture was always tested with all the panel targets with set expected 19–25 Cq range in qPCR depending on the target (Table 3). The oligonucleotide mixture was stored in stock concentrations in small aliquots, and a working dilution was formed for short term usage only. In addition, each PCR run including a representative negative and positive control for the given multiplex: KPC for multiplex 1 and NDM for multiplex 2. An acceptance range for positive controls (target +/−3 Cq) was implemented to accept test series.
All positive isolates were confirmed by further analysing by an independent, conventional PCR and by sequencing the carbapenemase gene. Primers used in sequencing are presented in Table 4. Reaction included 2,5 mM dNTP 1,6 µl, HotStarTaq polymerase (Qiagen, Helsinki, Finland), 0,1 µl, Polymerase Buffer 10×2 µl, primer F and R 1 µl each, H20 13,3 µl and 1 µl template making a total of 20 µl reaction volume. Amplification was performed as follows: initial denaturation 95°C 15 min, 35 cycles with denaturation 94°C 30 sec, variable annealing temperature 55/60/62°C 30 sec depending on the carbapenemase gene to be amplified, extension 72°C 10 min, final extension 72°C 10 min (DNA Engine Tetrad 2, Peltier Thermal Cycler, BioRad, CA, USA).
Table 4. Primers used for sequencing of resistance genes by polymerase chain reaction (PCR).
| Gene | Primer | Sequence (5′- 3′) | Size (bp) | T (m) | Reference |
| CMY | F_cmy_s1 | TAAGATACTTCGGATGAGGAG | 695 | 60 | |
| R_cmy_s1 | GCATCTTCTCGGATGAATC | This study | |||
| GES-C | GTTTTGCAATGTGCTCAACG | 371 | 60 | ||
| GES | GES-D | TGCCATAGCAATAGGCGTAG | [25] | ||
| GIM-1F | AGAACCTTGACCGAACGCAG | 748 | 60 | ||
| GIM | GIM-1R | ACTCATGACTCCTCACGAGG | [25] | ||
| IMI-A | ATAGCCATCCTTGTTTAGCTC | 818 | 55 | ||
| IMI | IMI-B | TCTGCGATTACTTTATCCTC | [25] | ||
| F_IMP-1 | TGAGCAAGTTATCTGTATTC | 740 | 55 | ||
| IMP | R_IMP-1 | TTAGTTGCTTGGTTTTGATG | [25] | ||
| F_IMP-2 | GGCAGTCGCCCTAAAACAAA | 737 | 55 | ||
| IMP | R_IMP-2 | TAGTTACTTGGCTGTGATGG | [25] | ||
| ISaba1/OXA-51 | F_IS51_01 | GTCATAGTATTCGTCGTTAGA | 301 | 60 | |
| R_oxa51_001 | GCACGAGCAAGATCATTACCATAGC | This study | |||
| F_KPC | ATGTCACTGTATCGCCGTCT | 893 | 55 | ||
| KPC | R_KPC | TTTTCAGAGCCTTACTGCCC | [25] | ||
| NDM | F_ndm_s1 | GACAACGCATTGGCATAAG | 447 | 60 | |
| R_ndm_s1 | AAAGGAAAACTTGATGGAATTG | This study | |||
| OXA-23 family | F_oxa23_s1 | GTGTCATAGTATTCGTCGTTAG | 592 | 60 | |
| R_oxa23_s1 | TATCAACCTGCTGTCCAAT | This study | |||
| OXA-24 family | F_oxa25_s1 | ATTAGGGCTTGAGTGGAAA | 521 | 60 | |
| R_oxa25_s1 | TTGTATGATTGTCAACTGCTAT | This study | |||
| OXA-48A | TTGGTGGCATCGATTATCGG | 744 | 62 | ||
| OXA-48 | OXA-48B | GAGCACTTCTTTTGTGATGGC | [25] | ||
| SFC | F_sfc_s1 | CTCATTCTCCTGTGACTGA | 351 | 60 | |
| R_sfc_s1 | TTGCTCCTCCTGTTGTATT | This study | |||
| SIM1-F | TACAAGGGATTCGGCATCG | 571 | 60 | ||
| SIM | SIM1-R | TAATGGCCTGTTCCCATGTG | [25] | ||
| F_sme_s1 | AAGGCTCAGGTATGACATT | 410 | 60 | ||
| SME | R_sme_s1 | GGCATAATCATTCGCAGTA | This study | ||
| SPM-1F | CCTACAATCTAACGGCGACC | 650 | 55 | ||
| SPM | SPM-1R | TCGCCGTGTCCAGGTATAAC | [25] | ||
| F_VIM-1 | TTATGGAGCAGCAACCGATGT | 920 | 60 | ||
| VIM | R_VIM-1 | CAAAAGTCCCGCTCCAACGA | [25] | ||
| F_VIM-2 | AAAGTTATGCCGCACTCACC | 865 | 60 | ||
| VIM | R_VIM-2 | TGCAACTTCATGTTATGCCG | [25] |
Rep-PCR
DNA was extracted from colonies on CLED plates using the UltraClean microbial DNA isolation kit (Mo Bio Laboratories, Solona Beach, CA, USA) and diluted to 35 ng/µl. The DNA was amplified using the DiversiLab Acinetobacter kit (Bacterial Barcodes, Inc. cat no DL-AB01, Athens, GA, USA) for DNA fingerprinting following the manufacturer's instructions. PCR was run on preheated thermal cycler (DNA Engine Tetrad 2, Peltier Thermal Cycler BioRad, Hercules, CA, USA) using the parameters according to manufacturer's recommendations. The kit specific positive and negative controls were run with each reaction set for the validation of amplification. The rep-PCR products were detected and the amplicons were separated using microfluidics lab-on-a-chip technology and analysed using the DiversiLab system (Bacterial Barcodes, Inc.). Further analysis was performed with the web-based DiversiLab software (version 3.4) using the band-based modified Kullback-Leibler distance for the calculation of percent similarities. The manufacturer provides guidelines for strain-level discrimination; similarity more than 97% is considered as indistinguishable (no differences in fingerprints), similarity more than 95% as similar (1-2 band difference in fingerprints) and similarity less than 95% as different. In this study optimal cut-off for clustering was 95%.
Ethics statement
The bacterial isolates analyzed in this study belong to the microbiological collections of HUSLAB (Laboratory of Helsinki University Central Hospital) and were obtained as part of routine clinical care in the past. Furthermore, all patient identifiers had been previously removed and data were analyzed anonymously. As the isolates were not clinical samples in the legal sense, no written or verbal consent was needed.
Results
Characterization of carbapenemase genes with A. baumannii
All the strains were analysed for 17 carbapenemase gene groups using the new assay. Among these A. baumannii isolates the most prevalent gene was OXA-23-like (bla OXA-23-like). In addition we also found eight OXA 58 (bla OXA-58) genes and one OXA-24-like (bla OXA-24-like) gene (Figure 1). No other carbapenemase genes, including genes for KPC, VIM, IMP, GES-1/-10, OXA-48, NDM, GIM-1, SPM-1, IMI/NMC-A, SME, CMY-10, SFC-1, and SIM-1, were detected. The ISAbaI-OXA-51-like junction PCR was negative in all strains, as well (data not shown).
Figure 1. DiversiLab analysis.
Dendogram and computer-generated image of rep-PCR banding patterns showing clustering between oxacillinase genes; OXA-23-like, OXA-24-like and OXA-58.
Temporal variation of prevalent, endemic A. baumannii clones
A time dependent clonal variation among the analysed A. baumannii was observed. A predominant clone was detected during the follow-up period, typically lasting a few years, which was then substituted by a new clone (Figure 2). Briefly, first a few isolates, harbouring a mobile element with OXA-58 gene, appeared 1993–1996 and 2003–2006 (Clone 1, Figure 1), which was not detected in the following years, followed by a clone harbouring a mobile OXA-23-like gene (Clone 2, Figure 1). The results were consistent with DiversiLab typing, and characteristic antibiotic susceptibility profile associated with the OXA clones analyzed. Only five out of 55 species having OXA-23/-58 gene displayed a different rep-PCR profile. Based on rep-PCR analysis, two predominant clones were detected. One isolate having OXA-24-like gene was unique in DiversiLab analysis, as well. As expected, all the control isolates from patient with no known connection were unique in their rep-PCR profiles.
Figure 2. Time-dependent distribution of acquired oxacillinase genes; OXA-23-like, OXA-24-like and OXA-58.
Association of antibiotic susceptibility with clonality and carbapenemase gene profile
In our study, OXA-58 isolates had lower MIC-values for to meropenem than OXA-23-like positive isolates that systematically had higher MIC-values (Table 5). The isolates with non-acquired OXA-gene, displayed a marked variation and they included also some carbapenem resistant isolates. The control isolates (Figure 1) consisted of Acinetobacter spp not harbouring any of the OXA genes analyzed. These isolates were all carbapenem susceptible (Table 5).
Table 5. MIC distributions for 55 Acinetobacter isolates.
| Cumulative percentage of isolates inhibited at MIC (mg/l) value of: | |||||||||||
| Drug | ≤0.5 | ≤1 | ≤2 | ≤4 | ≤8 | ≤16 | ≤32 | ≤64 | ≤128 | ≤256 | Isolate |
| MP | 0,0 | 0,0 | 12,5 | 75,0 | 75,0 | 87,5 | 100,0 | OXA-58 | |||
| IP | 0,0 | 0,0 | 0,0 | 0,0 | 12,5 | 37,5 | 100,0 | OXA-58 | |||
| RI | 0,0 | 0,0 | 0,0 | 75,0 | 75,0 | 75,0 | 100,0 | OXA-58 | |||
| AB | 0,0 | 0,0 | 12,5 | 37,5 | 50,0 | 50,0 | 87,5 | 87,5 | 87,5 | 100,0 | OXA-58 |
| TGC | 0,0 | 12,5 | 25,0 | 87,5 | 87,5 | 87,5 | 87,5 | 100,0 | OXA-58 | ||
| CO | 100,0 | OXA-58 | |||||||||
| MP | 0,0 | 0,0 | 0,0 | 0,0 | 0,0 | 0,0 | 100,0 | OXA-23 | |||
| IP | 0,0 | 0,0 | 0,0 | 0,0 | 0,0 | 3,0 | 100,0 | OXA-23 | |||
| RI | 0,0 | 0,0 | 0,0 | 85,0 | 88,0 | 88,0 | 100,0 | OXA-23 | |||
| AB | 0,0 | 0,0 | 0,0 | 6,0 | 12,0 | 74,0 | 89,0 | 95,0 | 95,0 | 100,0 | OXA-23 |
| TGC | 0,0 | 6,0 | 12,0 | 94,0 | 97,0 | 100,0 | OXA-23 | ||||
| CO | 100,0 | OXA-23 | |||||||||
| MP | 0,0 | 0,0 | 0,0 | 0,0 | 0,0 | 0,0 | 100,0 | OXA-24 | |||
| IP | 0,0 | 0,0 | 0,0 | 0,0 | 0,0 | 0,0 | 100,0 | OXA-24 | |||
| RI | 0,0 | 0,0 | 0,0 | 100,0 | OXA-24 | ||||||
| AB | 0,0 | 0,0 | 0,0 | 0,0 | 0,0 | 0,0 | 0,0 | 0,0 | 0,0 | 100,0 | OXA-24 |
| TGC | 0,0 | 0,0 | 100,0 | OXA-24 | |||||||
| CO | 100,0 | OXA-24 | |||||||||
| MP | 20,0 | 40,0 | 50,0 | 50,0 | 50,0 | 80,0 | 100,0 | non OXA | |||
| IP | 10,0 | 50,0 | 50,0 | 50,0 | 50,0 | 50,0 | 100,0 | non OXA | |||
| RI | 0,0 | 0,0 | 0,0 | 30,0 | 90,0 | 90,0 | 100,0 | non OXA | |||
| AB | 0,0 | 0,0 | 0,0 | 0,0 | 20,0 | 90,0 | 100,0 | non OXA | |||
| TGC | 0,0 | 0,0 | 0,0 | 70,0 | 100,0 | non OXA | |||||
| CO | 100,0 | non OXA | |||||||||
| MP | 75,0 | 100,0 | Control | ||||||||
| IP | 100,0 | Control | |||||||||
| RI | 0,0 | 25,0 | 50,0 | 50,0 | 75,0 | 100,0 | Control | ||||
