Abstract
Background: The ectopic expression of receptor tyrosine kinase Ror1 has been reported in patients with hematological malignancies such as chronic lymphocytic leukemia and acute lymphoblastic leukemia. Here we report, for the first time, expression of ROR1 gene in both tumor tissues and peripheral blood mononuclear cells (PBMC) from patients with renal cancer (RC). Methods: In the current study, the expression of ROR1 gene was semi-quantitatively measured in PBMC and tumor tissues from 16 RC patients as well as PBMC from 22 healthy individuals relative to the expression of the housekeeping gene phosphoglucomutase 1 by RT-PCR. Results: Our results showed that ROR1 was expressed at gene level in 81.3% of renal tumor tissues (13 out of 16) whereas it was expressed in 94% of PBMC from RC patients (15 out of 16). A weak expression of ROR1 was observed in PBMC of 4 out of 22 healthy individual. A significant expression of ROR1 was observed in PBMC from RC patients when compared to that in PBMC from normal healthy individuals (P<0.001). The expression of ROR1 in PBMC may reflect a shedding of tumor cells into blood stream. Conclusion: We conclude that detection of a high level of ROR1 expression in blood cells might assist in early detection of renal malignancies, providing taking into consideration the clinical symptoms of the disease.
Key Words: ROR1, Ectopic expression, Renal cancer
INTRODUCTION
Early detection of cancer cells significantly increases the possibility of successful treatment of patients with cancer. There are several molecular markers for diagnosis and prognosis of patients with renal cancer (RC) which includes Von Hippel-Lindau, Hypoxia-inducible factor 1 alpha, and carbonic anhydrase 9 [1-3]. However, these molecular markers are still insufficient as prediction tools in treatment and prognosis of the RC patients and have not been established as reliable tools in clinical practice. In this regard, the identification of more reliable tumor markers capable of characterizing cancer cells using more accessible patients’ specimens such as peripheral blood or urine would be of great assist in managing the patients.
Recently, we and others have reported expression of receptor tyrosine kinase (RTK) Ror1 at gene and protein levels in patients with chronic lymphocytic leukemia (CLL) and acute lymphoblastic leukemia (ALL) [4-8]. Human Ror 1 (hRor1) has a role in cancer and also it has been identified as a potent survival kinase in HeLa cervical carcinoma cells [9]. Ror proteins are type-1 transmembrane RTK and like other RTK, they are predominantly located in the plasma membrane [10, 11]. hROR1 gene is located on chromosome 1p31-p32 [12, 13] and consists of 937 amino acids (914 after cleavage of the signal peptide) [14]. The expression of Ror1 is restricted to heart, kidney, brain, skeletal muscle and lung in embryonic stages [15].Also it is expressed in the heart, and prostate [16, 17]. Normal adult tissues do not express cell surface Ror1 molecule [7]. Our preliminary RT-PCR results in a panel of solid tumor cell lines showed that ROR1 expression is not restricted to B cell malignancies and it is also expressed in some other solid tumors including renal cell carcinoma cell lines (Unpublished data). This finding directed us to investigate the expression of ROR1 in tumor tissues as well as peripheral blood mononuclear cells (PBMC) from RC patients.
MATERIALS AND METHODS
Patients. Sixteen patients with renal malignancies were selected from five hospitals in Tehran (Iran). The study was approved by the Ethical Committee of Avicenna Research Institute and an informed consent was obtained from patients and healthy volunteers. The patients (n = 16) are composed of 3 women and 13 men with the age of 56.9 ± 10.4 years from whom 16 fresh tumor in addition to their peripheral blood samples were collected. This group included 8 patients with renal cell carcinoma, 5 with transitional cell carcinoma, and 3 with papillary cell carcinoma. Data about the stages of tumors and the age groups of the patients with RC are summarized in Table 1. The control group included blood samples from 22 normal individuals (11 women and 11 men, aged 56.3 ± 16.2) with no background of cancer.
Isolation of peripheral blood mononuclear cells. PBMC were isolated using Ficoll (Amersham Pharmacia Biotech, Chicago, IL, USA) density-gradient centrifuge [18]. Then, PBMC were washed twice with PBS.
RNA extraction and cDNA synthesis. Total cellular RNA was extracted from tumor tissues and PBMC with RNA-Bee reagent (BioSite, Täby, Sweden) according to the manufacturer’s instructions. Reverse transcription was carried out in 20 μl reaction containing 5 μg total RNA, 1 U murine leukemia virus (M-Mulv) reverse transcriptase, 1 μl 20 pmol/μl random hexamer (N6), 1 U RNase inhibitor, 1 mM each of dNTP, and 4 μl 5× buffer (Invitrogen, Carlsbad, CA, USA). The tubes were incubated at 42°C for 45 min and then at 90°C for 5 min to terminate the reaction. The reaction products were used as template for PCR.
Table 1.
ROR1 expression profile and phenotypic characterization of 16 RC patients.
| No. | IC | Age | Sex | Stage | RCC Phenotype |
ROR1
(RT-PCR) |
|---|---|---|---|---|---|---|
| 1 | 74 | 49 | M | T3, N1 | Papillary renal cell carcinoma | + |
| 2 | 33 | 54 | M | T2 | Transitional cell carcinoma of renal pelvis | + |
| 3 | 18 | 50 | M | T1 | Transitional cell carcinoma of renal pelvis | + |
| 4 | 66 | 31 | M | T2, N1 | Renal cell carcinoma (sarcomatoid features) | + |
| 5 | 7 | 46 | M | T2 | Transitional cell carcinoma of renal pelvis | + |
| 6 | 10 | 82 | M | T2, N1 | Renal cell carcinoma (clear cell type) | + |
| 7 | 12 | 61 | F | T1 | Papillary renal cell carcinoma | + |
| 8 | 17 | 71 | M | T3 | Papillary Transitional cell carcinoma of renal pelvis | + |
| 9 | 57 | 57 | M | T2 | Renal cell carcinoma (chromophobe cell type) | + |
| 10 | 9 | 49 | F | T1 | Transitional cell carcinoma of renal pelvis | + |
| 11 | 55 | 62 | M | T2 | Renal cell carcinoma (clear cell type) | + |
| 12 | 84 | 53 | M | T1 | Renal cell carcinoma (clear cell type) | + |
| 13 | 14 | 56 | M | T2 | Transitional cell carcinoma of renal pelvis | - |
| 14 | 90 | 50 | M | T2 | Renal cell carcinoma (clear cell type) | - |
| 15 | 5 | 66 | M | T2 | Renal cell carcinoma (clear and granular cell type) | - |
| 16 | 31 | 67 | F | T2 | Renal cell carcinoma (clear and granular cell type) | + |
IC, internal code; M, male; F, female; T, tumor; N, nodes; T1, the tumor is no more than 7 cm across and is completely inside the kidney; T2, the tumor is more than 7 cm across, but is still completely inside the kidney; T3, the cancer has spread through the kidney capsule, to a major vein, the adrenal gland or other tissues immediately surrounding the kidney; N1, cancer spread to one nearby lymph node only
Fig. 1.
RT-PCR of ROR1 and PGM1 genes. ROR1 and PGM1 PCR products related to each sample were electrophoresed together in equal volumes in the same wells of 1.5% ethidium bromide. (Upper panel) lanes 1 to 16: tissues of patient with RC. (Lower panel) lanes 1 to 16: PBMC from renal cancer patients. M, molecular weight marker VIII Roche (Roche Diagnostic, Mannheim, Germany).
Reverse transcriptase-polymerase chain reaction (RT-PCR). RT-PCR was performed with Ror1 primers [6] and phosphoglucomutase 1 (PGM1) primers (TCCGACTGAGCGGCACTGGGAGTGC as sense and GCCCGCAGGTCCTCTTTCCCTCA CA as anti-sense) [19]. PCR cycling parameters for the ROR1 primers were at 95°C for 2 min followed by 35 cycles of 30 s at 95°C, 30 s at 60°C, and 1 min at 72°C. PCR cycling parameters for the PGM1 primers sets were 2 min at 95°C followed by 30 cycles of 30 s at 95°C, 30 s at 67°C, and 30 s at 72°C. PCR was carried out in a 25 μl reaction containing 1 μl of RT product, 1 μl of forward and reverse primers (10 Pmol/μl), 1 μl dNTP (10 mM), 1 mM MgCl2, 2.5 μl 10× buffer, and 1U Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA). The amplicon sizes of ROR1 and PGM1 PCR products were 545 and 387 bp, respectively. ROR1 and PGM1 PCR products related to each sample were electrophoresed together in equal volumes in the same wells of 1.5% ethidium bromide-stained agarose gels and visualized under UV light. The intensity of bands was analyzed with Labworks 4.0 software (UVP, USA) and the expression of ROR1 gene was measured semi-quantitatively relative to the expression of PGM1, in each sample.
Statistical analysis. Statistical analysis of the data was performed using the Statistical Package for Social Sciences (SPSS, Chicago, IL) version 11.2. The differences between values of parameters in the independent and dependent groups were determined using Mann-Whitney U test and Wilcoxon signed-rank test, respectively. In addition, Fisher’s exact and Chi square test were used for assessment of differences between qualitative variables. P value <0.05 was assigned to define the significance levels.
RESULTS
The representative RT-PCR amplification of ROR1 in RC PBMC and tissue samples are shown in Figure 1. In this study, PBMC of 22 healthy individuals, with no history of cancer diseases, were evaluated for relative expression of ROR1 gene transcript. Among these, 18 individuals did not show any ROR1 expression whereas 4 exhibited low levels of ROR1 expression (Data not shown). Based on these data, an arbitrary cut off level of 4.2 (mean + 2 SD) was defined. Accordingly, only 2 of the normal donors had ROR1 expression above the cut off level. ROR1 was expressed in 13 out of 16 RC tissue samples about cut off level, whereas its expression was detected in 15 out of 16 RC PBMC (Figs. 2 and 3).
Fig. 2.
Relative expression of ROR1 in 16 RC tissue samples. Dotted line shows the cut off level (4.2). The numbering corresponds to patients numbering in Table 1
Fig. 3.
Relative expression of ROR1 in PBMC of 16 renal cancer (RC) patients. Dotted line shows the cut off level (4.2). The numbering corresponds to patients numbering in Table 1.
When ROR1 gene expression was measured in PBMC of RC patients, there was a significantly higher expression of ROR1 in PBMC of RC patients when compared to normal controls (P<0.001). In addition, the ROR1 expression levels in tumoral tissues related to RC patients were significantly higher than that in normal PBMC (P<0.001). In Figures 2 and 3, we show relative expression of ROR1 in tissue and PBMC of RC patients, respectively. No significant difference was observed between ROR1 expression in tumoral tissues and their PBMC counterparts (P>0.05, Fig. 4).
Fig. 4.
Comparison of relative expression of ROR1 in healthy PBMC (n = 22), renal cancer (RC) patients´ PBMC (n = 16), and renal cancer (RC) patients´ tissues (n = 16). Dotted line shows the cut off level (4.2). Significant values are bolded
There was no significant difference between various stages of RC for ROR1 expression in both blood and tissue. ROR1 gene expression in different age groups showed that the age had no effect on ROR1 expression in peripheral blood and tumoral tissues of patients with RC.
DISCUSSION
Expression of Ror1 in two hematological malignancies of ALL and CLL has been reported previously. Here, we report the expression of ROR1 (at gene level) in a solid tumor. Apart from the role of this RTK in pathogenesis of cancer, its detection in the peripheral blood cells is an important discovery which may pave the way for solving problems in early cancer detection. Our results clearly show that ROR1 could be used as a tumor marker for diagnosis and detection of RC patients which of course needs further technical optimization. Among 16 RC patients’ PBMC studied here, only one of them did not show expression of ROR1 gene above the cut off level, indicating 95% detection rates. To our best knowledge, no single marker so far has yielded such a high percentage of positive cases in a given solid malignancy. We assume that the bias in expression of ROR1 in tissues and PBMC from RC patients might be due to sample preparation either during the surgery or RNA preparation.
No significant difference was found in expression of ROR1 with regard to the different stages of the disease indicating a constitutive expression of ROR1. This constitutive expression has previously been observed in a B cell-derived malignancy like CLL [6] and may imply that ROR1 has also playing the same role in the pathogenesis of RC.
The ROR1 gene is predominantly expressed during embryogenesis and principally is involved in development of different tissues. Interestingly, no cell surface expression of ROR1 has been reported in normal adult tissues yet [7]; therefore, making it an ideal kidney tumor marker.
Although we have previously shown that Swedish normal healthy PBMC do not express ROR1 transcript [6], a very low level expression of ROR1 was observed in PBMC from 4 healthy individuals used in this study with no history of cancer. This low expression of ROR1 gene might be due to either spontaneous stimulation of PBMC during Ficoll separation or it may reflect a genetic background of Iranian population as observed in our previous study [4]. As the ultimate goal is to establish a reliable RT-PCR based technique for detection of cancer cells using peripheral blood cells, considering such a low level of expression is essential for accurate diagnosis. Furthermore, it is obvious that real-time quantitative PCR would increase the accuracy of the assay. Further studies including a large number of samples in each group using real-time quantitative PCR as well as detection at protein level is warranted. Moreover, it would be interesting to investigate the expression of ROR1 in the urine from patients with RC where the shedding of cancer cells is more probable.
To our knowledge, this is the first report describing expression of ROR1 gene in a solid tumor as well as its detection in PBMC from these patients. Altogether, our results suggest that high levels of ROR1 expression in blood cells might be used as a potential marker for detection and perhaps for monitoring RC patients following any treatment.
ACKNOWLEDGEMENTS
We wish to thank Dr. Saeed Talebi for his invaluable comments on discussion part.
References
- 1.Lidgren A, Hedberg Y, Grankvist K, Rasmuson T, Vasko J, Ljungberg B. The expression of hypoxia-inducible factor 1alpha is a favorable independent prognostic factor in renal cell carcinoma. Clin Cancer Res. 2005;11:1129–1135. [PubMed] [Google Scholar]
- 2.Linehan W M, Walther M M, Zbar B. The genetic basis of cancer of the kidney. J Urol . 2003;170:2163–2172. doi: 10.1097/01.ju.0000096060.92397.ed. [DOI] [PubMed] [Google Scholar]
- 3.Pastorek J, Pastorekova S, Callebaut I, Mornon J P, Zelnik V, Opavsky R, Zatovicova M, Liao S, Portetelle D, Stanbridge E J, Zavada J, Burny A, Kettmann R. Cloning and characterization of MN a human tumor-associated protein with a domain homologous to carbonic anhydrase and a putative helix-loop-helix DNA binding segment. Oncogene. 1994;9:2877–2888. [PubMed] [Google Scholar]
- 4.Shabani M, Asgarian-Omran H, Vossough P, Ramazan A, Sharifian R A, Faranoush M, Ghragozlou S, Khoshnoodi J, Roohi A, Jeddi-Tehrani M, Mellstedt H, Rabbani H, Shokri F. Expression profile of orphan receptor tyrosine kinase (ROR1) and Wilms' tumor gene 1 (WT1) in different subsets of B-cell acute lymphoblastic leukemia. Leuk Lymphoma. 2008;49:1360–1367. doi: 10.1080/10428190802124000. [DOI] [PubMed] [Google Scholar]
- 5.Fukuda T, Chen L, Endo T, Tang L, Lu D, Castro J E, Widhopf G F, Rassenti L Z, Cantwell M J, Prussak C E, Dennis A, Carson D A, Kipps T J. Antisera induced by infusions of autologous Ad-CD154-leukemia B cells identify ROR1 as an oncofetal antigen and receptor for Wnt5a. Proc Natl Acad Sci USA. 2008;105(8):3047–3052. doi: 10.1073/pnas.0712148105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Daneshmanesh A H, Mikaelsson E, Jeddi-Tehrani M, Bayat A A, Ghods R, Ostadkarampour M, Akhondi M, Lagererantz S, Larsson C, Osterborg A, Shokri F, Mellstedt H, Rabbani H. Ror1 a cell surface receptor tyrosine kinase is expressed in chronic lymphocytic leukemia and may serve as a putative target for therapy. Int J Cancer. 2008;123:1190–1195. doi: 10.1002/ijc.23587. [DOI] [PubMed] [Google Scholar]
- 7.Baskar S, Kwong K Y, Hofer T, Levy J M, Kennedy M G, Lee E, Staudt L M, Wilson W H, Wiestner A, Rader C. Unique cell surface expression of receptor tyrosine kinase ROR1 in human B-cell chronic lymphocytic leukemia. Clin Cancer Res. 2008;14:396–404. doi: 10.1158/1078-0432.CCR-07-1823. [DOI] [PubMed] [Google Scholar]
- 8.Shabani M, Asgarian-Omran H, Jeddi-Tehrani M, Vossough P, Faranoush M, Sharifian R A, Toughe G R, Kordmahin M, Khoshnoodi J, Roohi A, Tavoosi N, Mellstedt H, Rabbani H, Shokri F. Over expression of orphan receptor tyrosine kinase Ror1 as a putative tumor-associated antigen in Iranian patients with acute lymphoblastic leukemia. Tumour Biol . 2007;28:318–326. doi: 10.1159/000121405. [DOI] [PubMed] [Google Scholar]
- 9.MacKeigan J P, Murphy L O, Blenis J. Sensitized RNAi screen of human kinases and phosphatases identifies new regulators of apoptosis and chemoresistance. Nat Cell Biol . 2005;7:591–600. doi: 10.1038/ncb1258. [DOI] [PubMed] [Google Scholar]
- 10.Matsuda T, Nomi M, Ikeya M, Kani S, Oishi I, Terashima T, Takada S, Minami Y. Expression of the receptor tyrosine kinase genes Ror1 and Ror2 during mouse development. Mech Dev. 2001;105:153–156. doi: 10.1016/s0925-4773(01)00383-5. [DOI] [PubMed] [Google Scholar]
- 11.Green J L, Kuntz S G, Sternberg P W. Ror receptor tyrosine kinases: orphans no more. Trends Cell Biol . 2008;18:536–544. doi: 10.1016/j.tcb.2008.08.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Reddy U R, Phatak S, Allen C, Nycum L M, Sulman E P, White P S, Biegel J A. Localization of the human Ror1 gene (NTRKR1) to chromosome 1p31-p32 by fluorescence in situ hybridization and somatic cell hybrid analysis. Genomics . 1997;41:283–285. doi: 10.1006/geno.1997.4653. [DOI] [PubMed] [Google Scholar]
- 13.Masiakowski P, Carroll R D. A novel family of cell surface receptors with tyrosine kinase-like domain. J Biol Chem. 1992;267:26181–26190. [PubMed] [Google Scholar]
- 14.Forrester W C. The Ror receptor tyrosine kinase family. Cell Mol Life Sci . 2002;59:83–96. doi: 10.1007/s00018-002-8407-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Reddy U R, Phatak S, Pleasure D. Human neural tissues express a truncated Ror1 receptor tyrosine kinase lacking both extracellular and transmembrane domains. Oncogene. 1996;13:1555–1559. [PubMed] [Google Scholar]
- 16.Oishi I, Takeuchi S, Hashimoto R, Nagabukuro A, Ueda T, Liu Z J, Hatta T, Akira S, Matsuda Y, Yamamura H, Otani H, Minami Y. Spatio-temporally regulated expression of receptor tyrosine kinases mRor1 mRor2 during mouse development: implications in development and function of the nervous system. Genes Cells. 1999;4:41–56. doi: 10.1046/j.1365-2443.1999.00234.x. [DOI] [PubMed] [Google Scholar]
- 17.Al-Shawi R, Ashton S V, Underwood C, Simons J P. Expression of the Ror1 and Ror2 receptor tyrosine kinase genes during mouse development. Dev Genes Evol . 2001;211:161–171. doi: 10.1007/s004270100140. [DOI] [PubMed] [Google Scholar]
- 18.Rezvany M R, Jeddi-Tehrani M, Rabbani H, Lewin N, Avila-Carino J, Osterborg A, Wigzell H, Mellstedt H. Autologous T lymphocytes may specifically recognize leukaemic B cells in patients with chronic lymphocytic leukaemia. Br J Haematol . 2000;111:608–617. doi: 10.1046/j.1365-2141.2000.02383.x. [DOI] [PubMed] [Google Scholar]
- 19.Hosseini-Asl S, Modarressi M H, Atri M, Salhab M, Mokbel K, Mehdipou P. The association between telomerase activity and expression of its RNA component (hTR) in breast cancer patients: the importance of DNase treatment. J Carcinog . 2006;5:17. doi: 10.1186/1477-3163-5-17. [DOI] [PMC free article] [PubMed] [Google Scholar]