Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2014 Jan;52(1):67–75. doi: 10.1128/JCM.02533-13

Real-Time Reverse Transcription-PCR Assay Panel for Middle East Respiratory Syndrome Coronavirus

Xiaoyan Lu a, Brett Whitaker a, Senthil Kumar K Sakthivel a, Shifaq Kamili a, Laura E Rose b, Luis Lowe b, Emad Mohareb c, Emad M Elassal c, Tarek Al-sanouri d, Aktham Haddadin d, Dean D Erdman a,✉
Editor: A J McAdam
PMCID: PMC3911421  PMID: 24153118

Abstract

A new human coronavirus (CoV), subsequently named Middle East respiratory syndrome (MERS)-CoV, was first reported in Saudi Arabia in September 2012. In response, we developed two real-time reverse transcription-PCR (rRT-PCR) assays targeting the MERS-CoV nucleocapsid (N) gene and evaluated these assays as a panel with a previously published assay targeting the region upstream of the MERS-CoV envelope gene (upE) for the detection and confirmation of MERS-CoV infection. All assays detected ≤10 copies/reaction of quantified RNA transcripts, with a linear dynamic range of 8 log units and 1.3 × 10−3 50% tissue culture infective doses (TCID50)/ml of cultured MERS-CoV per reaction. All assays performed comparably with respiratory, serum, and stool specimens spiked with cultured virus. No false-positive amplifications were obtained with other human coronaviruses or common respiratory viral pathogens or with 336 diverse clinical specimens from non-MERS-CoV cases; specimens from two confirmed MERS-CoV cases were positive with all assay signatures. In June 2012, the U.S. Food and Drug Administration authorized emergency use of the rRT-PCR assay panel as an in vitro diagnostic test for MERS-CoV. A kit consisting of the three assay signatures and a positive control was assembled and distributed to public health laboratories in the United States and internationally to support MERS-CoV surveillance and public health responses.

INTRODUCTION

On 20 September 2012, a report appeared on ProMED-mail (http://www.promedmail.org/direct.php?id=20120920.1302733) of a novel human coronavirus (CoV) isolated several months earlier from a hospitalized patient in Saudi Arabia who had died of severe respiratory complications (1). Like the severe acute respiratory syndrome (SARS)-CoV, this new virus was most closely related to known bat coronaviruses but was genetically distinct, being classified phylogenetically in the group 2C coronavirus clade (2).

This virus was subsequently named the Middle East respiratory syndrome (MERS)-CoV because of its geographic predilection (3), and the genomic sequence obtained from this isolate was used to develop real-time reverse transcription (rRT)-PCR assays that were released on the Eurosurveillance website on 27 September 2012 (4). These assays, targeting regions upstream of the envelope gene (upE) for specimen screening and open reading frames (ORFs) 1b and later 1a (5) for test confirmation, have been used extensively to investigate the emergence of this new virus. As of 4 October 2013, 136 laboratory-confirmed cases of MERS-CoV infection, including 58 deaths, have been reported from 8 countries in the Middle East and Europe, primarily using these assays (http://www.who.int/csr/don/2013_10_04/en/index.html).

On 25 September 2012, Christian Drosten at the University of Bonn Medical Center kindly provided the U.S. Centers for Disease Control and Prevention (CDC) with sequence data for the MERS-CoV nucleocapsid (N) protein gene in advance of publication. Based on this sequence, the CDC quickly developed several rRT-PCR assays targeting the N gene to support the public health response to MERS-CoV. This report describes the validation of these assays and presents comprehensive data on the performance of the published upE assay using multiple specimen types.

(Some data from this study were presented at the 29th Clinical Virology Symposium, Daytona Beach, FL, 28 April to 1 May 2013.)

MATERIALS AND METHODS

Viruses and clinical specimens.

MERS-CoV strain Jordan-N3/NCV (2012905864/VeroP1) was kindly provided by U.S. Naval Medical Research Unit 3 (NAMRU-3) (Cairo, Egypt), with permission from the Jordan Ministry of Health (MOH). Other high-titer respiratory virus stocks and virus-positive and -negative clinical specimens used for assay specificity studies were available from CDC collections. Extracts from pooled nasal wash specimens predicted to contain diverse human microbiological flora from 20 consenting healthy new military recruits were kindly provided by Lisa Lott, Eagle Applied Sciences (San Antonio, TX).

A total of 336 diverse fresh or frozen clinical specimens collected between April 2011 and April 2013 from 321 persons who had severe acute respiratory illness (SARI) and either were resident in or had a history of travel to the Middle East were available for testing. Of these, 280 were combined nasopharyngeal (NP)/oropharyngeal (OP) swab specimens collected in viral transport medium from hospitalized Jordanian children <2 years of age (15), with most of the remaining specimens being from adults. A bronchoalveolar lavage fluid sample and a serum specimen collected by the Jordan MOH Central Public Health Laboratory staff from two fatal SARI cases from a MERS-CoV pneumonia outbreak cluster at a Jordanian hospital in April 2012, and independently confirmed as positive for MERS-CoV by culture and/or sequencing by NAMRU-3, were also available for testing.

MERS-CoV culture.

On receipt of the virus at the CDC, Vero E6 cell monolayers were inoculated and observed daily for cytopathic effect (CPE). At 3 to 4+ CPE, the cell culture lysate was recovered, divided into aliquots of small volumes, and stored at −70°C or below. The titers of this stock virus were determined, and the 50% tissue culture infective dose (TCID50) was calculated using standard methods (stock titer, 1.3 × 104 TCID50/ml). Stock virus used in the spiking experiments described below was inactivated by gamma irradiation, and the sequence was confirmed over the rRT-PCR signature regions.

Sample processing and nucleic acid extraction.

For sputum samples or other lower respiratory tract specimens too viscous for downstream nucleic acid extraction, the sample was added to an equal volume of 500 mM freshly prepared No-Weigh dithiothreitol (catalog no. 20291; Pierce) and incubated at room temperature, with intermittent mixing, for 30 min or until the sample was sufficiently liquefied for processing. For stool specimens, 10% suspensions were prepared by adding 100 μl of liquid stool or a pea-sized amount of solid stool to 900 μl of phosphate-buffered saline (pH 7.4; Gibco), pulse vortex mixing the mixture for 30 s, and centrifuging the mixture at 4,000 × g for 10 min at 4°C. The clarified supernatant was then carefully removed for extraction. Total nucleic acid extractions were performed on 200 μl of sample using the NucliSens easyMAG system (bioMérieux, Durham, NC), following the manufacturer's default instrument settings, and 100-μl elution volumes were collected. For some comparison studies (see below), simultaneous extractions were also performed with the MagNA Pure Compact system, using nucleic acid isolation kit I (Roche Applied Science). Extracts were either tested immediately or stored at −70°C or below until use.

Primers and probes.

Multiple primer/probe sets targeting regions in the 3′, middle, and 5′ regions of the N gene sequence (GenBank accession no. JX869059.2) were designed using Primer Express software, version 3.0 (Applied Biosystems, Foster City, CA). Primer/probe sets were predicted to specifically amplify MERS-CoV with no major combined homologies with other coronaviruses or human microflora on BLASTn analysis that would potentially yield false-positive test results. All primers and probes were synthesized by standard phosphoramidite chemical techniques at the CDC Biotechnology Core Facility. Hydrolysis probes were labeled at the 5′ end with 6-carboxyfluorescein (6-FAM) and at the 3′ end with Black Hole Quencher 1 (BHQ1) (Biosearch Technologies, Inc., Novato, CA). Optimal primer/probe concentrations were determined by checkerboard titrations. Primers/probes with the highest amplification efficiencies with RNA transcripts (see below) were retained for further study (Table 1).

TABLE 1.

MERS-CoV rRT-PCR assay primer/probe sequences

Assay signature Assay use Genome target Genome location Primer or probea Sequence (5′ to 3′) 50× working concentration (μM)
upEb Specimen screening Noncoding region upstream of envelope gene 27458–27475c Forward primer GCAACGCGCGATTCAGTT 12.5
27549–27530c Reverse primer GCCTCTACACGGGACCCATA 25
27477–27502c Probe CTCTTCACATAATCGCCCCGAGCTCG 5
N2 Specimen screening Nucleocapsid gene 29424–29442c Forward primer GGCACTGAGGACCCACGTT 12.5
29498–29477c Reverse primer TTGCGACATACCCATAAAAGCA 12.5
29445–29471c Probe CCCCAAATTGCTGAGCTTGCTCCTACA 5
N3 Specimen confirmation Nucleocapsid gene 28748–28771c Forward primer GGGTGTACCTCTTAATGCCAATTC 25
28814–28795c Reverse primer TCTGTCCTGTCTCCGCCAAT 25
28773–28793c Probe ACCCCTGCGCAAAATGCTGGG 5
RP Sample quality control Human RNAse P gene 50–68d Forward primer AGATTTGGACCTGCGAGCG 40
114–95d Reverse primer GAGCGGCTGTCTCCACAAGT 40
71–93d Probe TTCTGACCTGAAGGCTCTGCGCG 10
a

Probes were labeled at the 5′ end with the reporter molecule 6-carboxyfluorescein (6-FAM) and at the 3′ end with Black Hole Quencher 1 (BHQ1) (Biosearch Technologies Inc., Novato, CA).

b

Primer/probe sequences from a report by Corman et al. (4).

c

Nucleotide numbering was based on human betacoronavirus 2c EMC/2012 strain (GenBank accession number JX869059.2).

d

Nucleotide numbering was based on human RNase P (RP) mRNA (GenBank accession number NM_006413.4).

In vitro RNA transcripts and viral template control.

Single-stranded DNA oligonucleotides covering the amplified region of each rRT-PCR signature and containing a 5′ T7 RNA polymerase promoter sequence (TAATACGACTCACTATAGGG) were synthesized. The oligonucleotides were amplified using the 5′ T7 promoter sequence as the forward primer, with the corresponding rRT-PCR reverse primer for each signature (Table 1). Amplification products were transcribed using a MEGAshortscript high-yield transcription kit (Invitrogen/Life Technologies). The RNA transcripts were purified using a MEGAclear kit (Invitrogen/Life Technologies) and were quantified by UV spectroscopy. A MERS-CoV viral template control (VTC) was prepared by combining the 3 signature templates with human genomic DNA (Promega) and then drying the mixture into a visible pellet with Pellet Paint Co-Precipitate (EMD Millipore) to create a thermostable product.

Real-time RT-PCR assay.

The rRT-PCR assay was performed using the Invitrogen SuperScript III Platinum One-Step quantitative RT-PCR system (Life Technologies). Each 25-μl reaction mixture contained 12.5 μl of 2× master mix, 0.5 μl of SuperScript III reverse transcriptase/Platinum Taq DNA polymerase, 0.5 μl of probe, 0.5 μl each of the forward and reverse primers, 5.5 μl of nuclease-free water, and 5 μl of nucleic acid extract. Amplification was carried out in 96-well plates on an Applied Biosystems 7500 Fast Dx real-time PCR instrument (Life Technologies). Thermocycling conditions consisted of 30 min at 50°C for reverse transcription, 2 min at 95°C for activation of the Platinum Taq DNA polymerase, and 45 cycles of 15 s at 95°C and 1 min at 55°C. Each run included one viral template control and at least two no-template controls (NTCs) for the sample extraction and reaction set-up steps. A positive test result was defined as a well-defined exponential fluorescence curve that crossed the threshold within 45 cycles. Positive viral template control (VTC) and no-template control (NTC) samples were included in all runs to monitor assay performance. All specimens were tested for the human RNase P (RP) gene by rRT-PCR to monitor nucleic acid extraction efficiency and the presence of PCR inhibitors.

