Abstract
Background
Inferring of parentage in natural populations is important in understanding the mating systems of a species, which have great effects on its genetic structure and evolution. Muricidae, a large group (approximately 1,600 species) of marine gastropods, are poorly investigated in patterns of multiple paternity and sperm competition based on molecular techniques. The veined Rapa whelk, Rapana venosa, a commercially important muricid species with internal fertilization, is an ideal species to study the occurrence and frequency of multiple paternity and to facilitate understanding of their reproductive strategies.
Methodology/Principal Findings
We developed five highly polymorphic microsatellites in R. venosa and applied them to identify multiple paternity in 19 broods (1381 embryos) collected from Dandong, China. Multiple paternity was detected in 17 (89.5%) of 19 broods. The number of sires per brood ranged from 1 to 7 (4.3 on average). Of the 17 multiply sired broods, 16 (94.1%) were significantly skewed from equal paternal contributions, and had a dominant sire which was also dominant in each assayed capsule.
Conclusions
Our results indicate that a high level of multiple paternity occurs in the wild population of R. venosa. Similar patterns of multiple paternity in the 2–6 assayed capsules from each brood imply that fertilization events within the body of a female occur mostly (but not entirely) as random draws from a “well-but-not-perfectly blended sperm pool” of her several mates. Strongly skewed distributions of fertilization success among sires also suggest that sperm competition and/or cryptic female choice might be important for post-copulatory paternity biasing in this species.
Introduction
Parentage studies and family reconstructions have become increasingly popular for investigating a range of evolutionary, ecological and behavioral process in natural populations [1]. Due to difficulties of observing mating in the wild, parentage in natural populations is usually difficult to determine by field observations. With the advent and increased use of molecular techniques, parentage in a wide range of animal groups has been determined [2]–[5].
Theoretically, one or a few matings are sufficient for females to fertilize all eggs and maximize their potential reproductive abilities for one reproductive period, and mating often carries relatively high cost and potential danger, so females are likely to be sexually monogamous [6]. Contrary to this prediction, female multiple mating (polyandry), where females mate with two or more males within a single reproductive season, is a taxonomically widespread phenomenon [5]. The evolution of female promiscuity and multiple paternity can be promoted by direct benefits (e.g., courtship feeding, nuptial gifts, fertilization assurance, paternal care and stimulation of reproduction) and indirect (genetic) benefits (e.g., acquisition of good genes, higher offspring diversity and genetic compatibility) [6]–[10]. In addition, mate encounter rate has also proved to be an important factor influencing levels of multiple paternity based on theoretical and empirical studies [11]–[13]. Sperm competition, which results from polyandry, refers to the competitive process between the sperm from two or more males for the fertilization of a given set of ova, and is a process of sexual selection and the final mode of males’ competition [14].
Parentage and sperm competition studies in marine gastropods and hermaphroditic land snails based on microsatellite evidence have shown that polyandry is an extremely common phenomenon in gastropods [15]–[21]. In these studied species (Littorina saxatilis, Busycon carica, Solenosteira macrospira, Aplysia californica, Arianta arbustorum, etc.), multiply-fertilized individuals accounted for about 76%–100% among all of the studied females, and the number of sires per brood ranged from 1–23. Patterns of sperm competition are variable in these species, some have no male sperm precedence [18], [22], [23] whilst others have last male sperm precedence [16], [19].
Muricidae is a large group (approximately 1,600 members) of marine gastropods [24]. Species of muricids are dioecious with internal fertilization, and fertilized eggs are encapsulated in capsules to be spawned. However, patterns of multiple paternity and sperm competition based on molecular techniques are poorly investigated in muricid species. Therefore, studies of mating systems of muricid species will facilitate understanding of their reproductive strategies and provide more insights into the mechanisms underlying female multiple mating and sperm competition.
The veined Rapa whelk Rapana venosa (Gastropoda: Muricidae), one of the most commercially important gastropod species in Asia, is abundant in silty sand of the intertidal and subtidal zones along the coasts of China, Korea and Japan [25]. It is also a notorious invasive species in Europe and North America [26]. Mating and spawning occurs from May to early August under seawater temperature of 24–27°C [25], [27]. In a hatchery environment, females mate and spawn many times in a single reproductive season [25], [27]. During spawning, groups of eggs, after being fertilized one after another in a chamber (receptaculum seminis) just posterior to the pallial oviduct, are extruded into the latter where they became encapsulated [28], [29]. The total number of egg capsules laid per female is 184–410 and the mean number of eggs in an egg capsule is 976 [25]. As divers have observed, the adults of R. venosa herd together in the wild during the reproductive season (personal communications), which should increase the rate of mate encounter and may affect the level of multiple paternity.
In this study, we developed five highly polymorphic microsatellites in R. venosa to determine the occurrence of multiple paternity in 19 broods obtained from one wild population. This study allows addressing two main questions: 1) What is the frequency and degree of multiple paternity in the veined Rapa whelk? 2) How much reproductive skew exists among the sires of a brood?
Materials and Methods
Ethics Statement
The collecting of egg-case strings of R. venosa from the Big Deer Island of Dandong was permitted by Zongyi Zhang, manager of the Dandong Daludao Haixing Group Co. Ltd. Ethical approval was not applicable for this study because no endangered animals were involved. However, all handling of the egg-case strings was conducted in strict accordance with Animal Care Quality Assurance in China.
Sampling
Egg-case strings (n = 19), which were anchored on rocks at one end at depths of 4 - 10 meters, were collected by fishery divers in July 2012 along the Big Deer Island (Dandong, China). The egg-case strings were raised in the laboratory at 25°C, which is a suitable temperature for egg development of R. venosa. Before embryos were hatched from the egg-case capsule, two to six capsules per brood were randomly selected and preserved at −80°C.
Microsatellite Development
Microsatellites were isolated from a single specimen of R. venosa following an enrichment protocol described by Glenn and Schable [30]. Primers flanking the microsatellite repeat regions were designed using Primer Premier version 5.00 (PREMIER Biosoft International). Primers were optimized and checked for polymorphisms using a sample of 30 adults. The number of alleles (Na), observed (HO) and expected (HE) heterozygosity were calculated by using the Excel Microsatellite Toolkit [31]. Hardy-Weinberg equilibrium (HWE) and genotypic linkage disequilibrium (LD) tests were performed with GENEPOP 4.0 [32]. Expected exclusion probabilities for each locus and across all loci were calculated with GERUD 2.0 [33]. The presence of null alleles for each locus was checked using Micro-Checker ver. 2.2.3 [34]. A total of five highly polymorphic loci were chosen for this study.
DNA Extraction and Microsatellite Genotyping
Sixteen embryos were randomly selected from each capsule for DNA extraction which was performed according to the following protocol: each embryo was incubated for 3 h at 56°C with 20 µl of lysis buffer (10 mM Tris-HCl PH8.3, 50 mM KCl, 0.5% Tween-20, 500 µg/ml proteinase K), followed by 15 min at 95°C [35]. Samples were then centrifuged at 3000 rpm for 2 min to pellet cellular debris.
Genotyping of microsatellites was conducted using fluorescently-labeled primers and an automated ABI3730 XL DNA Sequencer. Five microsatellite loci (TB19, QR43, R12, R13, RV11), were amplified following the PCR protocol described in [36]. PCR products were electrophoresed on an ABI3730 XL DNA sequencer with the LIZ-500 size standard (Applied Biosystems). Data were analyzed using GeneMarker v2.2 (SoftGenetics, State College, PA, USA). Probably because of low DNA quality, two of the loci (R12 and RV11) were not genotyped successfully in some families (Locus R12 for Family 2, 6, 9 and 10, Locus Rv11 for Family 1, 3, 4 and 15). These loci were excluded for the subsequent analyses of parentage for these families.
Analysis of Parentage
Analysis of paternity was conducted using the software COLONY 2.0 [37], [38], which uses a maximum likelihood method to assign parentage and sibship groups and to reconstruct the genotypes of the unsampled parents. COLONY evaluates genetic parentage by partitioning offspring into full-sib groups according to likelihood scores assuming Mendelian segregation and no maximum limit on the numbers of contributing parents. Offspring genotypes and known maternal sibships were entered into COLONY. The program was set to estimate and update allele frequencies during the analysis. Six replicate analyses were conducted for each brood by using three different random number seeds and two genotyping error rates (0.01 and 0.02). The number of sires contributing to each female’s brood and the reproductive skew among males were determined from the COLONY output. The degree of reproductive skew was measured by the binomial skew index B [36], [39]. A value of zero implies a random distribution of offspring among sires, positive values indicate skew, and significant negative values imply an overly equal distribution of offspring. Significant levels of B were estimated by simulation with 10,000 permutations. All of the skew analyses were conducted by SKEW CALCULATOR 2003 (http://www.eeb.ucla.edu/Faculty/Nonacs/PI.htm). A linear regression test for a correlation between the sample size and the number of sires was performed to assess whether larger samples were more likely to contain offspring from more of the males with whom a female had mated. To assess whether there were possible differences in a sire’s relative paternity contributions to the assayed capsules in each brood, Fisher’s exact tests were performed.
Results
Characterization of Microsatellites
All five microsatellite loci were highly variable, displaying from 11 to 32 alleles per locus (Table 1). Observed heterozygosities were high for all loci and ranged from 0.851 to 1.000 (Table 1). No evidence of genotypic disequilibrium between loci was detected, and all loci were in Hardy-Weinberg equilibrium. The exclusion probability (under the neither parent known model) was high for each of the five microsatellites analyzed and the combined exclusion probability for all five or four loci was larger than 99.65% (Table 1). Micro-Checker did not find any evidence for the presence of null alleles at any locus.
Table 1. Characteristics of five microsatellite loci in a sample of 30 adult individuals of Rapana venosa.
Locus | Repeat motif | Primer sequence(5′-3′) | Sizerange (bp) | Ta (°C) | Na | HE | HO | Exclusion probability |
TB19 -FAM | (GA)31(CAGA)4(CACACAGA)3 | F: CATCACCCTTAGGCCACAAT | 134–224 | 56 | 32 | 0.973 | 0.844 | 0.843 |
R: ACCTTTCCAAGTATCCACGA | ||||||||
QR43 -FAM | (CA)27AA(CA)5GA(CA)4 | F: CTTGTATCATTCATTCAACCTT | 240–288 | 54 | 23 | 0.955 | 1.000 | 0.785 |
R: GTTTCTTTTGGCTTCTTGTT | ||||||||
R12 -HEX | (GT)37 | F: CCTACCAAAAGTCAAGAGT | 91–145 | 52 | 25 | 0.959 | 1.000 | 0.799 |
R: CCCTGTGGGATAAGTATTG | ||||||||
R13 -HEX | (ATC)10 | F: TGCATAATGGTCCGTGAC | 295–319 | 58 | 11 | 0.834 | 0.867 | 0.589 |
R: ACATTTGGACTTGGTGGA | ||||||||
RV11 -TAMRA | (TCTG)6(TC)7(AC)42 | F: CTGTCCTCCATCTACCATA | 154–234 | 52 | 22 | 0.955 | 0.851 | 0.770 |
R: AATCTATTCCCTCCTTCAT | ||||||||
Over all loci | N/A | N/A | N/A | N/A | N/A | 0.934 | 0.912 | 0.999 |
Genetic Paternity
Genotypes were obtained from 1381 of 1488 sampled embryos, representing progenies of 19 females. Assuming the same genotyping error rate (0.01 or 0.02), identical results were obtained for three replicate analyses with different random number seeds. Results of replicate analyses for two different genotyping error rates showed that high proportions of the offspring (94.80% - 98.91%) were assigned to identical full-sib families in all broods. Replicate analyses of 7 broods for the two different genotyping error rates gave identical results. However, replicate analyses of the other 12 broods showed a little variation: under the genotyping error rate of 0.01, one offspring in 7 broods and 2 to 4 offspring in 5 broods were assigned to 1 to 3 more full-sib families compared with results with the 0.02 error rate. The genotyping error rate was set to 0.02 in the downstream analyses as suggested by Wang [37]. For each brood, the best maximum likelihood inferred configuration consisting of full-sib families is shown in Table 1. Multiple paternity was detected in 17 (89.5%) of 19 broods. The number of sires per brood ranged from 1 to 7, with an average of 4.3 sires per brood (Table 2). Of the 17 multiply sired broods, 16 (94.1%) were significantly skewed from equal paternal contributions (Table 2, Figure 1), and had a dominant sire which was also dominant in each assayed capsule. Of 81 assayed capsules in the 17 multiply sired broods, 8 (9.9%) involved all the identified sires for the entire brood, and 9 (11.1%) only contained offspring from the dominant sire. The number of sires per brood was not significantly correlated with the sample size (r 2 = 0.01, df = 18, P = 0.80). For the 17 multiply sired broods, a total of 7802 Fisher’s exact tests was conducted for possible differences in a sire’s relative paternity contributions to the assayed capsules in each brood. Statistical significance (P<0.05) was reached in 7 (0.89%) of these comparisons. This number is much lower than that expected due solely to type I statistical error.
Table 2. Multiple mating for 19 broods of Rapana venosa from Dandong.
Family | Number ofanalyzed capsules | Number of genotyped offspring | Number of sires | M1 | M2 | M3 | M4 | M5 | M6 | M7 | B value | P |
F01 | 6 | 86 | 6 | 62 | 8 | 6 | 4 | 4 | 2 | 0.362 | 0.000 | |
F02 | 6 | 71 | 3 | 57 | 12 | 2 | 0.331 | 0.000 | ||||
F03 | 6 | 89 | 6 | 78 | 4 | 2 | 2 | 2 | 1 | 0.596 | 0.000 | |
F04 | 6 | 89 | 7 | 35 | 25 | 9 | 9 | 5 | 3 | 3 | 0.107 | 0.000 |
F05 | 6 | 89 | 6 | 76 | 4 | 4 | 3 | 1 | 1 | 0.559 | 0.000 | |
F06 | 6 | 92 | 6 | 47 | 23 | 13 | 4 | 3 | 2 | 0.171 | 0.000 | |
F07 | 6 | 93 | 1 | 93 | NA | NA | ||||||
F08 | 6 | 96 | 4 | 65 | 14 | 12 | 5 | 0.240 | 0.000 | |||
F09 | 6 | 91 | 5 | 70 | 8 | 6 | 4 | 3 | 0.398 | 0.000 | ||
F10 | 6 | 88 | 5 | 61 | 13 | 10 | 3 | 1 | 0.307 | 0.000 | ||
F11 | 6 | 91 | 3 | 81 | 8 | 2 | 0.460 | 0.000 | ||||
F12 | 6 | 94 | 1 | 94 | NA | NA | ||||||
F13 | 5 | 80 | 2 | 79 | 1 | 0.469 | 0.000 | |||||
F14 | 4 | 55 | 5 | 46 | 4 | 3 | 1 | 1 | 0.494 | 0.000 | ||
F15 | 3 | 45 | 5 | 19 | 16 | 6 | 3 | 1 | 0.11 | 0.000 | ||
F16 | 3 | 41 | 6 | 10 | 10 | 6 | 6 | 5 | 4 | 0.000 | 0.459 | |
F17 | 2 | 31 | 5 | 15 | 11 | 3 | 1 | 1 | 0.146 | 0.000 | ||
F18 | 2 | 30 | 3 | 25 | 4 | 1 | 0.358 | 0.000 | ||||
F19 | 2 | 30 | 4 | 26 | 2 | 1 | 1 | 0.423 | 0.000 |
Figure 1. Relative contribution of sires within each brood of Rapana venosa.
