Lysophosphatidic acid induces vasodilation mediated by LPA₁ receptors, phospholipase C, and endothelial nitric oxide synthase

Abstract

Lysophosphatidic acid (LPA) has been implicated as a mediator of several cardiovascular functions, but its potential involvement in the control of vascular tone is obscure. Here, we show that both LPA (18:1) and VPC31143 (a synthetic agonist of LPA_1–3 receptors) relax intact mouse thoracic aorta with similar E_max values (53.9 and 51.9% of phenylephrine-induced precontraction), although the EC₅₀ of LPA- and VPC31143-induced vasorelaxations were different (400 vs. 15 nM, respectively). Mechanical removal of the endothelium or genetic deletion of endothelial nitric oxide synthase (eNOS) not only diminished vasorelaxation by LPA or VPC31143 but converted it to vasoconstriction. Freshly isolated mouse aortic endothelial cells expressed LPA₁, LPA₂, LPA₄ and LPA₅ transcripts. The LPA_1,3 antagonist Ki16425, the LPA₁ antagonist AM095, and the genetic deletion of LPA₁, but not that of LPA₂, abolished LPA-induced vasorelaxation. Inhibition of the phosphoinositide 3 kinase–protein kinase B/Akt pathway by wortmannin or MK-2206 failed to influence the effect of LPA. However, pharmacological inhibition of phospholipase C (PLC) by U73122 or edelfosine, but not genetic deletion of PLCε, abolished LPA-induced vasorelaxation and indicated that a PLC enzyme, other than PLCε, mediates the response. In summary, the present study identifies LPA as an endothelium-dependent vasodilator substance acting via LPA₁, PLC, and eNOS.—Ruisanchez, É., Dancs, P., Kerék, M., Németh, T., Faragó, B., Balogh, A., Patil, R., Jennings, B. L., Liliom, K., Malik, K. U., Smrcka, A. V., Tigyi, G., Benyó, Z. Lysophosphatidic acid induces vasodilation mediated by LPA₁ receptors, phospholipase C, and endothelial nitric oxide synthase.

Lysophosphatidic acid (LPA) has been assigned to a wide range of biological roles in mammals, including the regulation of embryonic development as well as certain immune, neuronal, reproductive, and cardiovascular functions (1, 2). Most LPA-related actions are mediated by specific plasma membrane receptors, but several intracellular targets of LPA have also been identified (1, 3). The first cloned G-protein-coupled receptors specific to LPA (LPA_1–3) belong to the endothelial differentiation gene (EDG) family, whereas subsequent studies have identified at least 3 additional non-EDG LPA receptors (LPA_4–6) that share similarities with the purinergic receptor family (4). LPA can be synthesized from phosphatidic acid by the action of phospholipase A₂, but the main route of its biosynthesis appears to be the conversion of lysophosphatidylcholine by the ecto/exoenzyme autotaxin (ATX)/lysophospholipase D (5). Interestingly, structural and functional connections have been proposed between ATX and LPA receptors in cell membranes (6).

A potential role of LPA in the regulation of cardiovascular functions emerged 2 decades before the discovery of the EDG family of LPA receptors. In 1978, Tokumura and coworkers isolated a fraction of soybean lecithin, which induced transient hypertension in rats, an effect that was independent of the sympathetic nervous system (7). Subsequently, LPA was identified as the vasopressor agent (8), which also induced hypertension in guinea pigs (9). On the contrary, LPA reduced blood pressure in cats and rabbits (9, 10). In cats, the hypotension was attributed to platelet aggregation and consequent increase of pulmonary vascular resistance, leading to reduced cardiac output (10). It is noteworthy that McQuarrie and Anderson (11) had already isolated a compound from soybean lecithin in 1960 with hypotensive activity on cats, but its chemical nature was not identified at that time.

In newborn pigs implanted with closed cranial windows, LPA was shown to induce dose-dependent pial vasoconstriction and to inhibit vasodilation to hypercapnia and isoproterenol (12). These latter effects were attributed to a G_i-mediated inhibition of adenylate cyclase by LPA in accordance with the finding that the vasoconstrictor effect was sensitive to pertussis toxin (PTX). Interestingly, intrathecal injection of autologous blood or endothelin 1, as models of subarachnoid hemorrhage, elevated LPA concentrations in the cerebrospinal fluid into the vasoactive range (12, 13). In addition, an enhanced vasopressor effect of LPA was reported in spontaneously hypertensive rats (14), a further indication that LPA may also be involved in pathophysiological reactions of the cardiovascular system (15).

Several lines of evidence indicate that LPA has a physiologically relevant role in the endothelium (16), via endothelial expression of both the EDG- and the purinergic-like subtypes of LPA receptors (17–20). For example, LPA was shown to stimulate endothelial cell proliferation and migration (19), although this latter effect may strongly depend on the presence of extracellular matrix proteins (16). However, LPA was reported to cause cell death in porcine cerebral microvascular and human umbilical vein endothelial cells (HUVECs) (21), whereas in another study, LPA pretreatment was protective against atorvastatin-induced apoptosis of HUVECs (22). It has also been shown that LPA activates endothelial expression of E-selectin and vascular cell adhesion molecule 1 (VCAM-1), which leads to enhanced attachment and transmigration of leukocytes (17). Both the secretion of chemokines (23–26) and the expression of adhesion molecules (17, 23, 24) by the endothelium appears to be regulated by LPA receptors. Furthermore, LPA stimulates actin stress fiber formation and endothelial cell contraction (27–30), which in turn increases endothelial permeability (27–30); although data contradicting such an effect have also been reported (31–33).