| AB | 0,0 | 75,0 | 75,0 | 75,0 | 75,0 | 75,0 | 75,0 | 75,0 | 100,0 | Control | |
| TGC | 50,0 | 100,0 | Control | ||||||||
| CO | 100,0 | Control | |||||||||
MP, meropenem; IP, imipenem; RI, rifampicin; AB, ampicillin+sulbactam; TCG, tigecycline; CO, colistin.
Discussion
The carbapenemase producing multi-resistant gram negative rods are probably the most important challenge for hospital hygiene at the moment [13], [19]. The great variety of underlying mechanisms, in contrast to simple mecA or mecC in MRSA, possesses a significant challenge to clinical screening process. Phenotypes are highly variable and many overlapping other resistance mechanisms complicate any simple screening approach. A straight-forward, economical method suitable for routine clinical diagnostics has not been available yet. In this paper we demonstrate the good performance of a new multiplex real-time PCR assay, detecting most important carbapenemases based on melting curve analysis, by applying it to an epidemiologically important set of clinical A. baumannii isolates. In a striking contrast to carbapenemase producing Enterobacteriaceae, which were first detected in Finland 2008 [14], the carbapenem resistant A. baumannii were detected in Finland already three decades ago. This study highlights the emergence of carbapenem-resistant A. baumannii isolates carrying the bla OXA-23-like gene (Clone 1), which replaced the bla OXA-58 gene (Clone 2) in three years (Figure 2). These major clones might have been endemic.
The new carbapenemase detection assay was initially developed to detect carbapenemase producing Enterobacteriaceae isolates, but it also appeared to be a useful tool for P. aeruginosa and A. baumannii. After three years of clinical use, it has been proved to be sensitive and highly specific screening assay among more than 700 hundred isolates with reduced carbapenem susceptibility analysed to date [14]. One of the major problems related to molecular detection of many antibiotic resistance genes is the appearance of new genomic variants. For example, the variable regions of bla OXA-181 are up to 9% different from bla OXA-48 [20]. The new variants may not be detectable with the existing systems. To minimize the risk for false negative results, the primers were designed at conserved gene regions to achieve optimal amplification of all the current and forthcoming sub-variants. The SYBR Green chemistry was preferred to avoid false negative results due to minor mutations in the probe sequence. The probe based assays are often sensitive to just 1–2 mutations in probe sequence, whereas primers are usually less sensitive to minor target mutations. These design features were considered relevant to achieve a high exclusion power of clinically relevant, acquired carbapenemase genes among carbapenem resistant strains.
A. baumannii is a nosocomial pathogen, and epidemiological tools are important to develop effective strategies for better monitoring of MDRAB clinical isolates [21]. In this study we used rep-PCR because the method is suitable for comparison of isolate genetic profiles using standardized and automated format [22]. This method has previously demonstrated good discrimination ability of A. baumannii isolates [23], [24]. We found two major clones with DiversiLab (Clone 1 and 2, Figure 1.) harbouring most of the isolates with bla OXA-23-like and bla OXA-58 genes. There were only few exceptions. The cases were mostly from departments of treating patients with severe burn trauma, or intensive care units.
In this study, a good correlation between the carbapenemase gene and DiversiLab typing suggested that they both could be effectively applied for epidemiological screening of A. baumannii species. The new carbapenemase gene screening assay has been in clinical use for more than three years, and it has been a highly suitable method for rapid unequivocal identification of isolates harbouring acquired carbapenemase genes among Acinetobacter, Pseudomonas aeruginosa, and Enterobacteriaceae species. This study suggests that the new molecular methods could be successfully applied in clinical diagnostics to monitor acquired carbapenemase genes, provided that they are user-friendly and cost-effective as well.
Supporting Information
Acinetobacter isolate description.
(DOCX)
Species included in analytical specificity testing.
(DOCX)
Funding Statement
As a preliminary notice, however, HUSLAB has informed us that they may not be able to commit to all publication costs unlike previously agreed due to bad economical situation. Therefore, another fundign source, including the authors' new employee Mobidiag Ltd must be considered. (No agreement from their side yet). If they decide to grant some portion of the total amount, it will be a personal hand-out to this academic study, and in such case it is fair to state: The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. For the sake of clarity, JK's affiliation has changed after submission of the original manuscript version. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Dijkshoorn L, Nemec A, Seifert H (2007) An increasing threat in hospitals: multidrug-resistant Acinetobacter baumannii. Nat Rev Microbiol 5: 939–951. [DOI] [PubMed] [Google Scholar]
- 2. Kohlenberg A, Brummer S, Higgins PG, Sohr D, Piening BC, et al. (2009) Outbreak of carbapenem-resistant Acinetobacter baumannii carrying the carbapenemase OXA-23 in a German university medical centre. J Med Microbiol 58: 1499–1507. [DOI] [PubMed] [Google Scholar]
- 3. Peleg AY, Seifert H, Paterson DL (2008) Acinetobacter baumannii: emergence of a successful pathogen. Clin Microbiol Rev 21: 538–582. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Higgins PG, Dammhayn C, Hackel M, Seifert H (2010) Global spread of carbapenem-resistant Acinetobacter baumannii. J Antimicrob Chemother 65: 233–238. [DOI] [PubMed] [Google Scholar]
- 5. Poirel L, Naas T, Nordmann P (2010) Diversity, epidemiology, and genetics of class D beta-lactamases. Antimicrob Agents Chemother 54: 24–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Turton JF, Ward ME, Woodford N, Kaufmann ME, Pike R, et al. (2006) The role of ISAba1 in expression of OXA carbapenemase genes in Acinetobacter baumannii. FEMS Microbiol Lett 258: 72–77. [DOI] [PubMed] [Google Scholar]
- 7. Poirel L, Pitout JD, Nordmann P (2007) Carbapenemases: molecular diversity and clinical consequences. Future Microbiol 2: 501–512. [DOI] [PubMed] [Google Scholar]
- 8. Healy M, Huong J, Bittner T, Lising M, Frye S, et al. (2005) Microbial DNA typing by automated repetitive-sequence-based PCR. J Clin Microbiol 43: 199–207. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Yan ZQ, Shen DX, Cao JR, Chen R, Wei X, et al. (2010) Susceptibility patterns and molecular epidemiology of multidrug-resistant Acinetobacter baumannii strains from three military hospitals in China. Int J Antimicrob Agents 35: 269–273. [DOI] [PubMed] [Google Scholar]
- 10.Higgins PG, Janssen K, Fresen MM, Wisplinghoff H, Seifert H (2012) Molecular epidemiology of Acinetobacter baumannii bloodstream isolates from the United States 1995–2004 using rep-PCR and multilocus sequence typing. J Clin Microbiol 15.. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Higgins PG, Hujer AM, Hujer KM, Bonomo RA, Seifert H (2012) Interlaboratory reproducibility of DiversiLab rep-PCR typing and clustering of Acinetobacter baumannii isolates. J Med Microbiol 61: 137–141. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Miriagou V, Cornaglia G, Edelstein M, Galani I, Giske CG, et al. (2010) Acquired carbapenemases in Gram-negative bacterial pathogens: detection and surveillance issues. Clin Microbiol Infect 16: 112–122. [DOI] [PubMed] [Google Scholar]
- 13.Walsh TR (2010) Emerging carbapenemases: a global perspective. Int J Antimicrob Agents 36 (suppl): : 8–14. [DOI] [PubMed] [Google Scholar]
- 14.Osterblad M, Kirveskari J, Hakanen AJ, Tissari P, Vaara M, et al. (2012) Carbapenemase-producing Enterobacteriaceae in Finland: the first years (2008-11). J Antimicrob Chemother 31.. [DOI] [PubMed] [Google Scholar]
- 15. Poirel L, Walsh TR, Cuvillier V, Nordmann P (2011) Multiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis 70: 119–123. [DOI] [PubMed] [Google Scholar]
- 16. Kaase M, Szabados F, Wassill L, Gatermann SG (2012) Detection of carbapenemases in enterobacteriaceae by a commercial multiplex PCR. J Clin Microbiol 50: 3115–3118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Kempf M, Bakour S, Flaudrops C, Berrazeg M, Brunel JM, et al. (2012) Rapid detection of carbapenem resistance in Acinetobacter baumannii using matrix-assisted laser desorption ionization-time of flight mass spectrometry. PLoS One 7: e31676. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Antikainen J, Tarkka E, Haukka K, Siitonen A, Vaara M, et al. (2009) New 16-plex PCR method for rapid detection of diarrheagenic Escherichia coli directly from stool samples. Eur J Clin Microbiol Infect Dis 28: 899–908. [DOI] [PubMed] [Google Scholar]
- 19. Nordmann P, Cuzon G, Naas T (2009) The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect Dis 9: 228–236. [DOI] [PubMed] [Google Scholar]
- 20. Potron A, Nordmann P, Lafeuille E, Al Maskari Z, Al Rashdi F, et al. (2011) Characterization of OXA-181, a carbapenem-hydrolyzing class D beta-lactamase from Klebsiella pneumoniae. Antimicrob Agents Chemother 55: 4896–4899. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Runnegar N, Sidjabat H, Goh HM, Nimmo GR, Schembri MA, et al. (2010) Molecular epidemiology of multidrug-resistant Acinetobacter baumannii in a single institution over a 10-year period. J Clin Microbiol 48: 4051–4056. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Carretto E, Barbarini D, Farina C, Grosini A, Nicoletti P, et al. (2008) Use of the DiversiLab semiautomated repetitive-sequence-based polymerase chain reaction for epidemiologic analysis on Acinetobacter baumannii isolates in different Italian hospitals. Diagn Microbiol Infect Dis 60: 1–7. [DOI] [PubMed] [Google Scholar]
- 23. Fontana C, Favaro M, Minelli S, Bossa MC, Testore GP, et al. (2008) Acinetobacter baumannii in intensive care unit: a novel system to study clonal relationship among the isolates. BMC Infect Dis 8: 79. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Grisold AJ, Zarfel G, Strenger V, Feierl G, Leitner E, et al. (2010) Use of automated repetitive-sequence-based PCR for rapid laboratory confirmation of nosocomial outbreaks. J Infect 60: 44–51. [DOI] [PubMed] [Google Scholar]
- 25.Queenan AM, Bush K (2007) Carbapenemases: the versatile beta-lactamases. Clin Microbiol Rev 20: : 440–58, table of contents. [DOI] [PMC free article] [PubMed]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Acinetobacter isolate description.
(DOCX)
Species included in analytical specificity testing.
(DOCX)