Discussion
Parentage studies and family reconstructions in natural populations are a challenging endeavour, and obtaining accurate assignments is crucial to obtaining accurate representations of behavioral, ecological and evolutionary processes [1]. However, it is difficult to determine exactly how many microsatellite loci are necessary to achieve a certain level of power in sibship inference. For inferring parent numbers and individual parental contribution, high marker polymorphism appears to be much more important than solely increasing the number of makers with low genetic diversity [1], [40]. Although the accuracy of assignments increased with the number of loci [1], [40], Jones et al. [41] proposed to analyze no more than 3 or 4 loci in order to offset the costs associated with the genotyping of many broods. Based on analyses of simulated data, Sefc and Koblmüller [1], [40] suggested that COLONY performed well with 5 markers of He = 0.84. In fact, 3 to 5 microsatellites have generally been used to reconstruct parentage for the majority of previous studies on gastropod species [15]–[21]. The average observed heterozygosity of the 5 microsatellite loci in the present study was 0.912, and the combined exclusion probability for all 5 or 4 loci was larger than 99.65%, which suggested that the microsatellite loci in our study could be sufficient to reconstruct parentage. Moreover, the presence of genotyping error had little impact on the accuracy of assignments [1], [37], and an analysis assuming an error rate of 0.01 gave essentially the same results as that assuming an error rate of 0.02 in our study.
Although there are over 1,600 living species in the family Muricidae [24], little is known about their genetic mating system in wild populations. The present study provides the first insights into the occurrence and frequency of multiple paternity in R. venosa, an commercially and ecologically important member in Muricidae.
Our findings, based on microsatellite assessments of 1381 embryos from 19 broods, indicate that a high level of multiple paternity (1 to 7, mean 4.3) occurs in the wild population of R. venosa. Since only a fraction of each brood was analyzed, the number of males contributing to each brood may be an underestimate of the true number of sires. The frequency of multiple paternity detected in R. venosa (89.5%) is low compared with some previously studied marine gastropods, such as Littorina saxatilis (100%) [42], Solenosteira macrospira (100%) [20], and Busycon carica (92%) [18], but higher than that of Neptunea arthritica (77%) and Aplysia californica (76%) [16]. Although there is no evidence that a R. venosa female does not obtain courtship feeding, nuptial gifts, or paternal care from multiple mating, we consider that the direct benefits obtained by a female from this behavior is more likely fertilization assurance. Females could also gain other fitness benefits such as the promotion of sperm competition, insurance against genetic abnormalities or inviable sperm from particular males and high genetic diversity among her progeny [18]. Furthermore, the high mate encounter rate of R. venosa during the reproductive season may be an important factor that leads to the high level of multiple paternity detected in R. venosa. Factors affecting male mate choice can also limit the level of female multiple mating. Males of some gastropods [19], [43], [44] have been reported to avoid the sperm competition risk by determining a female’s mating status using chemical cues or other cues.
In R. venosa, the male deposits sperm into the copulatory bursa to which the penis has access during mating. After copulation, sperm are transported from the bursa to the seminal receptacle where fertilization may occur. Our inability to reject the null hypothesis of relative paternity constancy in the assayed capsules from each brood suggests that sperm from multiple males should be mixed within the female’s reproductive tract. Thus, it is quite possible that fertilization events within the body of a female whelk occur mostly (but not entirely) as if by random draws from a “well-blended sperm pool” comprised of different ejaculate titers by her several mates [18]. Strongly skewed distributions of fertilization success among sires were detected in 94.1% of multiple mated females, suggesting that sperm competition and/or cryptic female choice might be important for post-copulatory paternity biasing in this species.
Different mechanisms of sperm competition exist in gastropod species. In the Neptune whelk, Neptunea arthritiga, males can achieve considerable reproductive success with a mated female through sperm removal, which implies last male sperm precedence [19]. However, in the garden snail, Cornu aspersum Müller, early sperm donors have been shown to sire more offspring by generating a resistance to incoming sperm cells through a unified beating of flagella of sperm residing in the female storage organ [45]. Results in the present study indicate that sperm competition may occur in R. venosa, however, it is impossible to elucidate the mechanisms of sperm competition of R. venosa due to the lack of the information on mating behaviors (e.g. mating order, copulation duration, intermating interval) and parental genetic information.
The post-copulatory female choice is another possible scenario that we can not exclude with the genetic data to explain the paternity biasing in R. venosa. It may be accomplished in a number of ways, such as sperm dumping, sperm digestion in female storage organs, or other means of differential sperm sorting and usage within the female reproductive tract [15], to determine the distribution of paternal contributions.
In the present study, only one wild population of R. venosa was analyzed. To fully understand the occurrence of sperm competition and cryptic female choice in this species, it would be very interesting to design experiments that track the sperm of individual male in the resulting offspring by observing their mating and spawning behaviors in laboratory and parentage analysis using genetic markers.
Data Accessibility
A file containing the genotypes at 4 or 5 microsatellite loci of all offspring used in the Colony analyses is available from the Dryad Digital Repository: http://doi.org/10.5061/dryad.88741.
Acknowledgments
We would like to thank Yulong Li and Bingjian Liu for their help in sample collection.
Funding Statement
This work was supported by NSF China Grant (No. 31200280), 100 Talents Program of the Chinese Academy of Sciences to JXL, and National Key Technology R&D Program in the 12th Five Year Plan of China (No. 2011BAD13B01 and No. 2011BAD45B01). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Harrison HB, Saenz-Agudelo P, Planes S, Jones GP, Berumen ML (2013) Relative accuracy of three common methods of parentage analysis in natural populations. Mol Ecol 22: 1158–1170. [DOI] [PubMed] [Google Scholar]
- 2. Pearse D, Avise J (2001) Turtle mating systems: behavior, sperm storage, and genetic paternity. J Hered 92: 206–211. [DOI] [PubMed] [Google Scholar]
- 3. Avise JC, Jones AG, Walker D, DeWoody JA (2002) Genetic mating systems and reproductive natural histories of fishes: lessons for ecology and evolution. Annu Rev Genet 36: 19–45. [DOI] [PubMed] [Google Scholar]
- 4. Jones AG, Ardren WR (2003) Methods of parentage analysis in natural populations. Mol Ecol 12: 2511–2523. [DOI] [PubMed] [Google Scholar]
- 5. Avise JC, Tatarenkov A, Liu JX (2011) Multiple mating and clutch size in invertebrate brooders versus pregnant vertebrates. Proc Natl Acad Sci 108: 11512. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Jennions MD, Petrie M (2000) Why do females mate multiply? A review of the genetic benefits. Biol Rev 75: 21–64. [DOI] [PubMed] [Google Scholar]
- 7.Simmons LW (2005) The evolution of polyandry: sperm competition, sperm selection, and offspring viability. Annu Rev Ecol Evol Syst: 125–146.
- 8. Evans JP, Simmons LW (2008) The genetic basis of traits regulating sperm competition and polyandry: can selection favour the evolution of good- and sexy-sperm? Genetica 134: 5–19. [DOI] [PubMed] [Google Scholar]
- 9. Foerster K, Delhey K, Johnsen A, Lifjeld JT, Kempenaers B (2003) Females increase offspring heterozygosity and fitness through extra-pair matings. Nature 425: 714–717. [DOI] [PubMed] [Google Scholar]
- 10. Birkhead TR, Pizzari T (2002) Postcopulatory sexual selection. Nat Rev Genet 3: 262–273. [DOI] [PubMed] [Google Scholar]
- 11. Kokko H, Rankin DJ (2006) Lonely hearts or sex in the city? Density-dependent effects in mating systems. Phil Trans R Soc Lond B Biol Sci 361: 319–334. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Uller T, Olsson M (2008) Multiple paternity in reptiles: patterns and processes. Mol Ecol 17: 2566–2580. [DOI] [PubMed] [Google Scholar]
- 13. Liu JX, Tatarenkov A, Teejay A, Moyle PB, Avise JC (2013) Molecular evidence for multiple paternity in a population of the viviparous Tule Perch Hysterocarpus traski . J Hered 104: 217–222. [DOI] [PubMed] [Google Scholar]
- 14. Parker GA (1970) Sperm competition and its evolutionary consequences in the insects. Biol Rev 45: 525–567. [Google Scholar]
- 15. Paterson IG, Partridge V, Buckland-Nicks J (2001) Multiple paternity in Littorina obtusata (Gastropoda, Littorinidae) revealed by microsatellite analyses. Biol Bull 200: 261–267. [DOI] [PubMed] [Google Scholar]
- 16. Angeloni L, Bradbury JW, Burton RS (2003) Multiple mating, paternity, and body size in a simultaneous hermaphrodite, Aplysia californica . Behav Ecol 14: 554–560. [Google Scholar]
- 17. Dupont L, Richard J, Paulet Y, Thouzeau G, Viard F (2006) Gregariousness and protandry promote reproductive insurance in the invasive gastropod Crepidula fornicata: evidence from assignment of larval paternity. Mol Ecol 15: 3009–3021. [DOI] [PubMed] [Google Scholar]
- 18. Walker DE, Power AJ, Sweeney-Reeves M, Avise JC (2007) Multiple paternity and female sperm usage along egg-case strings of the knobbed whelk, Busycon carica (Mollusca: Melongenidae). Mar Biol 151: 53–61. [Google Scholar]
- 19. Lombardo RC, Takeshita F, Abe S, Goshima S (2012) Mate choice by males and paternity distribution in offspring of triple-mated females in Neptunea arthritica (Gastropoda: Buccinidae). J Molluscan Stud 78: 283–289. [Google Scholar]
- 20. Kamel SJ, Grosberg RK (2012) Exclusive male care despite extreme female promiscuity and low paternity in a marine snail. Ecol Lett 15: 1167–1173. [DOI] [PubMed] [Google Scholar]
- 21. Kupfernagel S, Rusterholz HP, Baur B (2010) Variation in multiple paternity and sperm utilization patterns in natural populations of a simultaneous hermaphrodite land snail. Biol J Linn Soc Lond 99: 350–361. [Google Scholar]
- 22. Mäkinen T, Panova M, André C (2007) High levels of multiple paternity in Littorina saxatilis: hedging the bets? J Hered 98: 705–711. [DOI] [PubMed] [Google Scholar]
- 23. Brante A, Fernández M, Viard F (2011) Microsatellite evidence for sperm storage and multiple paternity in the marine gastropod Crepidula coquimbensis . J Exp Mar Biol Ecol 396: 83–88. [Google Scholar]
- 24.Merle D, Garrigues B, Pointier JP (2011) Fossil and Recent Muricidae of the World - Part Muricinae. Hackenheim: ConchBooks. 648 p.
- 25. Chung EY, Kim SY, Park K, Park GM (2002) Sexual maturation, spawning, and deposition of the egg capsules of the female purple shell, Rapana venosa (Gastropoda: Muricidae). Malacologia 44: 241–258. [Google Scholar]
- 26. Chandler E, Mcdowell J, Graves J (2008) Genetically monomorphic invasive populations of the rapa whelk, Rapana venosa . Mol Ecol 17: 4079–4091. [DOI] [PubMed] [Google Scholar]
- 27. Wei LP, Qiu SY, Wang BG, Sun XF, Wang XD (1999) Studies on the reproductive biology of Rapana venosa . Fisheries Science 23: 150–155 (in Chinese with English abstracts).. [Google Scholar]
- 28. Lee CY (1959) Reproduction and embryonic development of Rapana pecheliensis Grabau and King. Periodical of Ocean University of China 1: 92–130 (in Chinese with English abstracts).. [Google Scholar]
- 29. Hou ST, Cheng JM, Hou L, Wang QY, Li GH (1990) Morphlogy of reproductive system of Rapana venosa (Valenciennes)(Gastropoda). Acta Zoologica Sinica 36: 399–405 (in Chinese with English abstracts).. [Google Scholar]
- 30. Glenn TC, Schable NA (2005) Isolating microsatellite DNA loci. Methods Enzymol 395: 202–222. [DOI] [PubMed] [Google Scholar]
- 31.Park S (2001) Trypanotolerance in West African cattle and the population genetic effects of selection. Ph D thesis, University of Dublin.
- 32. Rousset F (2008) GENEPOP’007: a complete re-implementation of the GENEPOP software for Windows and Linux. Mol Ecol Resour 8: 103–106. [DOI] [PubMed] [Google Scholar]
- 33. Jones AG (2005) GERUD 2.0: a computer program for the reconstruction of parental genotypes from half-sib progeny arrays with known or unknown parents. Mol Ecol Notes 5: 708–711. [Google Scholar]
- 34. van Oosterhout C, Hutchinson WF, Wills DP, Shipley P (2004) Micro-Checker: software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes 4: 535–538. [Google Scholar]
- 35. Barreto FS, Avise JC (2008) Polygynandry and sexual size dimorphism in the sea spider Ammothea hilgendorfi (Pycnogonida: Ammotheidae), a marine arthropod with brood-carrying males. Mol Ecol 17: 4164–4175. [DOI] [PubMed] [Google Scholar]
- 36. Liu JX, Avise JC (2011) High degree of multiple paternity in the viviparous Shiner Perch, Cymatogaster aggregata, a fish with long-term female sperm storage. Mar Biol 158: 893–901. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Wang JL (2004) Sibship reconstruction from genetic data with typing errors. Genetics 166: 1963–1979. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Jones OR, Wang JL (2010) COLONY: a program for parentage and sibship inference from multilocus genotype data. Mol Ecol Resour 10: 551–555. [DOI] [PubMed] [Google Scholar]
- 39. Nonacs P (2000) Measuring and using skew in the study of social behavior and evolution. Am Nat 156: 577–589. [DOI] [PubMed] [Google Scholar]
- 40. Sefc KM, Koblmüller S (2009) Assessing parent numbers from offspring genotypes: the importance of marker polymorphism. J Hered 100: 197–205. [DOI] [PubMed] [Google Scholar]
- 41. Jones B, Grossman GD, Walsh DC, Porter BA, Avise JC, et al. (2007) Estimating differential reproductive success from nests of related individuals, with application to a study of the mottled sculpin, Cottus bairdi . Genetics 176: 2427–2439. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Panova M, Boström J, Hofving T, Areskoug T, Eriksson A, et al. (2010) Extreme female promiscuity in a non-social invertebrate species. PloS One 5: e9640 DOI: 10.1371/journal.pone.0009640 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Zahradnik TD, Lemay MA, Boulding EG (2008) Choosy males in a littorinid gastropod: male Littorina subrotundata prefer large and virgin females. J Molluscan Stud 74: 245. [Google Scholar]
- 44. Miranda RM, Lombardo RC, Goshima S (2008) Copulation behaviour of Neptunea arthritica: baseline considerations on broodstocks as the first step for seed production technology development. Aquac Res 39: 283–290. [Google Scholar]
- 45. Rogers DW, Chase R (2002) Determinants of paternity in the garden snail Helix aspersa . Behav Ecol Sociobiol 52: 289–295. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
A file containing the genotypes at 4 or 5 microsatellite loci of all offspring used in the Colony analyses is available from the Dryad Digital Repository: http://doi.org/10.5061/dryad.88741.