LPA was also shown to stimulate nitric oxide (NO) production in endothelial cell cultures (34–36), although long-term (24 h) incubation with micromolar concentrations of LPA reportedly reduces mRNA expression of NO synthase (NOS) in coronary endothelial cells and results in diminished endothelium-dependent relaxations of porcine coronary arteries (37). However, the mechanism by which LPA stimulates NO production is controversial in the literature. In one study, LPA-mediated activation of endothelial NOS (eNOS) was attributed to phosphoinositide 3 kinase (PI3K)-dependent phosphorylation of this enzyme in bovine aortic endothelial cells (BAECs) (35). A different report, also using BAECs, showed that inhibition of PI3K failed to influence LPA-induced NO release (36). These discrepancies underline the limitation of the aforementioned studies. The observations have been obtained in cultured endothelial cells, the properties of which are influenced by the culture and the experimental conditions (38, 39) and, therefore, may not be representative of the in vivo phenotype of the endothelium. In support of this consideration, it has been shown that the gene expression profile of BAECs changes completely in culture (40); a recent report demonstrated that cultured HUVECs lack surface glycocalyx that mediates important physiological functions in vivo (41). Because LPA is a natural component of blood and its level can change in physiological and pathophysiological conditions, a pressing need exists for in vivo studies to better understand the physiological and pathophysiological roles of LPA in the endothelium.

Despite the numerous experimental data indicating the importance of LPA in the cardiovascular system, no direct evidence for vasoactive actions mediated by vascular LPA receptors has been reported. The major interspecies differences in blood pressure responses elicited by LPA discussed above raise the possibility that LPA may have multifaceted actions in the cardiovascular system through the control of vascular tone. In the present study we show for the first time using isolated intact vessels that LPA induces vasorelaxation by stimulating LPA₁ receptors and activation of phospholipase C (PLC) and eNOS.

MATERIALS AND METHODS

Animals

Wild-type (WT) and eNOS-knockout (eNOS-KO) mice on C57BL/6J genetic background were obtained from Charles River Laboratories (Isaszeg, Hungary). Mice deficient in LPA₁ or LPA₂ receptors (LPA₁-KO and LPA₂-KO) were generated and kindly provided by Dr. Jerold Chun (Scripps Research Institute, La Jolla, CA, USA; refs. 42, 43). PLCε-deficient (PLCε-KO) mice were generated at the University of Rochester School of Medicine (Rochester, NY, USA; ref. 44). Cyclooxygenase 1 (COX1)-KO mice were kindly provided by Dr. Ingvar Bjarnason (Department of Medicine, Guy's, King's College, St. Thomas' School of Medicine, London, UK). All procedures have been reviewed and approved by the Institutional Animal Care and Use Committees of Semmelweis University and the University of Tennessee Health Science Center.

Preparation of vessels

For isolation of aortic segments, animals were perfused transcardially with 10 ml heparinized (10 IU/ml) Krebs solution under deep ether or isoflurane anesthesia as described in detail previously (45). The thoracic aorta was cleaned of fat and connective tissue under a dissection microscope (M3Z, Wild Heerbrugg AG, Gais, Switzerland) and immersed in Krebs solution of the following millimolar composition: 119 NaCl, 4.7 KCl, 1.2 KH₂PO₄, 2.5 CaCl₂·2H₂O, 1.2 MgSO₄·7H₂O, 20 NaHCO₃, 0.03 EDTA, and 10 glucose at room temperature and pH 7.4. Ring segments of ∼3 mm in length were prepared and mounted on stainless steel vessel holders (200 μm in diameter) in a conventional myograph setup (610M multiwire myograph system; Danish Myo Technology A/S, Aarhus, Denmark). Special care was taken to preserve the endothelium. However, in some experiments, the endothelium was removed purposely by gently rotating the segments on the vessel holder pins. The successful removal of the endothelium was verified by the lack of acetylcholine-induced vasorelaxation during these experiments.

Myography

Organ chambers of the myographs were filled with 6 ml Krebs solution and aerated with carbogen. The vessels were allowed a 30-min equilibration period, during which the bath solution was warmed to 37°C and the resting tension was adjusted to 15 mN, which was determined to be optimal in a previous study (45). Thereafter, the segments were exposed to 124 mM K⁺ Krebs solution (made by isoosmolar replacement of Na⁺ by K⁺) for 1 min, and following several washes with normal Krebs solution contracted by 10 μM phenylephrine (PE) and relaxed by 0.1 μM acetylcholine in order to roughly test the reactivity of the smooth muscle and endothelium, respectively. After repeated washing, during which the vascular tension returned to the resting level, the segments were exposed to 124 mM K⁺ Krebs solution for 3 min in order to elicit reference contraction. After 30 min, cumulatively increasing concentrations of PE (10 nM to 10 μM) and acetylcholine (1 nM to 10 μM) were administered in order to determine the reactivity of the smooth muscle and the functional integrity of the endothelium, respectively. After a 30-min resting period, some vessels were exposed to LPA or to the LPA_1–3-selective agonist VPC31143, in order to evaluate their potential vasoconstrictor effects on resting vascular tone. All other vessels were precontracted to 70–90% of the reference contraction by an appropriate concentration of PE, and, after contraction had stabilized, the effects of LPA or VPC31143 were determined. Enzyme inhibitors (wortmannin, MK-2206) or receptor antagonists (Ki16425, AM095) used in some of the experiments were applied to the baths 30 min prior to administration of LPA.

Protocol for selective inhibition of endothelial PLC

The procedure described for the preparation of the vessels has been slightly modified in some of the experiments aimed at the inhibition of endothelial PLC without abolishing PE-induced precontraction, which is mediated by PLC in vascular smooth muscle. For this purpose, U73122 was perfused transcardially at a concentration of 10 μM in 20 ml Krebs solution over a period of 3 min before the dissection of the aorta. In control experiments, animals have been perfused with vehicle (1% DMSO in Krebs solution) or the inactive analog of U73122, U73343. As an alternative inhibitor of phosphatidylinositol-specific PLC, edelfosine was used in a concentration of 100 μM. Similar to the aforementioned protocol, edelfosine was perfused transcardially in 20 ml Krebs solution over a period of 3 min and its vehicle (1% ethanol in Krebs solution) was used in control experiments.

In these experiments, the initial rough testing of smooth muscle and endothelial reactivity were omitted to reduce the time lag between exposure to the PLC inhibitors and the determination of vascular reactivity to LPA. Effective blockade of endothelial PLC has been established ex vivo by the lack of eNOS-mediated vasorelaxation to acetylcholine (Supplemental Figs. S1A and S3). On the other hand, vasorelaxation to the NO-donor sodium nitroprusside (SNP) was not suppressed after U73122 or edelfosine treatment, indicating that the vascular smooth muscle remained reactive to NO (Supplemental Figs. S2A and S4). Aortic segments of PLCε-KO mice were also tested in order to evaluate the potential involvement of this isoenzyme in the signaling pathway of LPA. These vessels showed unaltered reactivity both to acetylcholine and to SNP as compared to vessels from wild-type control mice (Supplemental Figs. S1B and S2B). Furthermore, acetylcholine- but not SNP-induced vasorelaxation disappeared after pretreatment with U73122 also in aortic segments of PLCε-KO mice (Supplemental Figs. S1B and S2B).

Isolation of mouse aortic endothelial cells

Endothelial cells were isolated from murine aorta as described previously (46) with minor modifications. In brief, mice were anesthetized deeply with diethyl ether and perfused transcardially with 10 ml Krebs solution containing 10 U/ml heparin. Thereafter, the lumen of the aorta was flushed with Dulbecco's Modified Eagle Medium (DMEM; Lonza, Verviers, Belgium) and filled with DMEM containing 2 mg/ml collagenase type II (Worthington Biochemical, Lakewood, NJ, USA). The aorta was ligated with silk threads on both ends, dissected out, immersed in DMEM, and incubated at 37°C for 45 min. Endothelial cells were removed from the lumen of the aorta by flushing with 3 ml of DMEM. The cell suspension was divided into two tubes and centrifuged at 1200 rpm for 5 min. The pellet of the first tube was suspended in 300 μl RNAlater (Ambion, Austin, TX, USA) and stored at 4°C until RNA isolation. The pellet of the other tube was resuspended in DMEM containing 20% FBS, 100 U/ml penicillin, and 100 μg/ml streptomycin; plated on coverslips; and incubated overnight at 37°C until cells were attached enabling immunocytochemical analysis for evaluation of the relative number of endothelial cells obtained (i.e., “purity” of the endothelial cell isolate).

Immunocytochemistry

Claudin-5-immunocytochemistry has been performed for the identification of endothelial cells and DAPI staining for counting of the total number of cells. Coverslips were washed 4 times with PBS, and the cells were fixed in 4% paraformaldehyde for 20 min at room temperature. After washing with 100 mM glycine-PBS solution for 10 min at room temperature and permeabilizing with 0.1% Triton X-100 for 20 min, cells were blocked with 3% bovine serum albumin (BSA) in PBS for 1 h. Next, cells were incubated with the mouse anti-mouse claudin-5 monoclonal antibody (1:200 dilution; Invitrogen, Carlsbad, CA, USA) in 1% BSA-PBS solution at room temperature for 1 h. After washing with PBS, cells were incubated for 1 h at room temperature with Alexa 568-conjugated anti-mouse IgG antibody (1:500 dilution; Invitrogen). Nucleus staining was performed with Alexa 488-conjugated DAPI (1:1000 dilution; Invitrogen) for 10 min at room temperature. Endothelial vs. total cell numbers were counted with a fluorescence microscope (Eclipse Ti, Nikon, Tokyo, Japan).

Quantitative real-time PCR

Expression analysis was performed only if the immunocytochemistry-verified endothelial cell content of the sample was >98%. RNA was isolated from the cells with the RNeasy micro kit (Qiagen, Valencia, CA, USA), and RNA concentration and quality was assessed with Nanodrop (Thermo Fischer Scientific, Waltham, MA, USA). RNA (50 ng total) was converted to single-primer isothermal amplification (SPIA) cDNA using the Ovation PicoSL WTA System V2 (NuGEN Technologies, San Carlos, CA, USA) according to the manufacturer's protocol. The amplified SPIA cDNA was purified with Qiagen QIAquick PCR purification column according to modifications from NuGEN.

Assessment of mRNA expression was performed by quantitative real-time PCR using 4 ng of SPIA amplified cDNA. PCR reactions were carried out in triplicate using RT2 SYBR Green/ROX PCR master mix (Qiagen) in 25 μl final volume, in an Applied Biosystems 7300 Real-Time PCR System (Life Technologies, Grand Island, NY, USA); the primer sequences are given in Table 1. Cycle parameters were: 1 initial incubation step at 50°C for 2 min, 1 denaturation step at 95°C for 10 min, and 40 cycles of denaturation at 95°C for 10 s, annealing and elongation at 60°C. Relative gene expression of each mRNA to GAPDH was determined using the dCt method.

Table 1.

Primers used for quantitative real-time PCR

Gene	Primer sequences, 5′–3′
	Forward	Reverse
GAPDH	CTGCACCACCAACTGCTTAG	GGGCCATCCACAGTCTTCT
LPA1	CACCATGATGAGCCTTCTGA	GCAGCACACATCCAGCAATA
LPA2	CCAGCCTGCTTGTCTTCCTA	GTGTCCAGCACACCACAAAT
LPA3	AGGGCTCCCATGAAGCTAAT	TGCACGTTACACTGCTTGC
LPA4	ACAGTGCCTCCCTGTTTGTC	AAATCAGAGAGGGCCAGGTT
LPA5	TCATCATCTTCCTGCTGTGC	ATCGCGGTCCTGAATACTGT
ATX	ATTACAGCCACCAAGCAAGG	AGGGAAAGCCACTGAAGGAT

Statistics

Changes of the vascular tension were recorded with the MP100 system and analyzed with the AcqKnowledge 3.7.3 software of Biopac System Inc. (Goleta, CA, USA). Vasoconstrictions were normalized to the reference contraction induced by 124 mM K⁺, whereas vasorelaxations were expressed as percentage of the precontraction produced by PE. All data are presented as means ± se, and n indicates the number of vessels tested. Statistical analysis was performed using Student's unpaired t test when comparing 2 variables. All other comparisons were made between the different experimental groups by ANOVA followed by Tukey's posthoc test. A value of P < 0.05 was considered to be statistically significant.

Reagents

LPA (18:1) and VPC31143 were purchased from Avanti Polar Lipids (Alabaster, AL, USA) and dissolved in saline immediately prior to administration. Stock solutions of LPA and VPC31143 were 100× more concentrated as compared to their final concentrations in the organ baths. AM095 was synthesized as described previously (47). Ki16425, edelfosine, and U73122 were purchased from the Cayman Chemical Co. (Ann Arbor, MI, USA), whereas insulin, U73343, and wortmannin were from Tocris Bioscience (Bristol, UK), and MK-2206 was from Selleckchem (Munich, Germany). All other drugs and chemicals used in the present study were purchased from Sigma-Aldrich (St. Louis, MO, USA). If drugs were dissolved in organic solvents (U73122, U73343, Ki16425, wortmannin, and MK-2206 in DMSO; AM095 and edelfosine in ethanol), the final concentration of the solvent was ≤0.1% in vitro and 1% during transcardial perfusion. In these experiments, vehicle treatment was used as control. In case of myograph experiments, all concentrations are expressed as the final concentration of each drug in the organ bath.

RESULTS

Vasoactive effects of LPA in aortic rings depend on the presence of intact endothelium and genetic deletion of eNOS

Our primary objective was to characterize the effect of LPA in aortic rings from C57BL/6 mice. First, the effect of LPA was examined on the resting vascular tension without precontraction of the smooth muscle. LPA produced negligible (+1.2±0.3%, n=17) tension change as compared to the reference contraction induced by 124 mM K⁺. In contrast, LPA evoked marked relaxations in PE-precontracted vessels (Fig. 1A). The dose-response relationship is shown in Fig. 2. LPA elicited vasorelaxation with an E_max of 53.9%, and an EC₅₀ of 400 nM. Of note, this EC₅₀ value of LPA is in the range of reported plasma and serum levels in experimental animals and humans (48).

Figure 1.

Effects of LPA and VPC31143 on the tone of precontracted thoracic aortas. Representative recordings of vessels prepared from wild type (WT) mice with intact (A, B) or denuded (C, D) endothelium as well as of vessels from eNOS-KO mice (E, F). LPA (A, C, E) or VPC31143 (B, D, F) (both 10 μM) were applied when PE-induced precontraction reached a stable plateau. Horizontal and vertical bars indicate 5 min and 5 mN, respectively. W, washing of the organ chamber with fresh Krebs solution.

Figure 2.

Dose-response relationship of the vasorelaxation induced by LPA and VPC31143. Each dose of the respective agonist has been tested in independent aortic segments (n=3–52) in order to avoid receptor desensitization. Values are expressed as mean ± se percentage of the PE-induced precontraction. E_max and EC₅₀ values were 53.9% and 400 nM for LPA, 51.9% and 15 nM for VPC31143, respectively.

Next, we sought to identify the mediators of LPA-induced vasorelaxation. We hypothesized a potential role of endothelium-derived vasoactive compounds, specifically NO and prostanoids, in mediating LPA-induced vasorelaxation. We tested this hypothesis in two ways by using deendothelialized WT vessels and vessels isolated from eNOS-KO or COX1-KO mice. Removal of the endothelium abolished the vasorelaxation elicited by LPA (Figs. 1C and 3). Interestingly, in the absence of the endothelium LPA increased vascular tone (Fig. 1C), which suggests that endothelium-derived signals and smooth muscle-dependent vasoconstrictor signals are involved simultaneously in the vasoactive effect. It is noteworthy that LPA induced a weak vasoconstriction (4.8±1.0%, n=14) also in nonprecontracted deendothelialized WT vessels, which effect was significantly (P<0.001) stronger as compared to the minor vasoactive effect in intact vessels.

Figure 3.

Endothelium-derived NO mediates the vasorelaxation induced by LPA and VPC31143. Effects of 10 μM LPA or VPC31143 in WT vessels with intact (open bars) or denuded endothelium (solid bars) as well as in vessels prepared from eNOS-KO (dark gray bars) and COX1-KO (light gray bars) mice. LPA- and VPC31143-induced vasorelaxations were abolished in endothelium-denuded WT as well as eNOS-KO vessels, but not in the absence of COX1. Values are expressed as mean ± se percentage of the PE-induced precontraction, n = 8–58. *P < 0.0001 vs. WT-intact; 1-way ANOVA with Tukey's post hoc test.

To obtain genetic evidence for the role of endothelial NO or prostanoid release in the mediation of LPA-induced vasorelaxation, we isolated aortic rings from eNOS-KO and COX1-KO mice. Genetic deletion of eNOS abolished LPA-induced vasorelaxation (Figs. 1E and 3) and a weak vasoconstrictor effect became apparent (Fig. 1E). In contrast, the vasoactive effect of LPA remained unaltered in vessels deficient in COX1 (Fig. 3). These lines of studies corroborate the role of eNOS in LPA-induced vasorelaxation in the intact vessels and indicate that in the absence of eNOS LPA evokes vasoconstriction.

Identification of the LPA receptors mediating LPA-induced vasorelaxation

Since the endothelium was found to mediate LPA-induced vasorelaxation, we first aimed to analyze the expression of LPA receptors and ATX in mouse aortic endothelial cells (MAECs) using quantitative real-time PCR. From the EDG-like subtypes of LPA receptors, both LPA₁ and LPA₂ but no LPA₃ transcripts were detectable (Fig. 4). In addition, expression of the non-EDG LPA receptor subtypes LPA₄ and LPA₅, as well as that of ATX, were also found in freshly isolated MAECs (Fig. 4).

Figure 4.

Expression profile of LPA receptors and ATX in freshly isolated MAECs, determined by quantitative real-time PCR. The EDG-like receptor subtypes LPA₁ and LPA₂ as well as the non-EDG subtypes LPA₄ and LPA₅ are expressed in MAECs (n=3). ATX shows moderate expression.

To evaluate the potential role of EDG family receptors in mediating LPA-induced vasorelaxation, we next examined the effect of the LPA_1–3-agonist VPC31143 (49) on vascular tension. VPC31143 evoked a weak vasoconstriction (8.0±1.7%, n=9) at the highest concentration of 10 μM when applied on the resting tension of the vessels. In contrast, VPC31143 induced a marked relaxation of PE-precontracted aortic rings (Fig. 1B) with an E_max of 51.9%, similar to that of LPA (Fig. 2). However, the EC₅₀ of VPC31143-induced vasorelaxation (15.0 nM) was significantly lower as compared to that of LPA indicating a higher potency of the synthetic compound. With regard to the role of endothelial NO release in mediating the effect of VPC31143, similar results were obtained as in the case of LPA: the vasorelaxation disappeared both in deendothelialized WT aortic segments and in vessels isolated from eNOS-KO mice, whereas COX1 deficiency failed to alter the effect (Figs. 1D, F and 3). These experiments indicated the role of the EDG-like LPA_1–3 receptors in the endothelium-dependent vasorelaxation effect. Furthermore, similarly to LPA, VPC31143 evoked vasoconstriction both in deendothelialized WT aortic segments (Fig. 1D) and in vessels isolated from eNOS-KO mice (Fig. 1F). Interestingly, the vasoconstrictor effect of VPC31143 was greater as compared to those of LPA both in deendothelialized WT (24.4±3.7 vs. 8.3±1.4%, P<0.001, n=17 and 38, respectively) and in eNOS-KO vessels (26.6±2.3 vs. 13.1±1.8%, P<0.001, n=33 and 43, respectively).

Our next aim was to identify the LPA receptor subtypes that mediate eNOS-dependent vasorelaxation. Again, we applied a combination of pharmacological and genetic manipulation of LPA receptors. The LPA_1/3-receptor antagonist, Ki16425, significantly reduced LPA-induced vasorelaxation (Fig. 5). We have synthesized the selective LPA₁-receptor blocker AM095 (47) and found that this compound also reduced LPA-induced vasorelaxation by ∼90% at 10 μM as compared to vehicle control (Fig. 5) without influencing the eNOS-mediated vasorelaxation elicited by acetylcholine (data not shown). We also tested vessels isolated from LPA₁- and LPA₂-KO mice. Aortic rings isolated from LPA₁-KO mice failed to show relaxation in response to LPA, whereas their reactivity to acetylcholine was not altered (Fig. 6). However, vessels isolated from LPA₂-KO animals showed unaltered relaxation to both LPA and acetylcholine (Fig. 6).

Figure 5.

Inhibition of LPA-induced vasorelaxation by Ki16425 (antagonist of LPA₁ and LPA₃ receptors) and by AM095 (selective antagonist of LPA₁). Both antagonists were applied in a concentration of 10 μM 30 min before the administration of 10 μM LPA. Control vessels (open bars) were treated by the vehicles of Ki16425 (DMSO) or that of AM095 (ethanol). Values are expressed as mean ± se percentage of the PE-induced precontraction, n = 7–18. *P < 0.0001 vs. vehicle-treated vessels; Student's unpaired t test.

Figure 6.

Lack of LPA₁ receptors results in diminished vasorelaxation by LPA. Effects of 10 μM LPA and 1 μM acetylcholine (ACh) in vessels prepared from WT (open bars), LPA₁-KO (gray bars) or LPA₂-KO (solid bars) mice. Values are expressed as mean ± se percentage of the PE-induced precontraction, n = 4–19. LPA-induced vasorelaxation was significantly reduced in LPA₁-KO vessels, whereas no difference was found in the ACh-induced vasorelaxations between the different experimental groups. *P < 0.0001 vs. WT; 1-way ANOVA with Tukey's post hoc test.

Identification of the intracellular signaling pathways of LPA-induced vasorelaxation

What signals couple LPA₁ to eNOS activation in the endothelium? To address this question, we examined first the potential role of PI3K and protein kinase B/Akt signaling pathway, since in a previous study using cultured BAECs it has been shown to mediate LPA-induced Ser1179 phosphorylation and consequent activation of eNOS (35). However, the inhibitors of this signaling cascade, 100 nM wortmannin and 5 μM MK-2206, failed to alter LPA-induced vasorelaxation (Fig. 7), although they significantly reduced the vasorelaxing effect of insulin, which is mediated reportedly by the PI3K-Akt pathway (34, 50). Thus, in murine vessels, LPA₁ coupling to eNOS does not appear to involve the PI3K-Akt pathway.

Figure 7.

LPA-induced vasorelaxation remains unaltered after inhibition of PI3K by wortmannin or protein kinase B/Akt by MK-2206. Effects of 10 μM LPA and 3 μM insulin in vessels pretreated with vehicle (DMSO, open bars), 100 nM wortmannin (gray bars), or 5 μM MK-2206 (solid bars) for 30 min. Values are expressed as mean ± se percentage of PE-induced precontraction, n = 16–27. The effect of LPA remained unaltered, whereas insulin-induced vasorelaxation decreased significantly in the presence of wortmannin or MK-2206. *P < 0.0001 vs. DMSO; 1-way ANOVA with Tukey's post hoc test.

LPA₁ is known to activate inositol trisphosphate (IP₃) production, and the ensuing elevation of intracellular Ca²⁺ can activate eNOS (51). To further delineate the mechanism of eNOS activation, we focused on PLC enzymes that can stimulate NO production via IP₃-mediated intracellular Ca²⁺ release. Because several effects of LPA are mediated reportedly by PLCε (52, 53), the involvement of this PLC isoenzyme was examined first by testing vessels isolated from PLCε-KO mice. However, in our experiments, LPA-induced vasorelaxation did not differ between vessels from PLCε-KO and WT mice (Fig. 8A), ruling out the involvement of PLCε in mediating the effect. Subsequently we focused on other PLC enzymes. To achieve a selective pharmacological inhibition of PLC in the endothelium without abolishing PE-induced precontraction, the vessels were pretreated intraluminally with 10 μM U73122 as described in Materials and Methods. Interestingly, LPA-induced vasorelaxations were abolished in aortae from both WT and PLCε-KO mice following treatment with U73122, but not with its inactive analog, U73343 (Fig. 8A). Furthermore, the structurally independent PLC inhibitor edelfosine also abolished the vasorelaxation by LPA (Fig. 8B) without altering the ability of the smooth muscle to relax in response to exogenous NO (Supplemental Fig. S4). Taken together, these results indicate the pivotal role of PLC enzyme(s) other than PLCε in mediating the LPA-induced vasorelaxation response.

Figure 8.

PLC mediates LPA-induced vasorelaxation. A) Effects of 10 μM LPA after treatment with vehicle as well as U73122 or its inactive analog, U73343 in vessels prepared from WT (open bars) and PLCε-KO (solid bars) mice. LPA induced similar effects in vehicle- and U73343-treated WT and PLCε-KO vessels, whereas U73122 abolished the vasorelaxation in both experimental groups. B) Effects of 10 μM LPA in vehicle-treated control (open bar) as well as edelfosine treated vessels (sold bar) prepared from WT mice. The phosphatidylinositol-specific PLC inhibitor edelfosine abolished LPA-induced vasorelaxation. Values are expressed as mean ± se percentage of PE-induced precontraction, n = 7–20. *P < 0.0001 vs. vehicle; 2-way ANOVA with Tukey's post hoc test (A) or Student's unpaired t test (B).

DISCUSSION

These results extend the list of the physiological and pathophysiological roles of LPA in the cardiovascular system by providing evidence for a direct vasodilator effect mediated by LPA₁ receptors via PLC and eNOS. Our observations that both LPA and VPC31143 increased vascular tone in vessels from eNOS-KO mice and in deendothelialized vessels from WT mice support the hypothesis that LPA receptors in the vascular smooth muscle may mediate vasoconstriction, as has been proposed previously in cerebral vessels (12, 54). It has to be noted that resting plasma levels of LPA are reportedly (48) close to or within the vasoactive concentration range determined in our experiments. Thus, enhanced LPA production by activated platelets or blood cells may result in changes of vascular resistance and blood flow. The direction of these changes depends on the functional integrity of the endothelium.

LPA₁ was initially described as “ventricular zone gene-1 (Vzg-1)” because of its abundant expression in the “ventricular zone”, the neural progenitor area of the mouse embryonic cerebral cortex (55). In subsequent studies, LPA₁ has been shown to play a key role in the development of the central nervous system by regulating neuronal differentiation, synaptic functions and astrocyte proliferation (56). LPA₁ has also been implicated in the pathogenesis of neuropathic pain (57). In the musculoskeletal system, LPA₁ is required for normal bone development, evidenced by the craniofacial dysmorphic phenotype of LPA₁-KO mice (42). Furthermore, LPA₁ appears to activate fibroblasts and contribute to several manifestations of organ fibrosis (1, 58). With regard to the cardiovascular system, frontal cephalic hemorrhage has been described in LPA₁-KO mice, but the mechanism of its pathogenesis has not been determined (42). LPA was also shown to induce LPA₁-mediated activation of human platelets (59), although this effect appears to vary markedly between species (10, 15). The present study establishes that LPA₁ receptors are also involved in the regulation of the vascular tone by mediating endothelium-dependent vasorelaxation.

Our results indicate that beside LPA₁, at least 3 other LPA receptor subtypes (LPA₂, LPA₄, and LPA₅) are expressed in freshly isolated mouse aortic endothelial cells. Taking into account the potential differences between species and vascular regions and also the above discussed changes in the gene expression profiles in cultured cells, it is not surprising that the expression pattern observed in our study is partly different from those described previously in endothelial cell cultures. Lee et al. (18) reported a ubiquitous expression of the EDG-like LPA_1–3 receptors in BAECs and rat aortic endothelial cells (RAECs), as well as in bovine umbilical vein and cornea endothelial cells. Interestingly, mouse pancreatic islet endothelial cells (MS1) also expressed all EDG-like LPA receptors, while human aortic endothelial cells (HAECs) and HUVECs expressed only LPA₁ and LPA₃ (18). In other studies the expression of LPA₁ in HUVECs and BAECs has been confirmed, while the expression of LPA₂ and LPA₃ was controversial (19, 20). Less data are available regarding the endothelial expression of non-EDG LPA receptors, although in one study, mRNA expression of LPA_4–6 receptors has been detected in HUVECs (20). Interestingly, our results also indicate the expression of LPA₄ and LPA₅ in freshly isolated MAECs, which encourages the investigation of potential physiological and pathophysiological functions of these receptors in endothelial cells. Nevertheless, our observation the ATX mRNA is expressed in endothelial cells together with LPA receptors raise the possibility that LPA may function as an autocrine/paracrine mediator of the systemic vasculature, as has been proposed recently in high endothelial venules (60, 61).

As a first attempt to identify the signaling pathway between LPA₁ receptors and eNOS, the role of the PI3K-Akt pathway was investigated. Previous studies have demonstrated that LPA-induced activation of PI3K and Akt is involved in the control of various cellular functions, including the balance between survival and apoptosis, differentiation, and migration (56, 62, 63). It was also shown in BAECs that LPA induces phosphorylation of Akt accompanied by eNOS phosphorylation on Ser1179, the putative target of Akt, and a >2-fold increase of the eNOS enzymatic activity (35). These effects could be prevented by inhibition of G_i and PI3K by administration of pertussis toxin and wortmannin, respectively (35). In the present study, however, the vasorelaxant effect of LPA appeared to be independent of the PI3K-Akt pathway. A difference among the type of receptors mediating the effect may explain this discrepancy, although BAECs were shown to express LPA₁ receptors (19), which mediated the vasorelaxation in our experiments. It is also possible that LPA₁ simultaneously activates different G-protein-mediated signaling pathways in endothelial cells, and their relative importance can either show interspecies differences or change in cultured cells. Indeed, it was shown in BAECs that pertussis toxin can only partially inhibit intracellular Ca²⁺ mobilization in response to LPA (19), indicating the presence of a G_i/o-independent signaling pathway, which can be responsible for the vasorelaxation in our studies. These considerations can give a possible explanation for a further discrepancy between previous observations and our results: while Akt phosphorylation, which is upstream of eNOS activation, developed only in 1–2 min after administration of LPA in BAECs (35), in our experiments the vasorelaxation started typically within a couple of seconds after adding LPA to the tissue baths. Therefore, LPA appears to be a rapidly acting regulator of the vascular tone.

Because the role of the PI3K-Akt pathway in mediating the LPA-induced vasorelaxation could be excluded, the potential role of PLC enzymes has been addressed. Recent studies have identified PLCε as a downstream signaling partner of LPA receptors (52, 53). In COS-7 cells, transfection with PLCε was shown to significantly stimulate the accumulation of inositol phosphates on administration of LPA, an effect mediated by G₁₂ and G_i proteins (64). Furthermore, coexpression of the LPA₁ receptor with PLCε markedly enhanced the inositol phosphate response to LPA in a Rho-dependent manner (65). In Rat-1 fibroblasts, LPA-induced PLC activation showed an isoenzyme-specific temporal profile: the acute phase of inositol phosphate release was catalyzed by PLCβ3 and the sustained phase by PLCε (66). In primary cultures of mouse astrocytes, LPA-induced phosphoinositide hydrolysis was mediated primarily by G_i and PLCε (67). In accordance, activation of protein kinase D and consequent up-regulation of the COX-2 enzyme in response to LPA were diminished in PLCε-deficient astrocytes (68), raising the potential role of this signaling pathway in neuroinflammation. In our present study, however, PLCε-KO vessels showed unaltered vasorelaxations to LPA, while U73122 and edelfosine abolished the response. Therefore, PLC other than PLCε appears to mediate LPA-induced eNOS activation, which in conclusion predicts that endothelial LPA₁ receptors are most likely coupled to G_q/11 proteins and explains the relatively fast development of vasorelaxation.

An intriguing question is the role of LPA-induced vasodilation in physiological or pathophysiological reactions. It has been shown in BAECs and mouse endothelial cells in situ that LPA sensitizes the intracellular Ca²⁺ signal in response to shear stress (69, 70), an interaction that may influence flow-induced vasodilation. The same group has proposed recently that in the presence of shear stress LPA stimulates endothelial thromboxane-release and subsequent changes of the vascular reactivity (71, 72). Our present study indicates that LPA may directly alter the vascular tone in a shear-stress independent manner, and that its vasoactive effect is markedly influenced by the presence or absence of the endothelium. It is well established that after endothelial injury, activated platelets release numerous mediators with vasoconstrictor activity, such as serotonin and thromboxane A₂. Our observations indicate that, in the absence of endothelium, LPA, which is also released by activated platelets, functions as a vasoconstrictor, an effect that may contribute to the prevention of bleeding after vascular injury (Fig. 9). However, platelet-derived mediators, including LPA, induce further activation and aggregation of platelets and the thrombus may grow into a vascular segment with intact endothelium. At this stage, according to our present observations, LPA stimulates endothelial NO release, which may in turn oppose vasoconstriction and thrombogenesis induced by platelet-derived mediators (Fig. 9). This concept would not only explain the potential physiological roles of LPA in the regulation of vascular tone and negative feed-back control of thrombogenesis but would also resolve the apparent inconsistency of previous findings indicating that LPA fails to induce systemic thromboembolism when applied intravenously (8, 9, 14) despite its pronounced platelet-activating effect in vitro (15, 48). The observation that mice heterozygous for ATX and, therefore, having a ∼50% reduction of plasma LPA levels are more prone to thrombosis (73) may also be related to the diminished LPA-induced NO release from the endothelium.

Figure 9.

Mechanism and proposed roles of LPA-induced endothelial NO release in the regulation of vascular tone and thrombus formation. In case of endothelial damage, activated platelets release numerous mediators, including LPA, which in turn results in further platelet activation. Our observations indicate that, in the absence of endothelium, LPA induces vasoconstriction, which may contribute to the hemostasis after vascular injury. However, when the thrombus grows into a vascular segment with intact endothelium, platelet-derived LPA stimulates endothelial NO release by the mechanism described in the present study, resulting in vasorelaxation, mediated by soluble guanylyl cyclase (sGC), and inhibition of platelet activation. Therefore, LPA₁- and PLC-mediated eNOS activation in the intact endothelium provides negative feedback control of thrombus growth and counterbalances the vasoconstrictor effects of platelet-derived mediators, including LPA itself. Platelets, endothelial cells, and smooth muscle are depicted in the figure by orange, blue, and red, respectively.

In summary, the present study identifies LPA as an endothelium-dependent vasodilator. This effect of LPA is mediated by the LPA₁ receptor, PLC, and eNOS. Since reported levels of LPA in the systemic circulation are within or close to the vasoactive concentration range observed in our study, it may potentially contribute to the regulation of blood pressure. However, we propose that LPA produced by platelets, leukocytes and probably also by endothelial cells is more intimately involved in local control of blood flow and hemostasis.