RESULTS

Signatures analyzed.

As noted above, multiple primer/probe sets were designed to target the MERS-CoV N gene sequence provided in advance of publication and were evaluated for optimal performance with RNA transcripts. Three candidate signatures that gave the best performance, designated N1, N2, and N3, were selected for further study. However, genomic sequences obtained from clinical specimens from a Qatari patient receiving care in London, England, in September 2012 (England 1, GenBank no. KC164505.2; England/Qatar/2012, GenBank accession no. KC667074.1), which later appeared in GenBank, revealed a 6-nucleotide deletion at the 3′ end of the forward primer of N1 that would predict assay failure (Table 2). Although this deletion has not been identified among more recently published MERS-CoV genomes, the N1 signature was withdrawn from further consideration.

TABLE 2.

MERS-CoV rRT-PCR assay primer/probe sequence identity with published MERS-CoV genome sequences

Strain Country of origin Specimen collection date (mo/day/yr) Sample type GenBank accession no. Primer/probe nt sequence identity (%)a
Reference no.
upE N1 N2 N3
HCoV-EMC Saudi Arabia 6/13/2012 Isolate JX869059.2 100 100 100 100 2
Jordan-N3/2012 Jordan 4/?/2012b Isolate KC776174.1 100 100 100 100
England 1c Qatar?b 9/11/2012 Lower respiratory tract KC164505.2 100 6-nt deletion 100 100 14
England/Qatar/2012c Qatar?b 9/19/2012 Sputum KC667074.1 100 6-nt deletion 100 100 14
England 2 Saudi Arabia?b 2/10/2013 Unknown HPA website 100 100 100 100
Munich United Arab Emirates 3/22/2013 Unknown KF192507.1 100 100 100 100
Al-Hasa_1_2013 Saudi Arabia 5/9/2013 Isolate KF186567.1 100 100 100 100
Al-Hasa_2_2013 Saudi Arabia 4/21/2013 Isolate KF186566.1 100 100 100 100
Al-Hasa_3_2013 Saudi Arabia 4/22/2013 Isolate KF186565.1 100 100 100 100
Al-Hasa_4_2013 Saudi Arabia 5/1/2013 Isolate KF186564.1 100 100 100 100
a

nt, nucleotide.

b

?, not definite.

c

From the same patient.

Analytical sensitivity. (i) Limits of detection with MERS-CoV RNA transcripts.

Serial 2-fold dilutions of each quantified RNA transcript were prepared in 10 mM Tris-EDTA buffer containing 50 ng/μl yeast tRNA (Invitrogen/Life Technologies) and were tested with each assay signature in 24-fold replicates. The highest dilution of transcript at which all replicates were positive was defined as the limit of detection (LoD) for each assay. The LoD values for all assay signatures ranged from 5 to 10 RNA transcript copies/reaction (Table 3). Linear amplification was achieved over a 8-log dynamic range, from 5 to 5 × 107 copies per reaction for N assays and from 10 to 1 × 108 copies for the upE assay, with calculated efficiency values of 99.5 to 102% (Fig. 1).

TABLE 3.

MERS-CoV rRT-PCR assay limits of detection with RNA transcripts

Predicted no. of copies/reaction No. of positive tests/no. of transcript replicates (%)
upE N2 N3
20 24/24 (100) 24/24 (100) 24/24 (100)
10 24/24 (100)a 24/24 (100) 24/24 (100)
5 18/24 (75) 24/24 (100)a 24/24 (100)a
2.5 14/24 (58) 21/24 (87.5) 22/24 (91.7)
1.25 8/24 (33) 14/24 (58.3) 16/24 (66.7)
a

Highest dilution at which 100% of replicates were positive.

FIG 1.

FIG 1

Plots of serial 10-fold dilutions ranging from 5 to 5 × 107 copies/reaction for the N2 and N3 RNA transcripts and 10 to 108 copies/reaction for the upE RNA transcripts analyzed by the MERS-CoV rRT-PCR assays. Plot inserts show calculated linear correlation coefficients (R2) and amplification efficiencies for each assay.

(ii) Limits of detection with MERS-CoV genomic RNA.

Serial 10-fold dilutions of MERS-CoV RNA extracted from a lysate of stock cultured virus were prepared in buffer as described above and were tested in triplicate with each assay signature (Table 4). The LoD was approximately 1.3 × 10−3 TCID50/ml, or 2.6 × 10−5 TCID50 per reaction (5.0 μl/reaction), for all assay signatures.

TABLE 4.

MERS-CoV rRT-PCR assay limits of detection with culture-extracted MERS-CoV RNA

Virus quantity (TCID50/ml) upEa
N2
N3
CT
No. positive/no. tested CT
No. positive/no. tested CT
No. positive/no. tested
Test 1 Test 2 Test 3 Test 1 Test 2 Test 3 Test 1 Test 2 Test 3
1.3 × 10−0 27.35 27.46 27.39 3/3 27.88 27.98 28.07 3/3 25.98 25.95 25.81 3/3
1.3 × 10−1 31.06 31.13 31.29 3/3 31.68 31.64 31.77 3/3 29.67 29.38 29.40 3/3
1.3 × 10−2 33.81 34.55 34.67 3/3 35.87 34.62 35.70 3/3 32.81 33.06 33.23 3/3
1.3 × 10−3 37.03 39.01 38.94 3/3 38.74 40.01 38.11 3/3 36.60 37.28 35.82 3/3
1.3 × 10−4 39.07 Neg Neg 1/3 Neg Neg Neg 0/3 Neg Neg Neg 0/3
1.3 × 10−5 Neg Neg Neg 0/3 Neg Neg Neg 0/3 Neg Neg Neg 0/3
1.3 × 10−6 Neg Neg Neg 0/3 Neg Neg Neg 0/3 Neg Neg Neg 0/3
a

CT, threshold cycle; Neg, negative.

(iii) Limits of detection with MERS-CoV spiked in different clinical matrices.

Serial 10-fold dilutions of MERS-CoV were spiked in different specimen matrices constructed from pooled human clinical samples, as follows: serum samples, including lipemic and hemolytic samples (10 samples); 10 NP/OP swabs in universal transport medium (Diagnostic Hybrids); 10 sputum samples; and 15 samples of 10% stool suspensions, as described above. The LoD values for all assay signatures ranged from 1.3 × 10−2 to 1.3 × 10−3 TCID50/ml across all sample matrices (Table 5). Similar results were obtained in direct comparisons between the NucliSENS easyMAG and MagNA Pure Compact extraction systems for NP/OP swab, serum, and sputum specimens (data not shown). However, the MagNA Pure Compact system was 1 to 2 log units less sensitive with stool specimens, and these results were replicated using a second instrument and different lots of nucleic acid isolation kit I cartridges.

TABLE 5.

MERS-CoV rRT-PCR assay performance with virus-spiked specimen pools

Virus amount (TCID50/ml) Specimen upEa
N2
N3
RP
CT
No. positive/no. tested CT
No. positive/no. tested CT
No. positive/no. tested CT
No. positive/no. tested
Test 1 Test 2 Test 3 Test 1 Test 2 Test 3 Test 1 Test 2 Test 3 Test 1 Test 2 Test 3
1.3 × 100 NP/OP 26.08 26.35 26.32 3/3 25.88 25.92 25.86 3/3 23.38 23.50 23.51 3/3 27.62 27.66 27.72 3/3
Sputum 26.62 26.72 26.75 3/3 26.07 26.13 26.15 3/3 23.69 23.74 23.76 3/3 23.43 23.56 23.61 3/3
Serum 26.81 26.71 27.07 3/3 26.55 26.46 26.48 3/3 25.71 25.66 25.65 3/3 31.53 31.02 31.04 3/3
Stool 27.24 27.67 28.05 3/3 28.26 28.34 28.45 3/3 25.13 25.40 25.56 3/3 37.36 38.15 36.74 3/3
1.3 × 10−1 NP/OP 27.90 27.86 27.85 3/3 27.35 27.24 27.49 3/3 25.00 25.16 24.93 3/3 27.58 27.62 27.69 3/3
Sputum 29.13 29.05 29.11 3/3 28.19 28.24 28.23 3/3 25.86 25.83 25.90 3/3 23.02 23.22 23.22 3/3
Serum 30.18 30.76 30.75 3/3 30.11 30.26 30.23 3/3 29.30 29.26 29.37 3/3 31.19 31.04 31.42 3/3
Stool 30.86 31.99 31.62 3/3 32.84 32.12 32.12 3/3 29.47 29.93 29.90 3/3 38.00 38.12 37.47 3/3
1.3 × 10−2 NP/OP 34.04 34.51 34.25 3/3 34.31 33.98 34.14 3/3 31.95 31.92 31.90 3/3 27.84 27.88 27.75 3/3
Sputum 35.29 35.59 34.88 3/3 35.35 34.67 35.52 3/3 32.57 32.69 32.27 3/3 23.28 23.28 23.28 3/3
Serum 33.62 33.67 33.54 3/3 33.03 33.00 33.33 3/3 32.70 32.43 32.18 3/3 31.29 30.98 31.19 3/3
Stool 34.93 35.74 35.08 3/3 36.95 37.83 36.72 3/3 32.74 33.87 33.68 3/3 36.69 38.23 38.36 3/3
1.3 × 10−3 NP/OP 38.70 37.87 39.36 3/3 37.50 37.11 38.10 3/3 36.57 35.43 35.41 3/3 27.87 28.01 28.03 3/3
Sputum 38.52 38.30 Neg 2/3 37.58 37.94 37.50 3/3 35.49 35.44 34.90 3/3 23.21 23.25 23.27 3/3
Serum 40.76 37.86 37.35 3/3 36.63 37.04 37.99 3/3 36.78 36.69 36.60 3/3 31.32 31.09 31.36 3/3
Stool 39.49 Neg 38.45 2/3 36.95 37.83 36.72 3/3 36.41 37.52 36.57 3/3 39.47 37.20 36.88 3/3
1.3 × 10−4 NP/OP Neg Neg Neg 0/3 Neg Neg Neg 0/3 Neg Neg Neg 0/3 28.01 28.00 27.96 3/3
Sputum Neg Neg Neg 0/3 Neg Neg Neg 0/3 Neg Neg Neg 0/3 24.74 24.72 24.69 3/3
Serum Neg Neg Neg 0/3 Neg Neg 39.72 1/3 Neg 40.44 39.58 2/3 31.40 31.28 31.65 3/3
Stool Neg Neg Neg 0/3 Neg Neg Neg 0/3 Neg Neg Neg 0/3 37.60 37.24 36.99 3/3
a

Neg, negative.

Analytical specificity. (i) Reactivity with different MERS-CoV strains (in silico prediction).

In addition to demonstrating reactivity of the rRT-PCR assay with the MERS-CoV strain Jordan-N3/NCV, primer/probe sequences were evaluated against an additional 8 genome sequences obtained from 7 patients between June 2012 and May 2013, available in GenBank, as well as a Health Protection Agency (HPA) website entry (http://www.hpa.org.uk/webc/HPAwebFile/HPAweb_C/1317138176202) (Table 2). Primer/probe sequences for all signatures were 100% identical to all published virus strains.

(ii) Cross-reactivity with other respiratory viral pathogens and human microbial flora.

The specificity of the MERS-CoV rRT-PCR assay was evaluated with purified nucleic acids obtained from a diverse collection of other respiratory virus isolates or positive clinical specimens, including human CoV 229E, OC43, NL63, and HKU1 and SARS (Table 6). In addition to the respiratory and stool specimens described below, pooled nasal wash fluid specimens prepared from 20 healthy adults to represent diverse microbial respiratory flora were also tested. No false-positive test results were obtained with any clinical sample.

TABLE 6.

MERS-CoV rRT-PCR assay cross-reactivity with other respiratory viruses

Virus (strain) Source rRT-PCR result (CT)a
Other respiratory viruses MERS-CoV
upE N2 N3
Adenovirus C1 (Ad.71) Laboratory strain Pos (13.7) Neg Neg Neg
Coronavirus 229E Laboratory strain Pos (9.8) Neg Neg Neg
Coronavirus OC43 Laboratory strain Pos (12.9) Neg Neg Neg
Coronavirus SARS (Urbani) Laboratory strain Pos (19.2) Neg Neg Neg
Coronavirus HKU1 Clinical specimen Pos (20.6) Neg Neg Neg
Coronavirus NL63 Clinical specimen Pos (19.9) Neg Neg Neg
Enterovirus 68 Field isolate Pos (21.3) Neg Neg Neg
Human metapneumovirus (CAN 99–81) Laboratory strain Pos (15.0) Neg Neg Neg
Influenza A H1N1 (A/India/2012) Field isolate Pos (14.7) Neg Neg Neg
Influenza A H3N1 (A/Texas/2012) Field isolate Pos (10.7) Neg Neg Neg
Influenza B (B/Massachusetts/1999) Field isolate Pos (8.4) Neg Neg Neg
Parainfluenza 1 (C35) Laboratory strain Pos (16.6) Neg Neg Neg
Parainfluenza 2 (Greer) Laboratory strain Pos (16.9) Neg Neg Neg
Parainfluenza 3 (C-43) Laboratory strain Pos (15.2) Neg Neg Neg
Parainfluenza 4a (M-25) Laboratory strain Pos (16.7) Neg Neg Neg
Parainfluenza 4b (CH 19503) Laboratory strain Pos (21.5) Neg Neg Neg
Parechovirus 1b Field isolate Pos (16.0) Neg Neg Neg
Respiratory syncytial virus (Long) Laboratory strain Pos (15.0) Neg Neg Neg
Rhinovirus 1A Laboratory strain Pos (13.4) Neg Neg Neg
a

Pos, positive; Neg, negative.

Clinical studies. (i) Performance of rRT-PCR assay with authentic human clinical specimens tested during retrospective and prospective MERS-CoV surveillance.

rRT-PCR results for clinical specimens obtained from persons hospitalized with SARI are shown in Table 7. Two specimens (1 bronchoalveolar lavage fluid specimen and 1 serum specimen) collected respectively from two SARI cases previously confirmed to be positive for MERS-CoV infection were positive with the three assay signatures. Of the 336 diverse clinical specimens from 321 other persons with SARI, all were negative with the corresponding assays. Assuming that all patients other than those associated with the Jordanian MERS-CoV outbreak cluster were not infected with MERS-CoV, the assay panel sensitivity, specificity, and overall agreement values were 100% (95% confidence interval [CI], 19.8% to 100%), 100% (95% CI, 98.6% to 100%), and 100% (95% CI, 98.9% to 100%), respectively.

TABLE 7.

MERS-CoV rRT-PCR assay results with 338 human specimens tested during retrospective and prospective MERS-CoV surveillance

Specimena MERS-CoV confirmed cases
Other SARI cases
Total no. No. positive/no. tested
Total no. No. positive/no. tested
upE N2 N3 upE N2 N3
URT
    NP/OP swab 0 290 0/290 0/290 0/290
    Nasal swab/wash 0 2 0/2 0/2 0/2
LRT
    Sputum 0 5 0/5 0/5 0/5
    Bronchoalveolar lavage fluid 1 1b/1 1b/1 1b/1 20 0/23 0/23 0/23
    Tracheal aspirate 0 3 0/3 0/3 0/3
    Lung tissue 0 4 0/4 0/4 0/4
Other
    Serum 1 1c/1 1c/1 1c/1 3 0/3 0/3 0/3
    Stool 0 7 0/7 0/7 0/7
    Pleural fluid 0 1 0/1 0/1 0/1
    Urine 0 1 0/1 0/1 0/1
Total 2 2/2 2/2 2/2 336 0/336 0/336 0/336
a

URT, upper respiratory tract; LRT, lower respiratory tract.

b

Bronchoalveolar lavage fluid specimen: upE, CT = 29.5; N2, CT = 27.9; N3, CT = 26.2.

c

Serum specimen: upE, CT = 38.35; N2, CT = 34.9; N3, CT = 36.1.

(ii) Performance of rRT-PCR assay with contrived serum and stool specimens.

To obtain additional performance data with other potentially high-value specimen types, 70 serum specimens and 70 stool specimens were obtained from the same numbers of individuals with SARI and gastroenteric illness, respectively. For each specimen type, 10 randomly selected samples were spiked with moderate (1.3 × 10−1 TCID50/ml) and 10 with low (1.3 × 10−2 TCID50/ml) concentrations of cultured virus and 50 were left unspiked. All samples were tested in a blinded manner. The expected test results were obtained for all samples of both specimen types (Table 8).

TABLE 8.

MERS-CoV rRT-PCR assay performance with individual virus-spiked serum and stool specimens

Virus quantity (TCID50/ml) Serum samples
Stool samples
Sample no. CT
Sample no. CT
upE N2 N3 upE N2 N3
1.3 × 10−1 SE1 32.19 32.66 31.74 ST1 34.63 33.95 32.68
SE2 37.08 37.57 36.98 ST2 31.35 31.17 29.37
SE3 34.10 35.02 33.88 ST3 34.43 33.51 32.48
SE4 34.48 34.36 33.63 ST4 34.40 33.74 32.94
SE5 36.30 36.28 35.86 ST5 33.98 33.70 32.29
SE6 32.40 32.42 31.82 ST6 34.59 34.21 32.89
SE7 33.28 33.28 32.60 ST7 34.07 33.43 32.16
SE8 36.33 36.33 36.33 ST8 33.96 33.07 31.84
SE9 33.92 34.31 33.02 ST9 32.32 32.27 30.78
SE10 32.43 32.63 31.69 ST10 34.57 33.91 32.86
34.25 (32.19–37.08)a 34.49 (32.42–37.57)a 33.76 (31.69–36.98)a 33.83 (31.35–34.63)a 33.30 (31.17–34.21)a 32.03 (29.37–32.94)a
1.3 × 10−2 SE11 35.56 35.93 35.78 ST11 37.08 37.10 35.89
SE12 41.49 43.41 39.76 ST12 37.16 36.52 35.27
SE13 36.38 37.96 38.96 ST13 37.36 36.16 35.54
SE14 39.59 39.76 38.62 ST14 35.97 35.72 34.60
SE15 36.47 36.12 35.75 ST15 37.76 37.10 36.50
SE16 38.29 39.23 39.22 ST16 37.42 37.85 35.09
SE17 38.52 38.08 38.11 ST17 36.96 37.00 36.11
SE18 35.25 35.46 34.68 ST18 39.81 37.23 35.69
SE19 38.18 40.11 39.23 ST19 37.53 37.39 36.00
SE20 37.81 38.46 38.55 ST20 37.94 37.24 35.72
37.75 (35.25–41.49)a 38.45 (35.46–43.41)a 37.87 (34.68–39.76)a 37.50 (35.97–39.81)a 36.93 (35.72–37.85)a 35.64 (34.60–36.50)a
No virus SE21-70 Negb Neg Neg ST21-70 Neg Neg Neg
a

Mean (range).

b

Neg, negative.

Reproducibility studies.

Assay reproducibility was evaluated with three contrived respiratory specimens constructed from pooled NP/OP swab samples as described above and spiked with high, moderate, or low concentrations of virus. Three laboratory staff members, each on a different day and blinded to content, extracted and tested the extracts in triplicate against each assay signature. Interassay variation was acceptably low for all signatures (coefficient of variation [CV] range: upE, 2.01 to 4.62%; N2, 2.81 to 8.09%; N3, 1.96 to 5.55%; RP, 1.07 to 2.26%) (Table 9).

TABLE 9.

MERS-CoV rRT-PCR assay reproducibility with virus spiked into pooled respiratory specimensa

Technician and virus quantity (TCID50/ml) CT
upE
N2
N3
RP
Test 1 Test 2 Test 3 Test 1 Test 2 Test 3 Test 1 Test 2 Test 3 Test 1 Test 2 Test 3
Day 1, technician 1
    3.4 × 101 20.64 20.81 20.61 19.78 19.89 19.64 18.75 18.82 18.86 33.33 33.04 32.85
    3.4 × 10−1 27.14 26.79 27.14 25.96 25.94 25.87 24.89 25.19 24.89 32.49 32.93 33.06
    3.4 × 10−3 35.69 35.79 35.86 35.07 35.21 35.10 33.42 33.73 33.58 32.53 32.77 32.16
Day 2, technician 2
    3.4 × 101 22.11 22.09 21.61 22.88 22.89 22.74 20.25 20.49 20.50 32.39 31.88 32.67
    3.4 × 10−1 28.22 27.96 28.62 29.48 29.19 29.42 27.42 27.22 27.21 32.28 33.47 33.87
    3.4 × 10−3 37.59 35.32 35.30 37.63 36.74 37.02 34.38 35.23 34.52 32.12 32.32 32.71
Day 3, technician 3
    3.4 × 101 20.68 20.56 20.47 19.92 19.28 19.68 19.18 19.21 19.24 32.34 32.26 32.68
    3.4 × 10−1 25.57 25.41 25.34 24.55 24.60 24.49 24.13 24.08 24.18 31.84 31.76 32.06
    3.4 × 10−3 35.75 35.19 36.08 35.62 35.07 35.14 34.62 33.62 35.02 32.12 31.65 32.33
Summary (mean ± SD [CV (%)])
    3.4 × 101 21.06 ± 0.68 (3.21) 20.75 ± 1.58 (7.63) 19.48 ± 0.73 (3.73) 32.60 ± 0.44 (1.35)
    3.4 × 10−1 26.91 ± 1.24 (4.62) 26.61 ± 2.15 (8.09) 25.47 ± 1.41 (5.55) 32.64 ± 0.74 (2.26)
    3.4 × 10−3 35.84 ± 0.72 (2.01) 35.84 ± 1.01 (2.81) 34.23 ± 0.67 (1.96) 32.30 ± 0.35 (1.07)
a

The pool of respiratory specimens was constructed from combined nasopharyngeal/oropharyngeal swabs obtained from 10 persons.

Test algorithm.

An algorithm based on the three rRT-PCR assays was developed to guide specimen testing for MERS-CoV (Fig. 2). For routine specimen screening, N2 testing was combined with upE testing to theoretically enhance the detection of virus when present at low concentrations and to reduce the likelihood of false-negative results due to polymorphisms within the binding sites of the signature sequences. A positive test result with either or both assays would require confirmation with N3 testing to report a presumptive positive specimen result.

FIG 2.

FIG 2

Algorithm for MERS-CoV rRT-PCR specimen testing and reporting of test results. For specimen screening, the N2 assay was combined with upE testing to potentially increase screening sensitivity and to reduce the possibility of false-negative results due to polymorphisms near the binding site of the oligonucleotide primers or probes. A positive test result by either or both assays requires confirmation with the N3 assay for reporting of a presumptive positive test result. VTC, viral template control; NTC, no-template control; RP, human RNase P gene.

DISCUSSION

In response to the emergence of MERS-CoV in the Middle East and its spread to several European countries, the U.S. Health and Human Services announced on 29 May 2013 that the virus posed a significant public health threat to U.S. citizens. On 5 June 2013, the U.S. Food and Drug Administration authorized emergency use of the CDC rRT-PCR assay as an in vitro diagnostic test for the presumptive detection of MERS-CoV in patients with clinical signs and symptoms of MERS-CoV infection, in conjunction with clinical and epidemiological risk factors (http://www.fda.gov/MedicalDevices/Safety/EmergencySituations/ucm161496.htm). Reagent kits were distributed by the CDC Laboratory Response Network to state public health departments and to select U.S. Department of Defense surveillance laboratories equipped to perform assays. The assay was also distributed to international public health partners in the affected region and to countries with extensive travel to and from the Middle East.

Our assay design and validation strategy were guided by several principles. First we chose to retain the upE signature designed by Corman et al. (4) due to its wide and successful use in MERS-CoV surveillance. A second signature developed by those authors to confirm positive upE test results, targeting the MERS-CoV 1b open reading frame (ORF), proved less sensitive than upE in comparison studies (4) and was not adopted; another assay signature, targeting ORF 1a, which was claimed to be as sensitive as upE, was later introduced (5). As an alternate testing strategy, we introduced two new signatures targeting the MERS-CoV nucleocapsid (N) gene; one assay (N2) was combined with upE testing to enhance sensitivity for specimen screening, and the second assay (N3) was reserved for positive test confirmation. Theoretically, rRT-PCR assays targeting the MERS-CoV N gene should offer enhanced diagnostic sensitivity due to the relative abundance of N gene subgenomic mRNA produced during virus replication, although we found no clear evidence of this in our study and this was not shown in practice for clinical diagnosis of SARS-CoV (6). Validation of all assay signatures was conducted with multiple specimen types, including upper and lower respiratory tract specimens, serum samples, and stool specimens, all shown to be diagnostically valuable for SARS-CoV (see below). Finally, we chose to validate the assay using instruments and reagents in common use by U.S. state and international public health laboratories, to minimize the occurrence of off-protocol use of the test.

Although the MERS-CoV rRT-PCR assay panel proved both sensitive and specific, the study was subject to several limitations. First, only two authentic specimens from patients with independently confirmed MRS-CoV infection were available for testing. Most data were derived from mock specimens spiked with cultured virus, which may not accurately replicate specimens obtained during natural virus infections. Also, spiked mock specimens were not subjected to the same collection, handling, and storage conditions to which authentic specimens would be subjected, which might negatively affect virus detection. Moreover, we cannot be certain that the specimens collected from other suspected MERS-CoV cases were truly negative for the virus. However, patient demographic and clinical features, evidence of infection with other respiratory pathogens, confirmed MERS-CoV seronegativity in some cases, and the self-validating negative test results obtained with all three assay signatures support this assumption. Finally, assay validation was necessarily limited to the use of specific instrumentation, reagents, and procedures. Use of different assay platforms or modifications in methodology could negatively affect assay performance.

The choice of appropriate specimen type, collection technique, and timing after the onset of symptoms is also critical for diagnostic success. Among some patients, MERS-CoV appears to be detected more often and with higher viral loads in lower respiratory tract specimens than in specimens from the upper respiratory tract (7, 8); consequently, lower respiratory tract specimens have been prioritized for collection by the WHO and the CDC (http://www.who.int/csr/disease/coronavirus_infections/update_20121221/en/). Other specimen types, such as serum/blood samples and stool specimens, may also prove valuable. Studies performed during the SARS epidemic found that SARS-CoV could be detected in serum/blood samples during the early prodromic phase of infection (9, 10) and was shed for prolonged periods at high titers in stool, facilitating detection later in the course of illness (11, 12). MERS-CoV RNA was reported to be detected in stool and urine specimens from one infected immunosuppressed patient (7), and the virus has been identified in serum samples from other patients (this study). Testing of more samples from additional patients infected with MERS-CoV, at all stages of illness, is essential to guide testing strategies. When respiratory specimens are collected late or are not available for molecular testing, serological testing may be an effective diagnostic alternative for MERS-CoV (13).

Even when optimal specimens and molecular tests are available, accurate diagnosis of MERS-CoV infection can still be challenging. Although rRT-PCR tests are less susceptible to amplicon contamination than are conventional RT-PCR assays, false-positive rRT-PCR results can still occur if practices designed to minimize the risk of contamination are not stringently followed. Access to multiple rRT-PCR assays targeting different regions of the MERS-CoV genome, with some assays kept in reserve for positive test result confirmation, is essential to prevent misidentifying MERS-CoV cases. It is also recommended that laboratories conducting MERS-CoV surveillance partner with the CDC or another qualified reference laboratory that can independently confirm rRT-PCR positive results by sequencing. While rRT-PCR assays are relevant for rapid diagnosis and patient management, genomic sequencing can provide public health authorities with needed confidence for response planning, can help avoid false alarms, and can provide data essential for monitoring both virus evolution and rRT-PCR assay signature integrity.

ACKNOWLEDGMENTS

We thank Christian Drosten from the University of Bonn Medical Center for providing the MERS-CoV nucleocapsid gene sequence. We also thank others at the CDC who contributed substantially to this effort, including Kanwar Bedi, Willie Betts, Michael Farrell, Matthew Marcum, Eileen Schneider, Yvonne Stifel, Nicky Sulaiman, and Azaibi Tamin.

The contents of this article are solely the responsibility of the authors and do not necessarily represent the official views of the CDC or the U.S. Department of Health and Human Services (DHHS). Names of specific vendors, manufacturers, or products are included for public health and informational purposes; inclusion does not imply endorsement of the vendors, manufacturers, or products by the CDC or the DHHS.

Footnotes

Published ahead of print 23 October 2013

REFERENCES

  • 1.Zaki AM, van Boheemen S, Bestebroer TM, Osterhaus AD, Fouchier RA. 2012. Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia. N. Engl. J. Med. 367:1814–1820. 10.1056/NEJMoa1211721 [DOI] [PubMed] [Google Scholar]
  • 2.van Boheemen S, de Graaf M, Lauber C, Bestebroer TM, Raj VS, Zaki AM, Osterhaus AD, Haagmans BL, Gorbalenya AE, Snijder EJ, Fouchier RA. 2012. Genomic characterization of a newly discovered coronavirus associated with acute respiratory distress syndrome in humans. mBio 3:e00473-12. 10.1128/mBio.00473-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.de Groot RJ, Baker SC, Baric RS, Brown CS, Drosten C, Enjuanes L, Fouchier RA, Galiano M, Gorbalenya AE, Memish ZA, Perlman S, Poon LL, Snijder EJ, Stephens GM, Woo PC, Zaki AM, Zambon M, Ziebuhr J. 2013. Middle East respiratory syndrome coronavirus (MERS-CoV): announcement of the Coronavirus Study Group. J. Virol. 87:7790–7792. 10.1128/JVI.01244-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Corman VM, Eckerle I, Bleicker T, Zaki A, Landt O, Eschbach-Bludau M, van Boheemen S, Gopal R, Ballhause M, Bestebroer TM, Muth D, Muller MA, Drexler JF, Zambon M, Osterhaus AD, Fouchier RM, Drosten C. 2012. Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction. Euro Surveill. 17:20285 http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=20285 [DOI] [PubMed] [Google Scholar]
  • 5.Corman VM, Muller MA, Costabel U, Timm J, Binger T, Meyer B, Kreher P, Lattwein E, Eschbach-Bludau M, Nitsche A, Bleicker T, Landt O, Schweiger B, Drexler JF, Osterhaus AD, Haagmans BL, Dittmer U, Bonin F, Wolff T, Drosten C. 2012. Assays for laboratory confirmation of novel human coronavirus (hCoV-EMC) infections. Euro Surveill. 17:20334 http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=20334 [DOI] [PubMed] [Google Scholar]
  • 6.Poon LL, Chan KH, Wong OK, Cheung TK, Ng I, Zheng B, Seto WH, Yuen KY, Guan Y, Peiris JS. 2004. Detection of SARS coronavirus in patients with severe acute respiratory syndrome by conventional and real-time quantitative reverse transcription-PCR assays. Clin. Chem. 50:67–72. 10.1373/clinchem.2003.023663 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Drosten C, Seilmaier M, Corman VM, Hartmann W, Scheible G, Sack S, Guggemos W, Kallies R, Muth D, Junglen S, Muller MA, Haas W, Guberina H, Rohnisch T, Schmid-Wendtner M, Aldabbagh S, Dittmer U, Gold H, Graf P, Bonin F, Rambaut A, Wendtner CM. 2013. Clinical features and virological analysis of a case of Middle East respiratory syndrome coronavirus infection. Lancet Infect. Dis. 13:745–751. 10.1016/S1473-3099(13)70154-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Guery B, Poissy J, el Mansouf L, Sejourne C, Ettahar N, Lemaire X, Vuotto F, Goffard A, Behillil S, Enouf V, Caro V, Mailles A, Che D, Manuguerra JC, Mathieu D, Fontanet A, van der Werf S, MERS-CoV Study Group 2013. Clinical features and viral diagnosis of two cases of infection with Middle East respiratory syndrome coronavirus: a report of nosocomial transmission. Lancet 381:2265–2272. 10.1016/S0140-6736(13)60982-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wang H, Mao Y, Ju L, Zhang J, Liu Z, Zhou X, Li Q, Wang Y, Kim S, Zhang L. 2004. Detection and monitoring of SARS coronavirus in the plasma and peripheral blood lymphocytes of patients with severe acute respiratory syndrome. Clin. Chem. 50:1237–1240. 10.1373/clinchem.2004.031237 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Grant PR, Garson JA, Tedder RS, Chan PK, Tam JS, Sung JJ. 2003. Detection of SARS coronavirus in plasma by real-time RT-PCR. N. Engl. J. Med. 349:2468–2469. 10.1056/NEJM200312183492522 [DOI] [PubMed] [Google Scholar]
  • 11.Cheng PK, Wong DA, Tong LK, Ip SM, Lo AC, Lau CS, Yeung EY, Lim WW. 2004. Viral shedding patterns of coronavirus in patients with probable severe acute respiratory syndrome. Lancet 363:1699–1700. 10.1016/S0140-6736(04)16255-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Peiris JS, Chu CM, Cheng VC, Chan KS, Hung IF, Poon LL, Law KI, Tang BS, Hon TY, Chan CS, Chan KH, Ng JS, Zheng BJ, Ng WL, Lai RW, Guan Y, Yuen KY, HKU/UCH SARS Study Group 2003. Clinical progression and viral load in a community outbreak of coronavirus-associated SARS pneumonia: a prospective study. Lancet 361:1767–1772. 10.1016/S0140-6736(03)13412-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Reusken CB, Haagmans BL, Muller MA, Gutierrez C, Godeke GJ, Meyer B, Muth D, Raj VS, Vries LS, Corman VM, Drexler JF, Smits SL, El Tahir YE, De Sousa R, van Beek J, Nowotny N, van Maanen K, Hidalgo-Hermoso E, Bosch BJ, Rottier P, Osterhaus A, Gortazar-Schmidt C, Drosten C, Koopmans MP. 2013. Middle East respiratory syndrome coronavirus neutralising serum antibodies in dromedary camels: a comparative serological study. Lancet Infect. Dis. 13:859–866. 10.1016/S1473-3099(13)70164-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Cotten M, Lam TT, Watson SJ, Palser AL, Petrova V, Grant P, Pybus OG, Rambaut A, Guan Y, Pillay D, Kellam P, Nastouli E. 2013. Full-genome deep sequencing and phylogenetic analysis of novel human betacoronavirus. Emerg. Infect. Dis. 19:736–742B. 10.3201/eid1905.130057 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Khuri-Bulos N, Payne DC, Lu X, Erdman D, Faouri S, Shehabi A, Johnson M, Becker MM, Denison MR, Williams JV, Halasa NB. Novel human coronavirus not detected in children hospitalized with acute respiratory illness in Amman, Jordan, March 2010–September 2012. Clin. Microbiol. Infect., in press [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES