Skip to main content
NCBI home page
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2014 Jan;80(2):741–750. doi: 10.1128/AEM.02907-13

A Moderately Thermophilic Mixed Microbial Culture for Bioleaching of Chalcopyrite Concentrate at High Pulp Density

Yuguang Wang a, Weimin Zeng a,b, Guanzhou Qiu a,b, Xinhua Chen c, Hongbo Zhou a,b,✉
PMCID: PMC3911102  PMID: 24242252

Abstract

Three kinds of samples (acid mine drainage, coal mine wastewater, and thermal spring) derived from different sites were collected in China. Thereafter, these samples were combined and then inoculated into a basal salts solution in which different substrates (ferrous sulfate, elemental sulfur, and chalcopyrite) served as energy sources. After that, the mixed cultures growing on different substrates were pooled equally, resulting in a final mixed culture. After being adapted to gradually increasing pulp densities of chalcopyrite concentrate by serial subculturing for more than 2 years, the final culture was able to efficiently leach the chalcopyrite at a pulp density of 20% (wt/vol). At that pulp density, the culture extracted 60.4% of copper from the chalcopyrite in 25 days. The bacterial and archaeal diversities during adaptation were analyzed by denaturing gradient gel electrophoresis and constructing clone libraries of the 16S rRNA gene. The results show that the culture consisted mainly of four species, including Leptospirillum ferriphilum, Acidithiobacillus caldus, Sulfobacillus acidophilus, and Ferroplasma thermophilum, before adapting to a pulp density of 4%. However, L. ferriphilum could not be detected when the pulp density was greater than 4%. Real-time quantitative PCR was employed to monitor the microbial dynamics during bioleaching at a pulp density of 20%. The results show that A. caldus was the predominant species in the initial stage, while S. acidophilus rather than A. caldus became the predominant species in the middle stage. F. thermophilum accounted for the greatest proportion in the final stage.

INTRODUCTION

Chalcopyrite is the most abundant of copper sulfides, accounting for about 70% of copper reserves in the world (1). It is also the most refractory to chemical or biological leaching (2). Several hypotheses have been proposed to account for this phenomenon, such as formation of passivation layers on the surface, a very stable structural configuration of chalcopyrite, and high lattice energy (1, 3, 4). Bioleaching of chalcopyrite on an industrial scale is still an immature method, although many processes have been tested to enhance copper extraction from chalcopyrite (5, 6).

The bioleaching process for sulfide minerals is affected by the choice of microorganism, pH, redox potential, and temperature (7), the choice of microorganism being one of the most important factors. Many published reports indicated that mixed cultures are more efficient and more robust in oxidizing sulfide minerals than pure cultures (7–13). However, the bioleaching system has many microbial niches, among which more than 14 genera and 33 species are distributed (10, 14). Thus, determining how to develop and optimize microbial consortia for bioleaching is a big challenge.

Two absolutely contrary approaches, “top down” and “bottom up,” have been proposed and used to develop optimal microbial consortia for bioleaching (15). For a top-down approach, a mix culture which contains a wide variety of different species and strains of acidophiles derived from environmental samples or specific cultures is used as the inoculum to treat sulfide minerals. In this “see-who-wins” approach, a limited number of species remain while those which are not fit for bioleaching of a particular mineral disappear. Using this approach, many researchers have established efficient and robust cultures for bioleaching at pulp densities of less than 12% (wt/vol) (3, 16–23). In contrast, the basic principle of the bottom-up approach is to assemble a highly efficient, stable, and robust consortium for treatment of a particular mineral. The physiological properties and ecological functions of different species contained in the consortium, such as being able to oxidize sulfur and/or ferrous iron or to grow autotrophically and/or heterotrophically, are complementary. Temperature, pH, physiologies of individual species, and other factors, such as metals and toxic ions, are determinative factors for the “logically designed” consortium. Previous reports indicated that cultures prepared on the basis of the bottom-up approach were more efficient in accelerating mineral oxidation (2, 7, 24–29). A previous study by us had demonstrated that a culture containing autotrophs and mixotrophs was far more effective in promoting chalcopyrite leaching than a mixed culture containing any combination of two or three of the four species (Acidithiobacillus caldus, Leptospirillum ferriphilum, Sulfobacillus sp., and Ferroplasma thermophilum) (30).

After a culture is prepared for bioleaching, the challenge is to adapt it to high pulp density and to toleration of a high metal ion concentration. Subculturing under conditions of constant or increasing pulp densities and metal ion concentrations is a well-known method for enhancing bioleaching performance of microorganisms and has been adopted by many researchers (3, 18, 23, 31, 32). However, it has been noted that pulp densities of greater than 15% are detrimental to cell viability and oxidizing activity (33, 34). Thus, few reports dealing with adaptation of moderately thermophilic cultures to a pulp density of greater than 15%, especially of chalcopyrite concentrate, have appeared. Only one study on bioleaching of complex copper concentrate at a pulp density of 20% was reported (35). In that study, galvanic interaction derived from pyrite could significantly enhance chalcopyrite dissolution. And chalcocite and copper oxide minerals contained in the complex copper concentrate could be easily oxidized during bioleaching. Thus, a high level of copper extraction was obtained by controlling redox potential. Moreover, those authors did not describe the adaptation strategy clearly and did not provide any microbial information. It is essential that the microbial diversity of a culture adapted to high pulp density is maintained. However, most researchers did not investigate changes in microbial diversity and population dynamics during adaption. Thus, we have only limited information about how microbial communities develop and how community members interact during adaptation to increasing pulp densities.

The aim of the present study was to assemble a moderately thermophilic mixed culture to bioleach chalcopyrite concentrate. After that, the culture was adapted to gradually increasing pulp densities of chalcopyrite concentrate. The bacterial and archaeal diversities during adaptation were analyzed by denaturing gradient gel electrophoresis and constructing clone libraries of the 16S rRNA gene. Finally, to evaluate its ability for bioleaching, bioleaching of chalcopyrite concentrate was carried out at a pulp density of 20% and the community dynamics was analyzed by real-time quantitative PCR (qPCR).

MATERIALS AND METHODS

Assembly and adaptation of a moderately thermophilic culture.

Several samples derived from different sources, including acid mine drainage, coal mine wastewater, and a thermal spring, were collected from the Dexing copper mine of Jiangxi province, Tongshankou copper mine of Hubei province, Yufu mine of Guangdong province, Chenzhou coal mine of Hunan province, and Tengchong thermal spring of Yunnan province in China. Portions (100 to 150 ml) of each of the various samples were combined and then inoculated into a medium composed of basal salts. Portions (30 ml) of the combined samples were inoculated into 120 ml of each of four media contained in 500-ml Erlenmeyer flasks. All four media consisted of a basal salts solution containing (NH4)2SO4 (3 g/liter), KCl (0.1 g/liter), K2HPO4 (0.5 g/liter), MgSO4·7H2O (0.5 g/liter), and Ca(NO3)2 (0.01 g/liter). The pH of the solution was adjusted to 2.0 with 9 M sulfuric acid. To one portion of this basal salts solution, 30 g of FeSO4·7H2O per liter was added; to a second portion, 10 g elemental sulfur per liter was added; to a third portion, 30 g of FeSO4·7H2O and 10 g elemental sulfur per liter were added; and to a fourth portion, 5 g of chalcopyrite concentrate per liter was added. These additions served as energy sources. After incubation at 45°C, equal volumes of each of the four cultures were pooled, resulting in a moderately thermophilic mixed culture for study in subsequent experiments.

The pooled culture described above was adapted to a 20% (wt/vol) pulp density of chalcopyrite concentrate by serial subculturing. Depending on the pulp density, the duration of incubation of each subculture ranged from 5 to 28 days. Each transfer during the adaptation process was made when the cell density of a culture reached 1 × 108 to 2 × 108 cells/ml.

First, the pooled culture was cultivated in the basalt salts solution, with gradual replacement upon subculture of the FeSO4·7H2O and the sulfur by chalcopyrite concentrate. In the first two subcultures, FeSO4·7H2O (10 g/liter), elemental sulfur (5 g/liter), and chalcopyrite concentrate (5 g/liter) were used as energy substrates. In the third subculture, the concentrations of FeSO4·7H2O, elemental sulfur, and chalcopyrite concentrate were 5 g/liter, 1 g/liter, and 10 g/liter, respectively. After that, the same medium was used for the fourth subculture. In the fifth subculture, 10 g/liter of chalcopyrite concentrate was used as the sole energy source. This procedure was repeated three times until the cell density of a culture reached 1 × 108 to 2 × 108 cells/ml within 5 days. Thereafter, the culture was transferred to increasing pulp densities of chalcopyrite concentrate for adaptation. The pulp density was gradually increased to 2%, 4%, 6%, 8%, 10%, 12%, 14%, 16%, 18%, and 20% (wt/vol). Subculturing was done as soon as the cell density reached 1 × 108 to 2 × 108 cells/ml. Subculturing was repeated at least twice at each pulp density when it was greater than 8%. After being adapted to a pulp density of 20%, the final culture was subcultured continually at that pulp density and maintained as an active culture at our laboratory. The adaptation experiments were carried out in a 500-ml batch shake flask containing 150 ml medium at low (<6%) pulp density or in a stirred tank reactor at high (>6%) pulp density as described below. After a subculture had adapted to a specific pulp density, samples (10 ml) were withdrawn to analyze the concentration of copper. In addition, microbial diversities were analyzed at pulp densities of 2%, 4%, 6%, 8%, 14%, and 20% using denaturing gradient gel electrophoresis (DGGE) and bacterial and archaeal clone libraries of the 16S rRNA gene.

Mineral components.

The chalcopyrite concentrate used in this study was obtained from the Dongshengmiao copper mine in Inner Mongolia, China. It was separated from copper/lead concentrate with dithiocarbamate and dithiophosphate. X-ray diffraction (XRD) and total organic carbon analyses showed chalcopyrite (60%), sphalerite (15%), and pyrrhotite (10%) as the major components and galena (5%), quartz (3%), and organic matter (0.25%) as the minor ones. The elemental composition analysis was based on the averaged results obtained by X-ray fluorescence spectrometry. The main chemical composition of the concentrate was 18.97% Cu, 24.20% Fe, 28.17% S, 4.03% Pb, 5.01% Zn, and 0.34% Ag.

Bioleaching of chalcopyrite concentrate at a pulp density of 20%.

Bioleaching experiments were carried out in a laboratory-scale jacketed stirred tank reactor made of 316L stainless steel with a total volume of 12.5 liters. It had a height/diameter ratio equal to 1 and was hermetically sealed and fitted with a condenser at the top to prevent excessive evaporation. Baffles were present on the inner wall of the reactor. Agitation was performed by means of one or two propellers located above a flat-blade disk turbine. Air was supplied by a sparger situated below the turbine. Flow rates were controlled by a rotameter. The temperature was controlled by a circulating water bath.

Bioleaching conditions were as follows: work volume, 8 liters; pulp density, 20% (wt/vol); agitation rate, 200 rpm; temperature, 45°C; airflow, 200 ml/h/liter; inoculum size, 80 ml. The cell density in the inoculum was 1 × 109 cells/ml.

The reactor was monitored daily or every 2 days for pH, cell density, iron concentration, and copper extraction. The water evaporation was compensated for with added water. The sampling loss was compensated for with added fresh medium. Community dynamics was analyzed every 5 days by real-time quantitative PCR (qPCR).

Physicochemical analysis.

The concentrations of copper and total iron in solution were measured by atomic absorption spectrometry. The ferrous iron concentration was determined by titration with potassium dichromate. The ferric iron concentration was equal to the difference between the concentrations of total iron and ferrous iron. The total density of planktonic and attached cells was determined by direct counting using an optical microscope with a hemocytometer of 0.1-mm depth and 1/400-mm2 area. The attached cells of the particulate phase were removed with 0.1% (vol/vol) Tween 20 as described by Marhual et al. (3). The pHS-3C acid meter and combination gel-filled pH electrode (INESA Scientific Instrument Co., Ltd., Shanghai, China) were adopted to measure pH value. The leached residues were analyzed by XRD.

Genomic DNA extraction and purification.

The genomic DNA from pure cultures used to evaluate primers and to construct standard curves was extracted using a TIANamp Bacteria DNA kit (Tiangen Biotech, Co., Ltd., Beijing, China) in accordance with the manufacturer's instructions. The microorganisms were harvested from 100-ml samples (including minerals and leachate) during adaptation and bioleaching by centrifuging at 10,000 × g for 15 min. DNA extraction was carried out according to the grinding-freezing-thawing-SDS method described by Zhou et al. (36). The crude genomic DNA was purified by the use of a Wizard genomic DNA purification kit (Promega) and stored at −20°C until use.

Primer evaluation for DGGE.

Seven species were employed to evaluate the universality and specificity of primers used in this study. They were Leptospirillum ferriphilum YSK, Sulfobacillus acidophilus ZW1, Acidithiobacillus caldus S2, Sulfobacillus thermosulfidooxidans YN22, Ferroplasma thermophilum L1, Ferroplasma cupricumulan BH2, and Ferroplasma acidiphilum YT. Five of these (YSK, S2, ZW1, YN22, and L1) were isolated in our laboratory (13, 37–40), and the other two (BH2 and YT) were kindly provided by Rebecca B. Hawkes (41) and Olga V. Golyshina (42), respectively.

First, similarities between the 16S rRNA genes of representative Ferroplasma and moderately thermophilic bacteria were assessed by sequence alignment to explore the feasibility of amplification of their partial 16S rRNA genes by PCR using the same primers. Subsequently, the universality of the primers for DGGE (341F [5′-CCTACGGGAGGCAGCAG-3′] and 518R [5′-GTATTACCGCGGCTGCTGG-3′]) was verified by amplification of the partial 16S rRNA genes of the seven representative moderate thermophiles as described by Muyzer et al. (43). PCR products were purified by the use of a Wizard SV Gel and PCR Clean-Up system (Promega) for sequencing to verify the universality of the primers and the sizes of PCR products.

DGGE and bacterial and archaeal clone libraries of the 16S rRNA gene.

DGGE was performed with a denaturing gradient gel electophoresis system (C.B.S. Scientific Company Inc., San Diego, CA). The protocols of DGGE, sequencing, and phylogenetic analysis were as described by Wei et al. (44) except that a denaturing gradient of 40 to 60% was used. The band intensity from DGGE was used to estimate the relative densities of the corresponding sequence types within the sample by the software Quantityone-1-D (version 4.6.2). The experiments employing the bacterial and archaeal clone libraries of the 16S rRNA gene analyses were carried out in accordance with our previous study except that primers 21F (5′-TTCCGGTTGATCCYGCCGGA-3′) and 1492R (5′-GGTTACCTTGTTACGACTT-3′) were used to amplify the 16S rRNA gene of archaea (44).

qPCR analysis.

The primers used in this study are listed in Table 1. PCR was carried out using an ABI Veriti Thermal Cycler (Life Technologies Corporation). The qPCR was performed with an iCycler iQ Real-time PCR detection system (Bio-Rad Laboratories, Inc.). Procedures for the detection of the specificity of primers and for qPCR were as described in our previous report (30).

TABLE 1.

The primers used in this study for community dynamics analysis

Primera Target species Primer sequence (5′–3′) Expected amplicon length (bp)
NR-R2b AGCTGRCGACRRCCATGCA
Lfer-P1 L. ferriphilum GGTACTAAGTGTGGGAGGGTTAAAC 253
Acaldus-P1 A. caldus TTGGCGCCTTAGGTGCTGA 239
Fer-P1 F. thermophilum CCCACTTTGATGTTGCTTTTCCG 248
Sacid-F S. acidophilus ACGTAGCGGTTTTCAGCC 244
Sacid-R GACACCTCGTATCCATCGTTTAC
Open in a new tab
a

NR-R2, Lfer-P1, and Acaldus-P1 data are from a study by Liu et al. (61). Fer-P1, Sacid-F, and Sacid-R data are from a study by Zhang et al. (30).

b

Universal primer for L. ferriphilum, A. caldus, and F. thermophilum.

Nucleotide sequence accession numbers.

The 16S rRNA gene sequences obtained in this study were submitted to the GenBank database under accession numbers JX463350 to JX463353 and accession numbers KF557570 to KF557573.

RESULTS

Copper extraction from chalcopyrite concentrate during adaptation process.

Figure 1 shows that the level of the final copper extraction from chalcopyrite concentrate during adaptation was up to 75.6% at a pulp density of 1%. At that pulp density, an average of 15.1% of copper could be extracted every day. However, the final copper extraction decreased with each increase in pulp density, from 79.0% at a pulp density of 2% to 47.6% at a pulp density of 20%. At a pulp density of 2%, the average daily copper extraction was 11.3%, whereas at a pulp density of greater than 8%, the average daily copper extraction dropped to below 4%. And the mean growth rate at a pulp density of greater than 8% was less than 0.2 generations/day compared to 0.7 generations/day at a pulp density of 2%. The time required to meet the adaptation criterion (cell density up to 1 × 108 to 2 × 108 cells/ml) increased from 7 days at a pulp density of 2% to 28 days at a pulp density of 20% (data not shown).

FIG 1.

FIG 1

Open in a new tab

Copper extraction from chalcopyrite concentrate by a moderately thermophilic mixed culture adapted to leaching at different pulp densities.

Primer analysis and verification.

Figure 2 shows the alignment of sequences of the 16S rRNA genes from seven representative moderate thermophiles. It can be seen that the 16S rRNA gene sequences of the archaea Ferroplasma spp. are very different from those of L. ferriphilum, A. caldus, and Sulfobacillus sp. at the V3 region. Although the region of the 16S rRNA genes of the archaea Ferroplasma spp. between primer sites is clearly shorter than that for the corresponding primers of the other moderate thermophiles, the universal primers 341F and 518R have a very high identity with the respective hybridization regions of the 16S rRNA gene sequences of Ferroplasma spp. and the other moderate thermophiles (only two sites for 341F and one site for 518R are mismatched).

FIG 2.

FIG 2

Open in a new tab

Alignment of the 16S rRNA gene fragments of representative moderately thermophilic species such as L. ferriphilum, A. caldus, Sulfobacillus sp., and Ferroplasma sp. (The primer binding sites are highlighted by rectangles. Nucleic acid sequences are subdivided into blocks of 10 nucleotides by asterisks above them. Shading shows the similarity of nucleotides at the given site. The darker the shading is, the greater similarity is at that site. Uppercase letters under the nucleic acid sequence indicate that the given nucleotide is the same at the site for all organisms; lowercase letters indicate that fewer than 3 nucleic acid sequences were different from other sequences at the site.)

Verification analysis was also carried out by amplifying the partial 16S rRNA genes of the seven representative moderately thermophilic bacteria and archaea using primers 341F and 518R as shown in Fig. 3. The results show that each PCR product contained a single fragment, and the result of BLAST analysis revealed that the consistencies of sequence alignment of the PCR products were all 100% (data not shown) and confirmed the length differences of PCR products between bacteria and archaea.

FIG 3.

FIG 3

Open in a new tab

Verification analysis of universal primers for DGGE by PCR. (Lanes: 1, F. cupricumulans; 2, F. thermophilum; 3, F. acidiphilum; 4, L. ferriphilum; 5, A. caldus; 6, S. acidophilus; 7, S. thermosulfidooxidans.)

Microbial diversity during the adaptation process.

Figure 4 shows DGGE band patterns for the 16S rRNA gene of the moderately thermophilic culture during adaptation at pulp densities of 2%, 4%, 6%, and 8%. Seven bands in the DGGE fingerprints were excised, reamplified, purified, and sequenced. A total of four (B1, B2, B3, and B4) of the seven sequences were identified by BLAST and included in phylogenetic tree as shown in Fig. 5. The other three bands either yielded no reamplification product or yielded a product whose sequence had too many ambiguous positions to be identified. As can be seen, B1 and B4 belonged to Sulfobacillus sp. and Ferroplasma sp., respectively (with homology of >95%); B2 and B3 showed the highest sequence similarity to A. caldus and L. ferriphilum (with >97% identity), respectively.

FIG 4.

FIG 4

Open in a new tab

DGGE band patterns of the 16S rRNA genes of the moderately thermophilic culture during adaption at pulp densities of 2% (a), 4% (b), 6% (c), and 8% (d). (The arrows indicate the sequenced bands.) The letter d followed by a number at the top of the panels indicates experimental day.

FIG 5.

FIG 5

Open in a new tab

Phylogenetic tree of the 16S rRNA gene sequences obtained by DGGE. Sequences detected by DGGE are highlighted by a triangle. The tree was constructed using sequences of comparable regions of the 16S rRNA gene sequences available in public databases. Neighbor-joining analysis using 1,000 bootstrap replicates was used to infer the tree topology.

A total of 3,325 randomly selected clones from the 34 bacterial and archaeal clone libraries of the 16S rRNA gene were screened by restriction fragment length polymorphism and grouped into identical restriction patterns. The phylogenetic tree and representative restriction fragment length profiles of the 16S rRNA gene of the bacteria and archaea are shown in Fig. S1 in the supplemental material. Table 2 shows the bacteria and archaea detected by clone libraries during adaptation at different pulp densities. As can be seen, the results were in agreement with the results obtained by DGGE and L. ferriphilum was not detected at any sampling time when the pulp density was greater than 4%. Furthermore, Sulfobacillus sp. and Ferroplasma sp. identified by DGGE were further grouped into Sulfobacillus acidophilus and Ferroplasma thermophilum.

TABLE 2.

Diversity of bacteria and archaea detected by clone libraries of the 16S rRNA gene during adaptation at different pulp densities

Pulp density (%) Day Organism detectiona
A. caldus S. acidophilus F. thermophilum L. ferriphilum
2 1 + + + +
3 + + − +
5 + + + +
7 + + + −
4 4 + + − +
7 + − − +
10 + + + +
6 5 + + − −
10 + + + −
15 + + + −
8 5 + + − −
11 + + − −
17 + + + −
14 10 + + + −
22 + + + −
20 11 + + − −
28 + + + −
Open in a new tab
a

+, the organism was detected; −, the organism was not detected.

When the pulp densities were 2% and 4%, the proportion of L. ferriphilum in the culture showed a tendency to first increase and then decrease over time (Fig. 6). When the pulp density was 6% or 8%, L. ferriphilum could not be detected at any sampling time. Both A. caldus and S. acidophilus were detected at all pulp densities and adaptation stages. Notably, the percentage of S. acidophilus increased markedly when L. ferriphilum disappeared, as shown in Fig. 6c and d. The proportion of F. thermophilum changed dramatically at all pulp densities during adaptation. In the initial stage, F. thermophilum accounted for a very low percentage of the culture which could not even be detected. However, it constituted at least 30% of the culture at the end of adaptation process.

FIG 6.

FIG 6

Open in a new tab

Proportions of different species contained in a moderately thermophilic culture determined by DGGE during adaption at pulp densities of 2% (a), 4% (b), 6% (c), and 8% (d). (Black segments, S. acidophilus; light gray segments, A. caldus; dark gray segments, L. ferriphilum; white segments, F. thermophilum.)

Bioleaching of chalcopyrite concentrate at a pulp density of 20%.

Figure 7 shows the variations of pH, cell density, and concentrations of copper and ferrous and ferric iron in the solution during bioleaching of chalcopyrite concentrate at a pulp density of 20%. It was found that only minor amounts of copper were leached before the fifth day. Thereafter, the copper extraction increased gradually to 7.11 g/liter from day 5 to day 13. Copper was leached at a high rate in the next 4 days. The copper concentration was up to 16.42 g/liter on day 17. After that, the rate of copper extraction decreased slightly. The copper concentration reached 22.90 g/liter at the end of the run.

FIG 7.

FIG 7

Open in a new tab

Variations of copper concentration (a), pH (b), cell density (c), and concentrations of ferric iron and ferrous iron (d) in the solution during bioleaching of chalcopyrite concentrate with a moderately thermophilic culture at a pulp density of 20%.

It can be seen from Fig. 7b that the pH of the bioleaching system increased at first and subsequently decreased after day 4. However, the pH increased slightly from day 12 to day 14. There was no obvious lag phase or stationary phase of growth of the culture, and the highest cell density was up to 3.0 × 108 cells/ml on day 17 (Fig. 7c). Thereafter, the cell density declined at a very high rate, but it remained at 1.7 × 108 to 1.6 × 108 cells/ml during the last 5 days. The ferrous and ferric iron concentrations increased at first and then decreased after day 18 and day 9, respectively (Fig. 7d). The concentrations of ferrous ions were very low for the first 6 days.

Community dynamics during bioleaching of chalcopyrite concentrate.

Figure 8 shows the variations in the proportions of S. acidophilus, F. thermophilum, and A. caldus on days 5, 10, 15, and 20 during bioleaching of chalcopyrite concentrate at a pulp density of 20%. A. caldus accounted for 60% of the culture on day 5. Thereafter, its proportion began to decrease gradually while bioleaching continued, representing just 16% of the culture on day 20. The proportion of S. acidophilus of the culture increased at first and then decreased. It became the dominant species in the middle stage, accounting for 66% and 62% of the culture on days 10 and 15, respectively. Although F. thermophilum accounted for a very low percentage of the culture in the initial and middle stages, it became the predominant species on day 20, accounting for 66% of the culture.

FIG 8.

FIG 8

Open in a new tab

Proportions of different species determined by real-time quantitative PCR on days 5 (a), 10 (b), 15 (c), and 20 (d) during bioleaching of chalcopyrite concentrate with a moderately thermophilic culture at a pulp density of 20%. (White segments, S. acidophilus; black segments, F. thermophilum; gray segments, A. caldus.)

DISCUSSION

Although the culture assembled for this study was completely acclimatized to chalcopyrite concentrate through gradual replacement of FeSO4·7H2O and elemental sulfur by chalcopyrite, the growth rate at a pulp density of 1% was low when chalcopyrite concentrate was used as the sole energy source after the fifth subculture (data not shown). Therefore, it was necessary to subculture continually at a pulp density of 1% to improve the bioleaching performance. Otherwise, the microbial diversity of the culture would be reduced and stability of the community would be disrupted if it were exposed to high pulp density immediately after the fifth subculture. To improve the extraction rate and tolerance of high pulp density, the method of serial subculturing was employed to adapt the culture to the increasing pulp density of chalcopyrite concentrate from 2% to 20%. The culture was able to tolerate a pulp density of 20% of chalcopyrite concentrate after more than 2 years of adaptation.

The reason why the level of copper extraction decreased and the time required to meet the adaptation criterion increased during adaptation was probably related to the high pulp density. It is believed that increasing pulp density causes a high shear force and limits oxygen and carbon dioxide transfer, which inhibit the growth and activities of microorganisms (3, 7, 18). The great metallic stress and high concentration of flotation reagent resulting from high pulp density also have toxic effects on cells (45). Although the unadapted culture might be able to grow very slowly at a pulp density of 20%, the copper extraction rate was too far below the requirements for industrial application. Therefore, stepwise adaptation of the culture to increasing pulp densities up to 20% was needed.

In moderately thermophilic bioleaching systems, Ferroplasma spp. are often dominant species in the final stage (13, 30, 46). However, currently it is difficult to analyze the diversities of bacteria and archaea in the same system using PCR. DGGE, which is convenient and less time-consuming and laborious, is one of the most popular technique for biodiversity assessment. Thus, the universality and specificity of DGGE primers (341F and 518R) for representative Ferroplasma spp. and other moderately thermophilic bacteria were evaluated and verified by sequence alignment and PCR. The hybridization potential (HP) between primers and 16S rRNA gene sequences of Ferroplasma spp. was also calculated as described by Brunk et al. (47). The HP values are 2.41 (341F) and 2.42 (518R), respectively. This suggests that the universal primers used in this study could hybridize efficiently with a unique site on the 16S rRNA gene sequences of archaea Ferroplasma spp. According to a previous report (48), a particular primer can hybridize with a target sequence if the number of mismatch sites is less than 4 at any nucleotide except for the last four nucleotides from the 3′ end. Thus, it was valid to analyze diversities of the bacteria and archaea of the mixed culture assembled in this study by DGGE using the universal primers 341F and 518R simultaneously.

The community structure analyzed by DGGE demonstrated that the microbial diversity during adaptation was relatively low, which was similar to previous reports (reviewed in reference 15). The results obtained by DGGE were also verified by the use of bacterial and archaeal clone libraries of the 16S rRNA gene. The physiological properties and ecological functions of members of the mixed culture are complementary. The culture included not only ferrous iron oxidizers (L. ferriphilum, S. acidophilus, and F. thermophilum) and reduced inorganic sulfur compound (RISC) oxidizers (A. caldus and S. acidophilus) but also autotrophs (A. caldus and L. ferriphilum) and mixotrophs (S. acidophilus and F. thermophilum). Ferrous iron oxidizers can oxidize sulfide minerals directly by means of the ferric iron they generate. RISC oxidizers can also accelerate the dissolution of sulfide minerals successfully by removing the passivation layer of elemental sulfur. The mixotrophs can utilize organic matter originating from exudates and cell lysates of microorganisms; thus, they can relieve the toxicity of organic matter for autotrophic bacteria, for example, L. ferriphilum. It is also likely that release of CO2 by mixotrophs benefits the autotrophs. These synergistic interactions among different species usually enhance metal extraction (49, 50). Thus, these microorganisms contained in the culture show all the ecological functions required to bioleach sulfide minerals efficiently.

Our results also show that the proportions of different species in the culture varied greatly during adaptation to chalcopyrite concentrate at pulp densities of 2%, 4%, 6%, and 8% (Fig. 6). qPCR was applied to determine whether or not L. ferriphilum was present at high pulp density. We found that the organism was not detected at high pulp density. The reason for this may have been high concentrations of organic matter and flotation reagents at high pulp density. L. ferriphilum is an obligate chemoautotroph and very sensitive to organic matter and flotation reagents such as dithiocarbamate and dithiophosphate (24, 45). The absence of L. ferriphilum seemed to have no effect on bioleaching performance, as indicated by results showing 70.1% and 68.2% of copper extractions at pulp densities of 6% and 8%, respectively (Fig. 1). As to Ferroplasma sp., previous reports have also indicated that it grows best in the final stage of the bioleaching process (30, 46, 51).

The chalcopyrite concentrate provided energy sources and some nutrients for the microorganisms. Therefore, those organisms which were most efficient at degrading the mineral and able to grow most efficiently under conditions of increasing pulp density would be retained and dominate the microbial population at each subculture, while other prokaryotes (for example, L. ferriphilum, which is very sensitive to organic matter and flotation reagents) may be found to be absent under conditions of increasing pulp density (15).

Bioleaching experiments were carried out after continuously subculturing at a pulp density of 20% to evaluate the performance of the culture in bioleaching of chalcopyrite concentrate. According to previous reports, the growth rate and specific activity (rate of iron released per microbial cell) of microorganisms are very low at high pulp density (52, 53). Thus, the pH increased to 3.79 on day 4 and copper extraction was very slow in the initial stage. However, the growth rate increased significantly in the next few days accompanied by a rapid pH decrease to below 2.0 (Fig. 7b). It is suggested that RISCs might have accumulated during this phase and might have stimulated the growth of oxidizers of RISCs, such as A. caldus (Fig. 8).

From day 12 to day 14, the capacity to oxidize ferrous iron increased, and acid consumption exceeded acid generation. As a result, the culture was able to grow at a maximum rate (0.2 generations/day) during this time period. Since ferric iron is the major oxidizing agent for chalcopyrite dissolution (54), high concentrations of ferric iron derived from ferrous iron oxidation promote and enhance chalcopyrite dissolution. Ferric iron is reduced to ferrous iron during the process, which leads to accumulation of ferrous iron. XRD analysis did not detect a passivation layer, e.g., jarosite, in the leached residues in the final stages (data not shown). As a result, a high total iron concentration was present in the leach solution (Fig. 7d). Since the cells might be disintegrated and the activity of the microorganisms was inhibited to a significant extent under conditions of the combination effects of the different stresses at the late stages of leaching, a decrease in cell density was observed after day 17 (Fig. 7c). Metabolic and metallic stresses exceeded the tolerance of the culture at that point in time.

Community dynamics analysis by qPCR indicated that three species of the culture showed different succession trends compared with each other during bioleaching of chalcopyrite concentrate at a pulp density of 20%. RISCs are the main intermediates of chalcopyrite dissolution (55). Oxidation of RISCs yields considerably more energy than oxidation of ferrous iron (56). Thus, A. caldus, which can utilize RISCs as an energy source, grows better than the ferrous iron oxidizers. Moreover, higher pH also benefits the growth of A. caldus. All these factors account for the relatively high proportion of A. caldus in the initial stage. However, A. caldus is unable to oxidize sulfide minerals directly. Therefore, the copper extraction rate did not increase significantly in the initial stage.

As bioleaching of chalcopyrite progressed, the pH decreased to less than 2.0 while the concentration of ferrous iron increased slowly (Fig. 7d), and S. acidophilus gained a competitive advantage and became the predominant species in the middle stage. The increased proportion of S. acidophilus resulted in an enhanced capacity for ferrous iron oxidation. The pH increased slightly from day 12 to day 14. S. acidophilus is well adapted to survive adverse conditions because of its ability to form endospores. Watling et al. (57) indicated that the versatility and resilience of Sulfobacillus sp. make it a valuable contributor in the bioleaching process. As a consequence, the copper extraction rate reached its maximum in the middle stage when S. acidophilus accounted for highest proportion of the culture.

In the final stage, the leachate became increasingly acidic and enriched with high concentrations of metals. Such conditions favor the growth of the archaeon F. thermophilum (13). Previous study indicated that a high concentration of dissolved carbon accumulates in the final stage during bioleaching (56). The organic matter, which derives from microorganisms as exudates and cell lysates and also from minerals enriched by flotation, can stimulate the growth of F. thermophilum.

In conclusion, three kinds of samples derived from different sites were collected in this study. Previous studies indicated that these samples had sufficient microbial diversity (both physiological and phylogenetic) available from which to assemble an efficient mixed culture for bioleaching of sulfide minerals, including Acidithiobacillus spp., Leptospirillum spp., Sulfobacillus spp., and Ferroplasma spp. (58–60). The various samples were combined and then inoculated into a basal salts solution at 45°C. The energy sources added to the solution were FeSO4·7H2O and/or elemental sulfur or chalcopyrite concentrate. Then, the mixed cultures growing on different substrates were pooled equally, resulting in a final mixed culture. After that, the pooled culture was adapted to a gradually increasing pulp density of chalcopyrite concentrate by serial subculturing for more than 2 years. The bacterial and archaeal diversities during the adaptation process were analyzed by DGGE in the same PCR system and were verified by the use of clone libraries of the 16S rRNA gene. The microbial diversity during adaptation was relatively low. Some species from the original mixed inoculum such as Acidithiobacillus ferrooxidans, Leptospirillum ferrooxidans, Acidithiobacillus thiooxidans, and Sulfolobus sp. were not detected (58–60). The performance of the culture in bioleaching was evaluated at a pulp density of 20%, and the community dynamics was analyzed by qPCR. It showed a good performance in bioleaching of chalcopyrite concentrate at a pulp density of 20%. A. caldus, S. acidophilus, and F. thermophilum were the predominant species in the initial, middle, and final stages, respectively. The information gives useful insights into how a microbial community of moderate thermophiles develops and interacts during adaptation and the bioleaching process and also into how a mixed culture of microorganisms can be assembled and adapted for optimal bioleaching of chalcopyrite concentrate.

Supplementary Material

Supplemental material
supp_80_2_741__index.html (1.1KB, html)

ACKNOWLEDGMENTS

This work was supported by the Fundamental Research Funds for the Central Universities of Central South University, Scientific Research Program of Marine Public Welfare Industry of China (201205020), the National Nature Science Foundation of China (51074195), and Research Innovation Project for Graduate Student of Hunan Province (CX2012B123).

We especially thank Rebecca B. Hawkes and Olga V. Golyshina for kindly providing Ferroplasma cupricumulan BH2 and Ferroplasma acidiphilum YT and the anonymous reviewers for their helpful comments and suggestions on an earlier version of the manuscript which improved the quality of the manuscript.

Footnotes

Published ahead of print 15 November 2013

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.02907-13.

REFERENCES

  • 1.Wang S. 2005. Copper leaching from chalcopyrite concentrates. J. Miner. Met. Mater. Soc. 57:48–51 [Google Scholar]
  • 2.Johnson DB, Okibe N, Wakeman K, Yajie L. 2008. Effect of temperature on the bioleaching of chalcopyrite concentrates containing different concentrations of silver. Hydrometallurgy 94:42–47. 10.1016/j.hydromet.2008.06.005 [DOI] [Google Scholar]
  • 3.Marhual N, Pradhan N, Kar R, Sukla L, Mishra B. 2008. Differential bioleaching of copper by mesophilic and moderately thermophilic acidophilic consortium enriched from same copper mine water sample. Bioresour. Technol. 99:8331–8336. 10.1016/j.biortech.2008.03.003 [DOI] [PubMed] [Google Scholar]
  • 4.Dutrizac J. 1981. The dissolution of chalcopyrite in ferric sulfate and ferric chloride media. Metall. Mater. Trans. B 12:371–378 [Google Scholar]
  • 5.Watling HR. 2006. The bioleaching of sulphide minerals with emphasis on copper sulphides—a review. Hydrometallurgy 84:81–108. 10.1016/j.hydromet.2006.05.001 [DOI] [Google Scholar]
  • 6.Dreisinger D. 2006. Copper leaching from primary sulfides: Options for biological and chemical extraction of copper. Hydrometallurgy 83:10–20. 10.1016/j.hydromet.2006.03.032 [DOI] [Google Scholar]
  • 7.Akcil A, Ciftci H, Deveci H. 2007. Role and contribution of pure and mixed cultures of mesophiles in bioleaching of a pyritic chalcopyrite concentrate. Miner. Eng. 20:310–318. 10.1016/j.mineng.2006.10.016 [DOI] [Google Scholar]
  • 8.Zhang Y, Qin W, Wang J, Zhen S, Yang C, Zhang J, Nai S, Qiu G. 2008. Bioleaching of chalcopyrite by pure and mixed culture. Trans. Nonferrous Met. Soc. China 18:1491–1496. 10.1016/S1003-6326(09)60031-5 [DOI] [Google Scholar]
  • 9.Falco L, Pogliani C, Curutchet G, Donati E. 2003. A comparison of bioleaching of covellite using pure cultures of Acidithiobacillus ferrooxidans and Acidithiobacillus thiooxidans or a mixed culture of Leptospirillum ferrooxidans and Acidithiobacillus thiooxidans. Hydrometallurgy 71:31–36. 10.1016/S0304-386X(03)00170-1 [DOI] [Google Scholar]
  • 10.Baker BJ, Banfield JF. 2003. Microbial communities in acid mine drainage. FEMS Microbiol. Ecol. 44:139–152. 10.1016/S0168-6496(03)00028-X [DOI] [PubMed] [Google Scholar]
  • 11.Johnson D. 2001. Importance of microbial ecology in the development of new mineral technologies. Hydrometallurgy 59:147–157. 10.1016/S0304-386X(00)00183-3 [DOI] [Google Scholar]
  • 12.Fu B, Zhou H, Zhang R, Qiu G. 2008. Bioleaching of chalcopyrite by pure and mixed cultures of Acidithiobacillus spp. and Leptospirillum ferriphilum. Int. Biodeterior. Biodegradation 62:109–115. 10.1016/j.ibiod.2007.06.018 [DOI] [Google Scholar]
  • 13.Zhou H, Zhang R, Hu P, Zeng W, Xie Y, Wu C, Qiu G. 2008. Isolation and characterization of Ferroplasma thermophilum sp. nov., a novel extremely acidophilic, moderately thermophilic archaeon and its role in bioleaching of chalcopyrite. J. Appl. Microbiol. 105:591–601. 10.1111/j.1365-2672.2008.03807.x [DOI] [PubMed] [Google Scholar]
  • 14.Johnson DB, Hallberg KB. 2003. The microbiology of acidic mine waters. Res. Microbiol. 154:466–473. 10.1016/S0923-2508(03)00114-1 [DOI] [PubMed] [Google Scholar]
  • 15.Rawlings DE, Johnson DB. 2007. The microbiology of biomining: development and optimization of mineral-oxidizing microbial consortia. Microbiology 153:315–324. 10.1099/mic.0.2006/001206-0 [DOI] [PubMed] [Google Scholar]
  • 16.Cancho L, Blazquez M, Ballester A, Gonzalez F, Munoz J. 2007. Bioleaching of a chalcopyrite concentrate with moderate thermophilic microorganisms in a continuous reactor system. Hydrometallurgy 87:100–111. 10.1016/j.hydromet.2007.02.007 [DOI] [Google Scholar]
  • 17.d'Hugues P, Foucher S, Galle-Cavalloni P, Morin D. 2002. Continuous bioleaching of chalcopyrite using a novel extremely thermophilic mixed culture. Int. J. Miner. Process. 66:107–119. 10.1016/S0301-7516(02)00004-2 [DOI] [Google Scholar]
  • 18.Zhou HB, Zeng WM, Yang ZF, Xie YJ, Qiu GZ. 2009. Bioleaching of chalcopyrite concentrate by a moderately thermophilic culture in a stirred tank reactor. Bioresour. Technol. 100:515–520. 10.1016/j.biortech.2008.06.033 [DOI] [PubMed] [Google Scholar]
  • 19.Plumb JJ, Gibbs B, Stott MB, Robertson WJ, Gibson JAE, Nichols PD, Watling HR, Franzmann PD. 2002. Enrichment and characterisation of thermophilic acidophiles for the bioleaching of mineral sulphides. Miner. Eng. 15:787–794. 10.1016/S0892-6875(02)00117-6 [DOI] [Google Scholar]
  • 20.Watling HR, Collinson DM, Shiers DW, Bryan CG, Watkin ELJ. 2013. Effects of pH, temperature and solids loading on microbial community structure during batch culture on a polymetallic ore. Miner. Eng. 48:68–76. 10.1016/j.mineng.2012.10.014 [DOI] [Google Scholar]
  • 21.Spolaore P, Joulian C, Gouin J, Morin D, d'Hugues P. 2011. Relationship between bioleaching performance, bacterial community structure and mineralogy in the bioleaching of a copper concentrate in stirred-tank reactors. Appl. Microbiol. Biotechnol. 89:441–448. 10.1007/s00253-010-3059-4 [DOI] [PubMed] [Google Scholar]
  • 22.Gericke M, Govender Y, Pinches A. 2010. Tank bioleaching of low-grade chalcopyrite concentrates using redox control. Hydrometallurgy 104:414–419. 10.1016/j.hydromet.2010.02.024 [DOI] [Google Scholar]
  • 23.Cameron RA, Yeung CW, Greer CW, Gould WD, Mortazavi S, Bédard PL, Morin L, Lortie L, Dinardo O, Kennedy KJ. 2010. The bacterial community structure during bioleaching of a low-grade nickel sulphide ore in stirred-tank reactors at different combinations of temperature and pH. Hydrometallurgy 104:207–215. 10.1016/j.hydromet.2010.06.005 [DOI] [Google Scholar]
  • 24.Okibe N, Johnson D. 2004. Biooxidation of pyrite by defined mixed cultures of moderately thermophilic acidophiles in pH-controlled bioreactors: significance of microbial interactions. Biotechnol. Bioeng. 87:574–583. 10.1002/bit.20138 [DOI] [PubMed] [Google Scholar]
  • 25.D'Hugues P, Joulian C, Spolaore P, Morin DH, Bryan CG, Challan-Belval S, El Achbouni H. 2009. Adaptation and evolution of microbial consortia in a stirred tank reactor bioleaching system: indigenous population versus a defined consortium. Adv. Mater. Res. 71:79–82 [Google Scholar]
  • 26.Vakylabad AB, Ranjbar M, Manafi Z, Bakhtiari F. 2011. Tank bioleaching of copper from combined flotation concentrate and smelter dust. Int. Biodeterior. Biodegradation 65:1208–1214. 10.1016/j.ibiod.2011.09.006 [DOI] [Google Scholar]
  • 27.Bryan C, Joulian C, Spolaore P, El Achbouni H, Challan-Belval S, Morin D, d'Hugues P. 2011. The efficiency of indigenous and designed consortia in bioleaching stirred tank reactors. Miner. Eng. 24:1149–1156. 10.1016/j.mineng.2011.03.014 [DOI] [Google Scholar]
  • 28.Mejia E, Ospina J, Marquez M, Morales A. 2009. Oxidation of chalcopyrite (CuFeS2) by Acidithiobacillus ferrooxidans and a mixed culture of Acidithiobacillus ferrooxidans and Acidithiobacillus thiooxidans like bacterium in shake flasks. Adv. Mater. Res. 71:385–388 [Google Scholar]
  • 29.Vilcáez J, Suto K, Inoue C. 2008. Bioleaching of chalcopyrite with thermophiles: temperature-pH-ORP dependence. Int. J. Miner. Process 88:37–44. 10.1016/j.minpro.2008.06.002 [DOI] [Google Scholar]
  • 30.Zhang R, Wei M, Ji H, Chen X, Qiu G, Zhou H. 2009. Application of real-time PCR to monitor population dynamics of defined mixed cultures of moderate thermophiles involved in bioleaching of chalcopyrite. Appl. Microbiol. Biotechnol. 81:1161–1168. 10.1007/s00253-008-1792-8 [DOI] [PubMed] [Google Scholar]
  • 31.Haghshenas D, Alamdari EK, Torkmahalleh MA, Bonakdarpour B, Nasernejad B. 2009. Adaptation of Acidithiobacillus ferrooxidans to high grade sphalerite concentrate. Miner. Eng. 22:1299–1306. 10.1016/j.mineng.2009.07.011 [DOI] [Google Scholar]
  • 32.Keeling SE, Davies KL, Palmer ML, Townsend DE, Watkin E, Johnson JA, Watling HR. 2006. Utilisation of native microbes from a spent chalcocite test heap. Hydrometallurgy 83:124–131. 10.1016/j.hydromet.2006.03.018 [DOI] [Google Scholar]
  • 33.Rawlings DE. 2005. Characteristics and adaptability of iron- and sulfur-oxidizing microorganisms used for the recovery of metals from minerals and their concentrates. Microb. Cell Fact. 4:13. 10.1186/1475-2859-4-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Astudillo C, Acevedo F. 2008. Adaptation of Sulfolobus metallicus to high pulp densities in the biooxidation of a flotation gold concentrate. Hydrometallurgy 92:11–15. 10.1016/j.hydromet.2008.02.003 [DOI] [Google Scholar]
  • 35.Ahmadi A, Schaffie M, Petersen J, Schippers A, Ranjbar M. 2011. Conventional and electrochemical bioleaching of chalcopyrite concentrates by moderately thermophilic bacteria at high pulp density. Hydrometallurgy 106:84–92. 10.1016/j.hydromet.2010.12.007 [DOI] [Google Scholar]
  • 36.Zhou J, Bruns M, Tiedje J. 1996. DNA recovery from soils of diverse composition. Appl. Environ. Microbiol. 62:316–322 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Gao J, Zhang CG, Wu XL, Wang HH, Qiu GZ. 2007. Isolation and identification of a strain of Leptospirillum ferriphilum from an extreme acid mine drainage site. Ann. Microbiol. 57:171–176. 10.1007/BF03175203 [DOI] [Google Scholar]
  • 38.Qiu GZ, Fu B, Zhou HB, Liu X, Gao J, Liu FF, Chen XH. 2007. Isolation of a strain of Acidithiobacillus caldus and its role in bioleaching of chalcopyrite. World J. Microbiol. Biotechnol. 23:1217–1225. 10.1007/s11274-007-9350-6 [DOI] [Google Scholar]
  • 39.Zeng W, Wu C, Zhang R, Hu P, Qiu G, Gu G, Zhou H. 2009. Isolation and identification of moderately thermophilic acidophilic iron-oxidizing bacterium and its bioleaching characterization. Trans. Nonferrous Met. Soc. China 19:222–227. 10.1016/S1003-6326(08)60256-3 [DOI] [Google Scholar]
  • 40.Ding J, Gao J, Wu X, Zhang C, Wang D, Qiu G. 2007. Jarosite-type precipitates mediated by YN22, Sulfobacillus thermosulfidooxidans, and their influences on strain. Trans. Nonferrous Met. Soc. China 17:1038–1044. 10.1016/S1003-6326(07)60222-2 [DOI] [Google Scholar]
  • 41.Hawkes RB, Franzmann PD, O'Hara G, Plumb JJ. 2006. Ferroplasma cupricumulans sp. nov., a novel moderately thermophilic, acidophilic archaeon isolated from an industrial-scale chalcocite bioleach heap. Extremophiles 10:525–530. 10.1007/s00792-006-0527-y [DOI] [PubMed] [Google Scholar]
  • 42.Golyshina OV, Pivovarova TA, Karavaiko GI, Kondrat'eva TF, Moore ERB, Abraham WR, Lunsdorf H, Timmis K, Yakimov M, Golyshin P. 2000. Ferroplasma acidiphilum gen. nov., sp. nov., an acidophilic, autotrophic, ferrous-iron-oxidizing, cell-wall-lacking, mesophilic member of the Ferroplasmaceae fam. nov., comprising a distinct lineage of the Archaea. Int. J. Syst. Evol. Microbiol. 50(Pt 3):997–1006. 10.1099/00207713-50-3-997 [DOI] [PubMed] [Google Scholar]
  • 43.Muyzer G, De Waal E, Uitterlinden A. 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59:695–700 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Wei M, Zhang R, Wang Y, Ji H, Zheng J, Chen X, Zhou H. 2013. Microbial community structure and diversity in deep-sea hydrothermal vent sediments along the Eastern Lau Spreading Centre. Acta Oceanol. Sin. 32:42–51 [Google Scholar]
  • 45.Okibe N, Johnson DB. 2002. Toxicity of flotation reagents to moderately thermophilic bioleaching microorganisms. Biotechnol. Lett. 24:2011–2016. 10.1023/A:1021118915720 [DOI] [Google Scholar]
  • 46.Hawkes R, Franzmann P, Plumb J. 2006. Moderate thermophiles including “Ferroplasma cupricumulans” sp. nov. dominate an industrial-scale chalcocite heap bioleaching operation. Hydrometallurgy 83:229–236. 10.1016/j.hydromet.2006.03.027 [DOI] [Google Scholar]
  • 47.Brunk C, Avaniss-Aghajani E, Brunk C. 1996. A computer analysis of primer and probe hybridization potential with bacterial small-subunit rRNA sequences. Appl. Environ. Microbiol. 62:872–879 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Liu WT, Marsh TL, Cheng H, Forney LJ. 1997. Characterization of microbial diversity by determining terminal restriction fragment length polymorphisms of genes encoding 16S rRNA. Appl. Environ. Microbiol. 63:4516–4522 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Johnson DB. 1998. Biodiversity and ecology of acidophilic microorganisms. FEMS Microbiol. Ecol. 27:307–317. 10.1111/j.1574-6941.1998.tb00547.x [DOI] [Google Scholar]
  • 50.Bacelar-Nicolau P, Johnson DB. 1999. Leaching of pyrite by acidophilic heterotrophic iron-oxidizing bacteria in pure and mixed cultures. Appl. Environ. Microbiol. 65:585–590 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Dopson M, Baker-Austin C, Hind A, Bowman JP, Bond PL. 2004. Characterization of Ferroplasma isolates and Ferroplasma acidarmanus sp. nov., extreme acidophiles from acid mine drainage and industrial bioleaching environments. Appl. Environ. Microbiol. 70:2079–2088. 10.1128/AEM.70.4.2079-2088.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Sissing A, Harrison S. 2003. Thermophilic mineral bioleaching performance: a compromise between maximizing mineral loading and maximizing microbial growth and activity. J. S. Afr. Inst. Mining Metall. 103:139–142 [Google Scholar]
  • 53.Harrison S, Sissing A, Raja S, Pearce S, Lamaignere V, Nemati M. 2003. Solids loading in the bioleach slurry reactor: mechanisms through which particulate parameters influence slurry bioreactor performance, p 359–375 In Tsezos M, Hatzikioseyian A, Remoudaki E. (ed), Proceedings of the 15th International Biohydrometallurgy Symposium. National Technical University of Athens, Athens, Greece [Google Scholar]
  • 54.Vilcáez J, Suto K, Inoue C. 2008. Response of thermophiles to the simultaneous addition of sulfur and ferric ion to enhance the bioleaching of chalcopyrite. Miner. Eng. 21:1063–1074. 10.1016/j.mineng.2007.11.005 [DOI] [Google Scholar]
  • 55.Sand W, Gehrke T, Jozsa P. 2001. (Bio)chemistry of bacterial leaching-direct vs. indirect bioleaching. Hydrometallurgy 59:159–175. 10.1016/S0304-386X(00)00180-8 [DOI] [Google Scholar]
  • 56.Okibe N, Gericke M, Hallberg K, Johnson D. 2003. Enumeration and characterization of acidophilic microorganisms isolated from a pilot plant stirred-tank bioleaching operation. Appl. Environ. Microbiol. 69:1936–1943. 10.1128/AEM.69.4.1936-1943.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Watling H, Perrot F, Shiers D. 2008. Comparison of selected characteristics of Sulfobacillus species and review of their occurrence in acidic and bioleaching environments. Hydrometallurgy 93:57–65. 10.1016/j.hydromet.2008.03.001 [DOI] [Google Scholar]
  • 58.Xiao S, Xie X, Liu J. 2009. Microbial communities in acid water environments of two mines, China. Environ. Pollut. 157:1045–1050. 10.1016/j.envpol.2008.09.035 [DOI] [PubMed] [Google Scholar]
  • 59.Xie X, Xiao S, He Z, Liu J, Qiu G. 2007. Microbial populations in acid mineral bioleaching systems of Tong Shankou Copper Mine, China. J. Appl. Microbiol. 103:1227–1238. 10.1111/j.1365-2672.2007.03382.x [DOI] [PubMed] [Google Scholar]
  • 60.Yin H, Cao L, Qiu G, Wang D, Kellogg L, Zhou J, Dai Z, Liu X. 2007. Development and evaluation of 50-mer oligonucleotide arrays for detecting microbial populations in acid mine drainages and bioleaching systems. J. Microbiol. Methods 70:165–178. 10.1016/j.mimet.2007.04.011 [DOI] [PubMed] [Google Scholar]
  • 61.Liu CQ, Plumb J, Hendry P. 2006. Rapid specific detection and quantification of bacteria and archaea involved in mineral sulfide bioleaching using real-time PCR. Biotechnol. Bioeng. 94:330–336. 10.1002/bit.20845 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material
supp_80_2_741__index.html (1.1KB, html)
AEM.02907-13_zam003145066so1.pdf (311.8KB, pdf)

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES