Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2014 Jan;88(1):628–642. doi: 10.1128/JVI.02052-13

Hepatitis C Virus RNA Replication and Virus Particle Assembly Require Specific Dimerization of the NS4A Protein Transmembrane Domain

Andrew Kohlway a, Nathan Pirakitikulr b, Francisco N Barrera a, Olga Potapova b, Donald M Engelman a, Anna M Pyle b,c,d,, Brett D Lindenbach e,
PMCID: PMC3911751  PMID: 24173222

Abstract

Hepatitis C virus (HCV) NS4A is a single-pass transmembrane (TM) protein essential for viral replication and particle assembly. The sequence of the NS4A TM domain is highly conserved, suggesting that it may be important for protein-protein interactions. To test this hypothesis, we measured the potential dimerization of the NS4A TM domain in a well-characterized two-hybrid TM protein interaction system. The NS4A TM domain exhibited a strong homotypic interaction that was comparable in affinity to glycophorin A, a well-studied human blood group antigen that forms TM homodimers. Several mutations predicted to cluster on a common surface of the NS4A TM helix caused significant reductions in dimerization, suggesting that these residues form an interface for NS4A dimerization. Mutations in the NS4A TM domain were further examined in the JFH-1 genotype 2a replicon system; importantly, all mutations that destabilized NS4A dimers also caused defects in RNA replication and/or virus assembly. Computational modeling of NS4A TM interactions suggests a right-handed dimeric interaction of helices with an interface that is consistent with the mutational effects. Furthermore, defects in NS4A oligomerization and virus particle assembly of two mutants were rescued by NS4A A15S, a TM mutation recently identified through forward genetics as a cell culture-adaptive mutation. Together, these data provide the first example of a functionally important TM dimer interface within an HCV nonstructural protein and reveal a fundamental role of the NS4A TM domain in coordinating HCV RNA replication and virus particle assembly.

INTRODUCTION

Hepatitis C virus (HCV) is an enveloped, positive-sense RNA virus in the Flaviviridae family (1). HCV has been grouped into seven major genotypes and several subtypes (2, 3). The 9.6-kb genome is translated into a single ∼3,000-amino-acid polypeptide by cap-independent translation through an internal ribosome entry site (1). The polypeptide is cleaved into three structural proteins—core, E1, and E2—as well as seven nonstructural (NS) proteins—p7, NS2, NS3, NS4A, NS4B, NS5A, and NS5B (4). The structural proteins and p7 are cleaved from the polypeptide by cellular signal peptidases, whereas cleavage of the NS proteins is accomplished by the NS2-NS3 (NS2-3) cysteine autoprotease and the NS3-NS4A (NS3-4A) serine protease (4).

HCV NS4A is a 54-amino-acid polypeptide that anchors NS3 to the endoplasmic reticulum (ER) (1, 5, 6). NS4A encompasses an N-terminal, alpha-helical, single-pass transmembrane (TM) region required for association with the ER membrane (68), a central region that mediates interaction with the NS3 protease domain (5, 6, 911), and a C-terminal region implicated in both RNA replication and virus particle assembly (1215). NS4A functions as a cofactor for both serine protease and RNA helicase activities of NS3 and exhibits genetic and physical interactions with several other NS proteins, including NS2, NS4B, NS5A, and NS5B (1519). Additional roles for NS4A include translation inhibition (20, 21) through interaction with elongation factor 1A (22), regulation of the innate immune response through cleavage of the antiviral mitochondrial signaling adaptor MAVS as part of NS3-4A (2325), and recruitment of creatine kinase B to facilitate viral genome replication (26).

To date, the molecular architecture of the HCV replication complex and the process by which it is assembled from viral NS and host proteins remain obscure. Several studies have revealed interactions between HCV and host proteins (17, 27, 28). Nuclear magnetic resonance (NMR) and X-ray crystal structures have also been obtained for individual domains of HCV NS proteins (8, 2933), and progress has been made in isolating crude replication complexes from HCV-infected cells that retain endogenous replication activity (3436). Despite these gains, the molecular details of interactions between NS proteins and between NS proteins and host factors remain to be elucidated. Interestingly, TM regions appear to play a fundamental role in the incorporation of the NS proteins into the replication complex (7, 8, 37), motivating our efforts to understand their interactions.

To examine the propensity of the NS4A TM domain to homodimerize, we employed the GALLEX system, a well-characterized two-hybrid assay capable of measuring the strength of TM domain interactions in biological membranes (3840). In this system, a TM domain is fused between an N-terminal, cytosolic, DNA binding domain of the LexA transcriptional repressor and a C-terminal, periplasmic domain of maltose binding protein (MBP). Dimerization of the heterologous TM domain results in a LexA fusion capable of repressing β-galactosidase expression in Escherichia coli (41, 42). Similar bacterial two-hybrid systems have also been developed to examine homo- and heterotypic interactions between TM domains (4348).

As a reference, we used the best-studied model system for the study of TM protein interactions, human glycophorin A (GpA), a single-pass TM protein that forms a homodimer and has been characterized in model membranes, detergent micelles, and two-hybrid assays (4953). The “GxxxG” motif found in the GpA TM domain is one of the more prevalent and well-studied TM interaction motifs, which also include “GxxxA,” “GxxxS,” and other variations (39, 5459). Within the GxxxG motif, glycines or other small residues, such as serine or alanine, allow the two alpha helices to pack together in close proximity, leading to formation of hydrogen bonds between the carbonyl group and neighboring Cα hydrogens (55, 60). In addition, β-branched residues such as isoleucine and valine contribute to TM alpha-helical packing interactions by constraining side-chain rotamers and thereby limiting entropic penalties in helix interactions (55, 58). We show here that the NS4A TM domain also contains variations of the GxxxG motif and that these motifs contribute to NS4A dimerization.

We find that dimerization of the NS4A TM domain is required for the HCV life cycle. The NS4A TM domain exhibits a strong propensity for dimerization in the GALLEX system, and several residues critical for oligomerization were identified through mutational analysis. Mutations in the NS4A TM domain were then examined in a genotype 2a replicon system, revealing strong correlations between NS4A dimer formation and RNA replication and/or virus particle assembly. All-atom molecular dynamics simulations in vacuo provide a model for a right-handed dimer of NS4A alpha helices with a helix-helix interface that predicts the sensitive mutational sites. Together, these observations reveal the importance of the membrane as a scaffold in functional interactions of viral proteins.

MATERIALS AND METHODS

General computational tools.

Graphpad Prism 6 was used for data analysis and graphing. Models of the NS4A dimer were made in Pymol (PyMOL Molecular Graphics System, Version 1.5.0.4, Schrödinger, LLC, http://www.pymol.org). Adobe Photoshop and Illustrator CS6 were used to construct the figures. The NS4A TM alignment was created by using the UGENE toolkit (61).

Molecular biology.

Standard molecular biology techniques were used for cloning; plasmids were sequenced at the W.M. Keck Foundation Center at Yale University. Forward and reverse primers for site-directed mutagenesis were ordered from Invitrogen. The pYSGR-JFH1/GLuc replicon was previously described by Phan et al. (15). The GALLEX backbone plasmid pBLM100 was previously described by Schneider and Engelman (38).

NS4A mutations were introduced into pYSGR-JFH1/GLuc by using the Quikchange protocol with 2× PFU DNA polymerase master mix (Stratagene). Forward primers used for mutagenesis are listed in Table 1. Amplification products were digested with DpnI for 6 h at 37°C and then transformed into MachI cells (Invitrogen). Plasmids were prepared (Qiagen miniprep kit), sequences were verified, and correct mutants were subcloned back into pYSGR-JFH1/GLuc by using common NsiI and BsrGI restriction sites.

TABLE 1.

Site-directed mutagenesis primers for the HCV NS4A TM domaina

NS4A mutation JFH-1 codon H77 codon Replicon primer sequence Replicon GALLEX
T2A 1663 1659 CATGACCAGCGCGTGGGTCCTAG x x
W3A 1664 1660 GACCAGCACGGCGGTCCTAGCTG x x
W3F 1664 1660 GACCAGCACGTTTGTCCTAGCTG x
V4A 1665 1661 CAGCACGTGGGCCCTAGCTGGAG x x
V4G 1665 1661 CAGCACGTGGGGCCTAGCTGGAG x x
L5A 1666 1662 CACGTGGGTCGCAGCTGGAGGAG x x
L5G 1666 1662 CACGTGGGTCGGAGCTGGAGGAG x x
A6L 1667 1663 GTGGGTCCTACTTGGAGGAGTCC x x
G7A 1668 1664 GGTCCTAGCTGCAGGAGTCCTGG x x
G7L 1668 1664 GGTCCTAGCTCTAGGAGTCCTGG x x
G8A 1669 1665 CCTAGCTGGAGCAGTCCTGGCAG x x
G8L 1669 1665 CCTAGCTGGACTAGTCCTGGCAG x x
V9A 1670 1666 AGCTGGAGGAGCCCTGGCAGCCG x
V9G 1670 1666 AGCTGGAGGAGGCCTGGCAGCCG x x
L10A 1671 1667 TGGAGGAGTCGCGGCAGCCGTCG x x
L10G 1671 1667 TGGAGGAGTCGGGGCAGCCGTCG x x
A11L 1672 1668 AGGAGTCCTGCTAGCCGTCGCCG x x
A12L 1673 1669 AGTCCTGGCACTCGTCGCCGCAT x x
V13A 1674 1670 CCTGGCAGCCGCCGCCGCATATT x x
V13G 1674 1670 CCTGGCAGCCGGCGCCGCATATT x
A14L 1675 1671 GGCAGCCGTCCTCGCATATTGCC x x
A15L 1676 1672 AGCCGTCGCCCTATATTGCCTGG x x
A15S 1676 1672 AGCCGTCGCCTCATATTGCCTGG x x
Y16A 1677 1673 CGTCGCCGCAGCTTGCCTGGCGA x x
Y16S 1677 1673 CGTCGCCGCATCTTGCCTGGCGA x x
Y16F 1677 1673 CGTCGCCGCATTTTGCCTGGCGA x
Y16W 1677 1673 CGTCGCCGCATGGTGCCTGGCGA x
C17A 1678 1674 CGCCGCATATGCCCTGGCGACTG x x
C17S 1678 1674 CGCCGCATATAGCCTGGCGACTG x
L18A 1679 1675 CGCATATTGCGCGGCGACTGGAT x
L18G 1679 1675 CGCATATTGCGGGGCGACTGGAT x x
T20A 1681 1677 TTGCCTGGCGGCTGGATGCGTTT x x
G21V 1682 1678 CCTGGCGACTGTATGCGTTTCCA x
a

x, the NS4A mutation was introduced into either the replicon or GALLEX context.

For creation of the NS4A TM mutant library, forward and reverse primers with SpeI and SacI restriction sites were used for PCR with the wild-type (WT) and mutant NS4A TM regions, which were then ligated into SacI/SpeI-digested pBLM100. One extra nucleotide was needed after the SacI restriction site to keep the TM domain and MBP in the correct reading frame. Ligations were transformed into MachI cells, plasmids purified with Qiagen miniprep kits, and sequences verified at the Yale Keck facility. The WT NS4A TM GALLEX constructs are listed in Table S1 in the supplemental material.

Cell culture replication and infectivity.

pYSGR-JFH1/GLuc was digested with XbaI at 37°C overnight and mung bean nuclease at 30°C for 30 min. HCV RNA was made by runoff transcription with T7 RNA polymerase and purified by Qiagen RNeasy columns. HCV RNA was stored at −20°C in ME buffer (10 mM MOPS [morpholinepropanesulfonic acid; pH 6.5], 1 mM EDTA).

Replication assays were performed in a 24-well plate format and seeded 1 day prior to the experiment with 5 × 104 Huh-7.5[core-NS2] cells per well. Huh-7.5[core-NS2] cells were as described by Phan et al. (15) and cultured in Dulbecco's modified Eagle's medium (DMEM) (Invitrogen) containing 10% fetal calf serum (HyClone, Logan, UT) and 1 mM nonessential amino acids (Invitrogen). The Huh-7.5[core-NS2] cells were created by using the pLenti4 (Invitrogen) lentivirus transduction system to express the Jc1 core, E1, E2, p7, and NS2 proteins via the human cytomegalovirus immediate-early-1 promoter. HCV RNA was transfected with MIR-2250 mRNA lipid transfection reagent (Mirus) according to the manufacturer's protocol. Media were collected at 8, 24, 48, 72, and 96 h posttransfection and clarified in a microcentrifuge at 16,000 × g. Media were then mixed with 5× luciferase lysis buffer (NEB), and Gaussia luciferase activity was measured in a Berthold Centro LB 960 luminescent plate reader with a Gaussia luciferase kit (NEB). For luminescent measurements, 10 to 20 μl of media was assayed with 50 μl of luciferase reagent, and the signal was integrated over a span of 2 to 10 s.

For released infectivity assays, 100 μl of media collected from the 24-well replication assays was added to 96-well plates of naïve Huh-7.5[core-NS2] cells, previously seeded at 6 × 103 cells per well. After 12 to 16 h of infection, each 96-well plate was washed with phosphate-buffered saline (PBS) and fresh DMEM was added to each well. Media were collected 48 h after the wash, and Gaussia luciferase activity was measured as described above for replication.

For intracellular infectivity assays, Huh-7.5[core-NS2] cells were transfected with HCV RNA, washed with PBS after 8 h, and then harvested at 48 h posttransfection by trypsinization. Cells were centrifuged at 1,200 × g for 5 min, resuspended in DMEM, and subjected to three rounds of freezing with liquid nitrogen and thawing at 37°C. The cell lysates were then clarified at 16,000 × g for 5 min, and the lysates were tested for infectivity of naïve Huh-7.5[core-NS2] cells in 96-well plates as described above.

GALLEX β-galactosidase assays.

The pBLM100 expression construct, SU101 cells, and the GpA WT strain and GpA G83I GALLEX mutants were described previously (38). A modified protocol from Zhang and Bremer (62) was followed for the β-galactosidase assays. Overnight cultures of SU101 cells were grown in LB media containing the appropriate IPTG (isopropyl-β-d-thiogalactopyranoside) concentration and 200 μg/ml ampicillin. Cultures were diluted to an A600 of 0.1 and grown at 37°C to an A600 of 0.6. Then, 20 μl of cells was added to 80 μl of permeabilization solution (100 mM Na2HPO4, 20 mM KCl, 2 mM MgSO4, 0.8 mg/ml hexadecyltrimethylammonium bromide, 0.4 mg/ml sodium deoxycholate, 5.4 μl/ml β-mercaptoethanol [BME]) and warmed to 30°C. A 600-μl volume of prewarmed substrate solution (60 mM Na2HPO4, 40 mM NaH2PO4, 1 mg/ml o-nitrophenyl-β-d-galactoside, 2.7 μl/ml BME) was added to the permeabilized cells, and the reaction mixture was then incubated at 30°C for various lengths of time until a yellow color appeared (longer for strong oligomerization). After approximately 60 to 120 min, 700 μl of 1 M Na2CO3 was added to stop the reaction and debris was spun down for 10 min in a microcentrifuge. The A420 was measured in a spectrophotometer, and Miller units (MU) were calculated by using the following equation: MU = 1,000 × [A420/(A600 × 0.02 ml × substrate incubation time)]. The interaction affinity data were fitted by using the hyperbolic function [monomer] = 1 − [[IPTG]/([IPTG] + Kd)], where Kd (dissociation constant) = [monomer]2/[dimer].

Test for insertion of GALLEX TM domain.

To test if the chimeric NS4A TM GALLEX constructs localized to the inner membrane of E. coli SU101 cells, membrane fractions were isolated by alkaline extraction following the protocol of Russel and Model (63). Briefly, a 0.5-ml volume of cells was put on ice and an equal volume of ice-cold 0.2 M NaOH solution was added. Samples were then vortexed and centrifuged for 15 min at 4°C, and the pellet was resuspended in 1× SDS sample buffer. The soluble fraction was precipitated by adding 110 μl of 100% trichloroacetic acid (TCA) to the supernatant to achieve a final concentration of 10%. The mixture was kept at 4°C overnight, centrifuged, and washed with 0.5 ml of ice-cold acetone. The precipitant was then resuspended in 1× SDS buffer. Samples were separated on 12% Bio-Rad Tris-glycine gels, and Western blots were run in a Bio-Rad wet transfer apparatus onto polyvinylidene difluoride (PVDF) membranes. Maltose binding protein (MBP) polyclonal (PA1-989) and anti-rabbit secondary horseradish peroxidase (HRP) (31460) antibodies were purchased from Thermo Scientific.

Test for orientation of GALLEX TM domain.

To test for correct orientation of LexA-TM-MBP chimeric proteins, GALLEX constructs were transformed into NT326 E. coli cells lacking endogenous MBP (malE) and cultured on M9-agar plates following a modified protocol from Schneider and Engelman (38). Transformants were plated onto LB plates containing 200 μg/ml carbenicillin and 0.01 mM IPTG. Single colonies were grown overnight in M9 minimal media (22 mM KH2PO4, 47.6 mM Na2HPO4, 8.55 mM NaCl, 18.7 mM NH4Cl, 2 mM MgSO4, 0.1 mM CaCl2) supplemented with trace elements (6.3 μM ZnSO4, 7 μM CuCl2, 7.1 μM MnSO4, 7.6 μM CoCl2, 60 μM FeCl3), 2 μg/ml thiamine, 0.4% glucose, 200 μg/ml carbenicillin, and 0.02 mM IPTG. Overnight cultures were pelleted, washed with PBS, resuspended in 200 μl of PBS, and plated onto M9 minimal-medium plates with 1.5% maltose, 200 μg/ml carbenicillin, 1.5% noble agar, and 0.02 mM IPTG. Plates were incubated at 37°C for 3 to 4 days to assay for MBP complementation. We detected subtle variations in the levels of MBP complementation for a few of the NS4A TM mutants. A reduction in complementation could be explained by the structural constraints that the TM mutants impose on the MBP because of an altered oligomeric interface. MBP must be able to diffuse freely and bind to the MBP transporter in the proper orientation in order for complementation to occur (64).

Modeling of the NS4A TM dimer.

A model for dimeric TM helices (see Table S2 in the supplemental material) was generated by using the CHI (CNS [Crystallography and NMR System] Helix Interactions) computational search strategy (65, 66). Briefly, CHI was used to construct a pair of canonical alpha helices from the NS4A TM sequence with lengths of 16, 17, 18, and 19 amino acids with both left-handed and right-handed helical arrangements. Molecular dynamics (MD) simulations were performed in vacuo by using simulated annealing. Energy minimization was performed before and after the MD simulations, and the resulting structures with backbone root mean square deviations (RMSD) of 1 Å or less were placed into clusters corresponding to the final model. The search was carried out over the entire two-body rotational interaction space (0 to 360°), and different interhelix distances (9 to 11 Å) and crossing angles (10 to 40°) were explored. Clusters for both left-handed and right-handed dimers of NS4A alpha helices were obtained. However, only the right-handed dimer model was in agreement with the experimentally determined interaction interface. The searching algorithm settled on a crossing angle of between approximately 25° and 30° in all of the clusters. The predicted interaction energy for NS4A residue W3 is high because stacking between aromatic rings of the TM helices, particularly in the 16-, 17-, and 18-amino-acid dimer models, can occur in vacuo but is unlikely to occur in a true lipid-water interface.

Modeling of NS3-4A in a membrane.

The 19-amino-acid NS4A dimer was modeled into a membrane of 1-palmitoyl-2-oleoylphosphatidylcholine (POPC) created with the VMD membrane builder (67). Two protease domains of NS3 (3O8B) were docked across from each other with the constraints imposed by the NS4A dimer and the α0 helix of the NS3 protease domain (8). The cytosolic portions of the NS3protease-4A dimer were minimized with the Yasara Energy Minimization Server (68). For placement of the NS3 helicase, the domain was positioned and oriented relative to the protease domain through the alignment with the dengue virus NS3 structure (2WHX).

RESULTS

The NS4A TM domain dimerizes in biological membranes.

Approximately 80% of the NS4A TM region is identically conserved across all genotypes (Fig. 1A), suggesting that the sequence of this region has functional significance beyond acting as a TM anchor (69). Notably, the NS4A TM domain contains a central region with several invariant glycines and alanines (G7GxxAAxAA15), as well as two valines, which could contribute to intramembrane oligomerization. Based on these observations, we hypothesized that the NS4A TM domain forms a homotypic protein-protein dimer within the plane of the membrane.

FIG 1.

FIG 1

NS4A TM domain dimerizes in the GALLEX system. (A) Alignment of the NS4A TM domain with representative sequences from the seven major HCV genotypes. (B) A 19-amino-acid segment of the NS4A TM domain and a 16-amino-acid segment of the GpA TM domain dimerize in the GALLEX assay. The GpA G83I mutant is defective in dimerization; pBR322 served as a vector control. β-Galactosidase activities were measured in Miller units and are displayed on a log2 scale to facilitate visualization of both large and small differences. (C) Estimation of dimer interaction affinity. The monomeric fraction was plotted against IPTG concentration and fitted to a hyperbolic curve. (D) NS4A TM mutant GALLEX plasmids and controls were transformed into NT326 cells lacking MBP (malE) and plated onto M9 minimal media with 1.5% maltose. Plates were incubated at 37°C for 3 to 4 days to test for complementation of MBP. (E) Membrane (M) and soluble (S) fractions from SU101 cells expressing 19-amino-acid NS4A mutant GALLEX plasmids were isolated by alkaline extraction. Fractions were run on 12% SDS-PAGE gels and subjected to Western blot analysis for MBP. The band runs at approximately 50 kDa. (F) The β-galactosidase repression in SU101 cells of 19-amino-acid NS4A TM mutants in the GALLEX system. The pBR322 negative control was reproduced from the experiment described for panel B. Each β-galactosidase experiment was performed in at least triplicate, and error bars represent the range.

There are no generally applicable, direct biochemical methods to detect TM domain interactions within mammalian cells. Therefore, to test our hypothesis that the NS4A TM domain can self-interact, we utilized the GALLEX assay, a well-characterized two-hybrid system for measuring TM domain interactions, including human protein TM dimers, in biological membranes (38). Peptides corresponding to 16-, 17-, 18-, and 19-amino-acid segments of the NS4A TM domain (see Table S1 in the supplemental material) were fused between an N-terminal LexA transcriptional regulatory domain and a C-terminal maltose binding protein (MBP). The chimeric NS4A TM constructs were expressed under the control of the tac promoter in SU101 E. coli cells containing a β-galactosidase reporter gene with an upstream ctx promoter that is repressed by LexA dimers. Because the LexA regulatory domain and MBP do not dimerize on their own, oligomerization of the NS4A TM domain should drive LexA dimerization and repress β-galactosidase reporter gene expression (see Fig. S1 in the supplemental material).

While the length of a TM domain can influence the strength of oligomerization in the GALLEX system (38), all four of the 16- to 19-amino-acid segments of NS4A exhibited strong homotypic interaction (see Fig. S2 in the supplemental material). We therefore chose to further characterize the 19-amino-acid segment of the NS4A TM domain as a conservative choice for the region of interest. First, we compared the oligomerization affinity of the NS4A TM domain to that of the GpA TM domain previously characterized in the GALLEX system, as well as to that of the GpA G83I mutant, which is defective in dimerization (38). pBR322, the backbone plasmid for expression of LexA-TM-MBP, served as a negative control. At 0.02 mM IPTG, which induced near-saturating levels of chimeric protein, the wild-type (WT) NS4A and GpA TM domains exhibited similar oligomerization affinities, and the measured β-galactosidase activities (Miller units) were over 10-fold lower than those of the negative controls, GpA G83I and pBR322 (Fig. 1B).

Next, in order to calculate an approximate free energy of dimerization, we employed the method described for GpA by Finger et al., which takes advantage of the linear relationship between IPTG concentration and induction of protein expression, at least within the approximate range of 0.001 to 0.1 mM IPTG (40). IPTG was titrated at concentrations ranging from 0 to 0.5 mM to vary the expression level of the NS4A and GpA TM domains (Fig. 1C), and the initial and saturating β-galactosidase activities were used to normalize the monomeric fraction. Note that the GALLEX assay can register higher-order oligomers and that dimerization of the NS4A TM domain would be the simplest case. Based on hyperbolic curves fitted to the data, the apparent Kd values of the NS4A and GpA TM domains were 2.9 and 2.1 μM, respectively; this was in close agreement with the 3.1 μM apparent Kd calculated previously for GpA (40). These values correspond to apparent free energies of dimerization (ΔG) of 7.5 and 7.7 kcal/mol for NS4A and GpA, respectively. Furthermore, a fit to the Hill equation yielded a cooperativity coefficient (“n”) of approximately 1 (data not shown). This apparent lack of cooperativity suggests that the NS4A TM domain is likely to form a dimer rather than a higher-order oligomer. Together, these data indicate that the NS4A and GpA TM domains have similarly strong tendencies to homodimerize in a biological membrane.

Mutations in the NS4A TM domain exhibit defects in dimerization.

After establishing that the NS4A TM domain can interact with itself in the GALLEX system, we wanted to identify residues in NS4A that contribute to this interaction. We therefore created a library of mutants designed to disrupt TM helix packing interactions without affecting TM helix stability or membrane insertion. Based on these considerations, the mutations were limited to substitutions of glycine, alanine, and leucine residues that are abundant in TM domains, with the one exception of a tyrosine-to-serine mutation (58) (Table 1). In addition, we included double and triple mutants with mutations of G7, A11, and A15 residues, which could fall on the alpha-helical interface of a right-handed dimer, following the i, i + 4 rule. These three residues form part of the conserved double-alanine and double-glycine patches and may be part of a GxxxG-like scaffold.

Generally speaking, for a hypothetical TM-TM interaction, the increase in volume from glycine to leucine is expected to disrupt tight packing of the TM helices. For example, the small glycine residues in the GxxxG-like motifs are important to allow close packing of helices and formation of backbone hydrogen bonds (see the introduction above). Therefore, larger residues at the glycine positions would cause steric clashes, preventing the two TM alpha helices from coming into close contact and inhibiting the formation of stabilizing hydrogen bonds. A decrease in volume from a leucine to a glycine could decrease van der Waals packing interactions between helices and introduce a destabilizing void or pocket. This point is highlighted by computational and experimental models predicting that a loss of buried surface area between TM helices costs 26 to 39 cal · mol−1 · Å−2 of surface area, similar to the packing energetics of soluble proteins (70, 71).

The ability of the WT NS4A TM domain to repress β-galactosidase activity in the GALLEX assay implies that it was properly inserted and oriented within the E. coli membrane. However, before measuring the β-galactosidase activity of the NS4A TM domain mutants, we wanted to test whether each mutation affected insertion and proper orientation into the membrane. To test for the correct orientation of the NS4A TM domain, with LexA in the cytoplasm and MBP in the periplasm, we performed a maltose complementation assay with NT326 cells that lack endogenous MBP. We first tested each construct on minimal-medium plates supplemented with glucose and determined that the expression of the WT and mutant NS4A TM domains did not affect cellular growth of the NT326 cells (see Fig. S3 in the supplemental material). Then, we established that the WT and mutant NS4A TM domains complemented the maltose auxotrophy of NT326 cells, indicating proper insertion and orientation of the TM domain (Fig. 1D).

To further confirm the membrane insertion of the WT and mutant NS4A TM domains, we performed an alkaline extraction to isolate integral membrane proteins from SU101 cells. A Western blot analysis for MBP confirmed that the expression levels of the WT and mutant NS4A TM chimeras were similar and that the chimeras were predominately in the pellet (membrane) fraction of E. coli, with little to no protein expressed in the supernatant (soluble) fraction (Fig. 1E). Therefore, we conclude that the expression levels of correctly oriented and inserted NS4A TM chimeras were similar for all of the mutants tested in the GALLEX system.

After establishing that our library of mutations did not affect the insertion of the NS4A TM domain, we measured the β-galactosidase activities of the single, double, and triple NS4A TM domain mutants (Fig. 1F). The β-galactosidase experiments were performed with a constant IPTG concentration of 0.02 mM, a concentration at which the WT NS4A TM domain repressed the maximum level of β-galactosidase activity (Fig. 1C). This concentration of IPTG was chosen to maximize oligomer formation and thereby reveal dimer-disrupting mutations but was still in the predicted linear range of protein induction based on previous work with GpA (40).

Single mutations in the double-glycine patch, G7 and G8, as well as in the second double-alanine patch, A14 and A15, demonstrated the greatest disruption in β-galactosidase repression. As expected, the G7L and G8L mutations disrupted β-galactosidase repression more than the G7A and G8A mutations. There were 2- to 5-fold defects in β-galactosidase repression for leucine mutations in the first double-alanine patch, A11L and A12L, indicating that this patch appears to be less critical for oligomerization of the NS4A TM domain. However, a double- or triple-mutation combination of G7L, A11L, or A15L disrupted β-galactosidase activity to nearly the level seen with the negative control, pBR322. This observation is particularly interesting because it suggests that the conserved alanine and glycine patches are instrumental in the packing of NS4A TM domain oligomers. Outside the double-glycine and -alanine patches, the only mutations that destabilized the NS4A TM dimer were L5G and V9G. Together, these data define residues in the NS4A TM domain that influence dimer stability.

Several residues in the NS4A TM domain are required for HCV replication and infectivity.

To study the role of the NS4A TM domain in viral replication and infectious virus production, we examined the phenotypes of NS4A TM mutants in the JFH-1 genotype 2a HCV replicon system (Table 1). In particular, we were interested in determining whether mutants with oligomerization defects in the GALLEX system also sustained defects in the viral life cycle. In addition, we expanded our mutant library to include G21V, a mutation previously identified to disrupt HCV replication (8), as well as additional substitutions (mainly to G, A, and L) at several positions: W3, V9, V13, Y16, C17, L18, and G21. All NS4A mutations were studied in the context of the bicistronic subgenomic replicon JFH1-GLuc, which constitutively expresses the secreted luciferase from Gaussia princeps (Fig. 2A) (15). To facilitate the production of pseudoinfectious virus particles, replicons were transfected into Huh-7.5 cells constitutively expressing core-NS2 (Huh-7.5 [core-NS2]) as described by Phan et al. (15). The experimental setup used to measure replication and released infectivity is illustrated in Fig. 2B. Media were collected at 8, 24, 48, 72, and 96 h posttransfection, and RNA replication was assayed by measuring the activity of luciferase released into the media of transfected cells. Virus production was determined by using the media or cell lysates to infect naive cells and measuring nascent luciferase production. A well-characterized defective NS5B polymerase mutant, GNN, was used as a negative control for the cell culture experiments.

FIG 2.

FIG 2

Replication and infectivity of HCV subgenomic replicon in Huh-7.5 cells expressing core-NS2. (A) Diagram of the GLuc replicon construct for monitoring HCV replication in Huh-7.5[core-NS2] cells. Triangles indicate sites cleaved by NS3-4A, and the circle indicates a signal peptidase cleavage site at the N terminus of the GLuc gene that leads to the secretion of Gaussia luciferase. IRES, internal ribosome entry site; EMCV, encephalomyocarditis virus. (B) Design of replication and released infectivity experiments. (C) Replication of NS4A TM mutants in the GLuc-JFH1 replicon context in Huh-7.5[core-NS2] cells. Media were collected at 8, 24, 48, 72, and 96 h and then assayed for secreted Gaussia luciferase. The GNN mutant is the product of a mutation that disrupts the active site of the NS5B RNA-dependent RNA polymerase. The luciferase activity (y axis) at each of the time points—8, 24, 48, 72, and 96 h—is plotted in succession from left to right (x axis) for each NS4A mutant. RLU, relative light units. (D) Released infectivity measurements of the media collected at 8, 24, 48, 72, and 96 h for each NS4A TM mutant. The media assayed for replication as described for panel C were used to infect naive cells, and then fresh media were assayed 48 h after infection for secreted luciferase. The time courses of luciferase expression are plotted as described for panel C. (E) Intracellular infectivity measurements of lysate from infected cells. Infected cells were trypsinized from plates, centrifuged, and subjected to three rounds of freezing and thawing. Cell lysates were then used to infect naive cells, and fresh media were assayed 48 h after infection for secreted luciferase. Each point or column in panels C, D, and E represents the average of the results of three experiments, and the error bars represent the standard deviations. Designations of mutants tested in cell culture but not in the GALLEX assay are colored gray in panels C, D, and E.

Nearly half of the NS4A TM domain mutants—V4G, L5G, G7A, G7L, G8L, V9G, L10A, L10G, A11L, A15L, Y16A, Y16S, L18G, and G21V—had severe defects in RNA replication (Fig. 2C). Certain positions—V4G, L5G, G8L, V9G, Y16S, and L18G—required severe mutations (larger volume changes) in order to disrupt replication, whereas moderate mutations at the same positions—V4A, L5A, G8A, V9A, Y16F/W, and L18A—retained WT or near-WT levels of replication. Two residues, G7 and L10, exhibited defects both with the moderate substitutions G7A and L10A and with the more severe substitutions G7L and L10G. The alanine residues were scanned with only one set of mutations—A6L, A11L, A12L, A14L, and A15L—and we observed replication defects in only two of those positions—A11 and A15.

Aromatic residues, particularly tyrosine and tryptophan, can foster aromatic-aromatic interactions between TM alpha helices or can contribute to stability at the lipid-water interface of a TM alpha helix (72, 73). Because of the location of Y16 near the end of the NS4A alpha helix segment and the requirement for an aromatic residue, Y16 may interact with the phospholipid head group region of the lipid bilayer. Similarly, W3 is invariant among HCV isolates but was surprisingly not required for HCV replication. Thus, W3 may contribute to the overall stability of the NS4A TM helix without being essential for the function of NS4A, at least in the context of our cell culture model.

Next, we measured the level of infectious virus released into the media at each time point (Fig. 2D). As expected, mutants that were unable to replicate did not produce infectious virus. However, several mutants with near-WT levels of viral replication were impaired in the secretion of infectious virus particles, including V4A, L5A, A6L, G8A, A12L, A14L, and L18A. Two mutants—V4A and L5A—had lags in replication that likely contributed to the decrease in infectious virus production at earlier time points. In order to establish if the defects in virus production were due to reduced levels of virus assembly or virus release, we measured the levels of intracellular infectivity from cells lysed at 48 h postinfection (Fig. 2E). The intracellular infectivity levels for each mutant correlated well with the levels of released infectivity, indicating that defects in virus production were attributable to decreased virus assembly, although we cannot quantitatively assess how subtle defects in replication contribute to defects in virus production.

CHI all-atom simulation predicts a right-handed dimer of NS4A TM domains.

To provide a detailed structural model of the NS4A TM homotypic interaction, we used the program CHI to perform a series of molecular dynamics simulations for TM helix interactions. CHI is a helix-interaction modeling package integrated within the CNS (Crystallography and NMR System) software suite (65, 66). Two NS4A TM domain alpha helices were generated and then docked in locations adjacent to one another at the beginning of each simulation. After an initial energy minimization, a simulation was initiated and the helices were allowed to explore the full rotational interaction space, interhelix distances, and crossing angles. Upon completion of the simulation, a final energy minimization was performed and the resulting structures were binned based on root-mean-square deviations (RMSD). Simulations were performed with NS4A TM helices of lengths of 16 to 19 amino acids and with two initial helix-helix crossing angles. Clusters of resulting structures represent chemically favorable interactions of the helices. Both right- and left-handed dimers of NS4A were generated; however, a right-handed parallel dimer, which aligns G7, A11, and A15, was more compatible with our experimental results.

The relative enthalpic interaction energies contributed by each residue were averaged from every simulation of 16- to 19-amino-acid helices and plotted in Fig. 3A. A parallel right-handed 19-amino-acid NS4A TM dimer structure from our lowest energy bin is shown in Fig. 3B and C. The predicted dimer model reveals that three residues—G7, A11, and A15—constitute the center of the dimer interface. Based on this model, it is clear that mutations with larger volumes at these positions would introduce steric clashes with the opposing helix and mutations with smaller volumes at other positions such as L18 would eliminate van der Waals packing interactions between helices (see Fig. S4 in the supplemental material).

FIG 3.

FIG 3

CHI all-atom simulation predicts a right-handed parallel NS4A dimer. (A) The CHI simulation was run with 16-, 17-, 18, and 19-amino-acid-length NS4A TM segments (see Table S1 in the supplemental material) at two different starting helix-helix crossing angles of 25° and 40°. The average interaction energy (kcal/mol) from the lowest energy cluster of each simulation was plotted for each residue. The NS4A T2 and W3 positions yielded interaction energies of 1.0 and 8.0 kcal/mol, respectively, but are not shown in the graph because of the high interaction energies caused by the artifactual pi-pi stacking between the W3 positions in vacuo (see Materials and Methods). (B) Top-down view of the predicted NS4A dimer with positions G7, A11, and A15 highlighted in red. (C) Side view of the predicted NS4A dimer with positions G7, A11, and A15 highlighted in red.

Based on the predicted role of residue A11 in stabilizing the dimeric interface and the observation that A11L caused profound defects in RNA replication, it was surprising that the A11L mutation had only a modest destabilizing effect on dimer formation in the GALLEX assay. It is worth noting that in the context of the NS4A G7L and A15L mutations, the A11L mutation substantially exacerbated defects in GALLEX oligomerization (Fig. 1F). Nonetheless, to reconcile these results, we hypothesized that the NS4A A11L mutant may adopt an alternative dimer interface, a mechanism previously observed for mutations that unexpectedly stabilize GpA dimers (74). To test this hypothesis, we ran an additional CHI simulation on the NS4A A11L mutant to predict whether an alternate packing interface could exist for this mutant. We discovered that the NS4A A11L mutant displayed an interaction energy profile similar to that displayed by WT NS4A, suggesting a propensity to dimerize, but the packing interface of the NS4A A11L dimer was shifted by one residue and the crossing angle increased from 29° to 36° (see Fig. S5 in the supplemental material). This prediction may explain why the A11L mutant showed oligomerization in the GALLEX system whereas the shifted packing interface could have disrupted replication in cell culture, further highlighting the specificity and functional importance of dimer formation.

The NS4A TM dimer model complements the experimental data obtained from the GALLEX and cell culture mutational analyses. The highest interaction energies from the computational dimer model were observed for residues V4, G7, L10, A11, A14, A15, and L18. These predicted determinants for homodimerization overlap the set of empirically determined constraints for homodimerization detected via the GALLEX assay (G7, A11, A14, and A15) and overlap residues that, when mutated, caused defects in RNA replication (V4A, V4G, G7A, G7L, L10A, L10G, A11L, A15L, and L18G) or virus assembly (A14L and L18A). Although we did not detect GALLEX deficiencies at positions V4, L10, and L18, it is possible that subtle defects at these positions may have been missed because the NS4A TM domain was overexpressed at a high level under the control of the tac promoter.

One surface of the NS4A TM alpha helix is responsible for homotypic interaction.

A summary of the GALLEX, cell culture, and CHI experimental results, including helical wheel and helical net representations as well as graphs comparing the phenotypes in the cell culture assay versus the GALLEX assay, is shown in Fig. 4. In the helix representations, residues were classified based on their sensitivity to mutation or contribution to calculated binding energy. The typically observed crossing angles in right-handed (−40°) and left-handed (20°) TM dimers result in a unique interaction interface that can be represented by modifying the number of residues per turn of a single alpha-helical wheel (75). This representation groups residues that fall together on a putative dimer interface. Therefore, to more clearly represent the helix-helix contacts in a right-handed dimer, alpha-helical wheel representations were drawn with 3.9 residues per turn to align the interaction interface. For comparison, a left-handed alpha-helical wheel representation with 3.5 residues per turn was also included (see Fig. S6 in the supplemental material) (76). Note that the NS4A TM alpha helix still retained a canonical 3.6 residues per turn and that the helical wheel alterations represent only potential dimeric interaction interfaces. These data highlight strong correlations between RNA replication, infectious virus production, and homotypic interaction within the GALLEX assay. The predicted dimerization interface also aligns well with the surface important for RNA replication, although it is slightly shifted from the surface important for interaction within the GALLEX assay.

FIG 4.

FIG 4

Helical wheel representations of the replication, infectivity, and oligomerization properties of mutants at each position of the NS4A TM domain. (A) Summary of the CHI simulation data. Amino acid positions are colored darker to represent a stronger interaction energy as predicted by the CHI simulation. (B) Summary of the GALLEX data on NS4A homo-oligomerization. (C) Summary of the HCV cell culture replication data. (D) Summary of the HCV cell culture infectivity data. For panels B, C, and D, amino acid positions are colored based on defects observed in the oligomerization, replication, or infectivity properties of mutants at each position. Amino acid positions are colored light (WT) to dark (defective) for each amino acid position according to whether a mutation or mutations at each position disrupted oligomerization, replication, or infectivity. Amino acid positions are colored a lighter shade if a mutation or mutations exhibited only small defects or if two mutations at the same position exhibited different phenotypes. (E) The replication phenotypes (indicated in RLU at 48 h) are plotted against the GALLEX interaction phenotypes. The white oval and dotted line represent the WT phenotype; blue, mutants with only minor defects in replication and GALLEX interaction; green, mutants with defects in replication but no defect in GALLEX interaction; yellow, mutants with defects in replication and GALLEX interaction; red, mutants with no defects in replication but defects in GALLEX interaction. (F) The intracellular infectivity phenotypes are plotted against the GALLEX interaction phenotypes. Mutants are colored as described for panel E. For panels E and F, unpaired Student's t tests determined that the L10A, L10G, Y16S, G7A, V9G, and A11L GALLEX results were statistically significant (P < 0.05) compared to the WT NS4A results; however, mutants were labeled defective if their results were above the 2-fold threshold. Given the larger dynamic range of the HCV replication and infectivity assays, mutants were labeled defective if their results were above the 10-fold threshold.

There is a remarkable concordance between the cell culture phenotypes and GALLEX results. Specifically, every point mutation that disrupts NS4A dimer formation in the GALLEX system—L5G, G7L, G8A, G8L, V9G, A11L, A12L, A14L, and A15L—also disrupts either viral replication or infectious virus production (yellow points in Fig. 4E and F). Three mutations—G8A, A12L, and A14L—destabilized dimer formation in the GALLEX assay but had minor effects on virus replication (red points in Fig. 4E). However, these mutations caused strong defects in virus assembly (dotted oval in Fig. 4F), suggesting that the mechanism by which they destabilize dimer formation is still compatible with RNA replication but may cause defects in virus assembly. Several mutations—V4A, V4G, L5A, A6L, G7A, L10A, L10G, Y16A, Y16S, and L18G—did not destabilize NS4A in the GALLEX assay but caused severe defects in cell culture (green points in Fig. 4E and F). These data support a model in which the homotypic interaction of the NS4A TM domain is required for both viral replication and infectivity but suggest that other, heterotypic TM interactions may also be required.

NS4A A15S suppresses defects in cell culture and GALLEX oligomerization.

While our reverse genetic approach supports a model for NS4A dimerization, the discovery of sequence preferences through forward genetic analysis could provide further evidence for this model. Interestingly, a mutation within the NS4A TM domain, A15S, was identified as a key adaptive change that, when combined with two additional mutations in NS3 and NS5B, conferred efficient replication and virus production to genotype 1a, 2a, and 2b viral genomes that were previously unable to replicate in cell culture (77, 78). Based on our model of NS4A dimerization, this serine substitution at position 15 could provide additional hydrogen bonds to help stabilize a TM dimer (Fig. 5A). Consistent with this, previous GALLEX studies showed that a serine substitution was more stabilizing than an alanine substitution for the second glycine within the GxxxG motif of GpA (39).

FIG 5.

FIG 5

The NS4A A15S mutation rescues replication and assembly defects of the NS4A A6L, G8A, and A14L mutants. (A) The A15S mutation in the context of the proposed NS4A dimer model would create two additional hydrogen bonds with the backbone carbonyl of the preceding residue and in theory stabilize the NS4A dimer. (B) The β-galactosidase repression in SU101 cells of A6L, G8A, and A14L with and without the A15S mutation in the GALLEX system. (C) Replication of A6L, G8A, and A14L with and without the A15S mutation in the GLuc-JFH1 replicon context in Huh-7.5[core-NS2] cells. Media were collected at 8, 24, 48, 72, and 96 h and then assayed for secreted Gaussia luciferase. (D) Released infectivity measurements of the media collected at 8, 24, 48, 72, and 96 h for each NS4A TM mutant. The media assayed for replication in panel C were used to infect naive cells, and then fresh media were assayed 48 h after infection for secreted luciferase. Each cell culture and β-galactosidase experiment was performed in at least triplicate, and error bars represent the standard deviation (cell culture) or range (β-galactosidase).

We therefore tested the effects of the NS4A A15S adaptive mutation in our assay systems. Because this adaptive mutation was associated with increased levels of cell culture replication and virus production in nonreplicative strains, we introduced the NS4A A15S mutation into the NS4A G8A and A14L mutants that exhibit defects in both virus production and homotypic interaction, as well as into the NS4A A6L mutant that has a defect in virus production but normal homotypic interaction. Not surprisingly, the NS4A A15S single mutant showed no cell culture or GALLEX defects and exhibited a slight increase in homotypic interaction (see Fig. S7 in the supplemental material). Interestingly, NS4A A15S suppressed the defects in homotypic interaction of the G8A and A14L mutants in the GALLEX assay (Fig. 5B; see also controls in Fig. S8 in the supplemental material). Furthermore, NS4A A15S suppressed the defects in infectious virus production of NS4A A6L, G8A, and A14L mutants and moderately improved cell culture replication levels (Fig. 5C and D). Taken together, these forward genetic data further support the idea of a functional role for the homotypic interaction of the NS4A TM domain.

DISCUSSION

Our hypothesis, that NS4A TM domains have a propensity to oligomerize, is strongly supported by experimental evidence for dimerization in the GALLEX assay system (Fig. 1), by reverse genetic analyses indicating that NS4A TM oligomerization is important for HCV RNA replication and virus particle assembly (Fig. 2), by computational modeling that predicts a right-handed dimer structure with functionally important residues at the dimer interface (Fig. 3), and by identification of a cell culture-adaptive mutation that stabilizes NS4A TM dimer formation (Fig. 5). We propose that NS4A interacts with itself, most likely as a dimer, through interaction motifs within the TM domain. While a dimer is the simplest case of homotypic interaction, is consistent with the lack of cooperativity seen in the GALLEX assay, and minimizes steric constraints that higher-order oligomers would likely encounter, we cannot absolutely exclude the possible occurrence of higher-order homo-oligomeric interactions in biologically relevant membranes. Taken together, our results strongly support the idea of formation of functionally important NS4A homodimers through specific TM domain interactions.

Previously, Brass et al. used NMR to show that a peptide corresponding to the N-terminal 21 amino acids of NS4A can fold into an alpha-helical structure in the presence of several membrane mimetic compounds. Not unexpectedly, the NMR structure, which was determined in 50% trifluoroethanol (TFE), aligns well with a single helix of the NS4A dimer predicted from the all-atom CHI simulation (8). However, interpeptide contacts were not reported in the NMR structure, likely because TFE is an organic solvent that does not closely mimic the structure of a lipid bilayer. The association of TM alpha helices can be strongly affected by the chemical properties of surrounding lipids, solvents, and detergents (7982). One advantage of the GALLEX system is that a biological membrane better approximates the complex lipid bilayer environment of the ER than organic solvents or detergent micelles do.

Yang et al. recently detected small quantities of p14, a putative homodimer of NS4A, in genotype 1b replicon-bearing cells (83). The p14 form of NS4A was apparent only in the presence of ACH-806, an inhibitor of NS3-NS4A interaction (84), or when NS4A was overexpressed in the absence of NS3. These results suggest that p14 formation likely involves interactions with the central cofactor peptide rather than the NS4A TM domain. Furthermore, p14 was disrupted by 8 M urea but stable with respect to boiling in Laemmli sample buffer, which is uncharacteristic of a TM interaction (85, 86). Thus, p14 may represent an aggregated form of NS4A. While the functional relevance of p14 remains unclear, the stability of the NS4A TM dimer characterized in this study strongly correlates with HCV replication and virus assembly.

An interesting ramification of an NS4A dimer is the effect that it might have on the NS3 protease/helicase it anchors into the membrane, which again differentiates it from p14. The NS3 helicase domain has been crystallized as a monomer with and without RNA and other ATP analogs; the only exception is a cocrystal with a 16-mer single-stranded DNA long enough for two binding sites (29, 33, 87). Several biochemical studies on NS3 have hinted at either physical or functional oligomerization, although it is clear that the minimum functional unit is a monomer (8891). The idea of functional oligomerization of NS3-4A units is appealing because NS3 exhibits a relatively low level of processivity for unwinding duplex RNA (92). NS4A dimerization could provide a way to increase the number of neighboring NS3 molecules and thereby enhance RNA unwinding efficiency. Indeed, NS3 may work in conjunction with NS4A to form a stable NS3-4A dimer and NS3-4A may have evolved the ability to pack favorably in a dimeric configuration in order to efficiently unwind HCV RNA.

An NS4A dimer would bring NS3 molecules into very close contact because there is only a small two- or three-amino-acid linker between the TM domain and the NS3 cofactor region in NS4A. Moreover, the α0 helix of the NS3 protease domain fastens NS3 to the membrane in a constrained configuration (8). To provide evidence that the NS3 protein could exist in a stable and sterically favorable configuration upon NS4A TM dimerization, we modeled the putative NS3 protease-4A dimer with the constraints from the α0 helix of the protease domain and our computationally predicted NS4A TM domain dimer (Fig. 6A). This model predicts that the protease domain is anchored tightly against the membrane and is free to rotate only in the plane parallel to the membrane surface. Previous structural and biochemical work on NS3 from HCV, dengue virus, and Murray Valley encephalitis virus indicates that the ∼10-amino-acid linker region between the protease and helicase domains can accommodate a rotation of up to 180° between domains (9395). This flexibility is sufficient for placement of adjacent NS3 helicase domains and would allow both domains to orient themselves above the membrane (Fig. 6B). Since NS4A stabilizes NS3 and activates its enzyme activities (6), we predict that NS4A dimerization may lead to dimerization of NS3-4A. However, we cannot rule out the possibility that NS4A dimerization occurs independently of an interaction with NS3 (i.e., between one molecule of NS3-4A and one molecule of NS4A or between two NS4A molecules).

FIG 6.

FIG 6

Model of the putative NS3-4A dimer in the membrane. The NS4A dimer generated by CHI was modeled in a homogenous membrane of POPC. The NS3 protease domain (blue) was attached to each NS4A TM domain (yellow) and modeled onto the membrane with the structural constraints imposed by the α0 helix. Due to structural constraints from the POPC membrane, NS4A dimer, and α0 helix, the NS3 protease domains would have only one plane of rotation parallel to the surface of the lipid membrane. (A) Side view of the NS3-4A model in a POPC membrane. Serine protease active site residues are shown in red. (B) Top view of the NS3-4A model in a POPC membrane. A surface representation of the NS3 helicase domain is shown with a flexible linker that is approximately 8 to 10 amino acids in length. The approximate path of RNA through the helicase is shown.

In addition to NS3-4A, oligomerization has been reported for all other HCV NS proteins, including p7 (96, 97), NS2 (27, 98), NS4B (99, 100), NS5A (31, 32, 101), and NS5B (102, 103). NS4A dimer formation might be required in order to allow NS3-4A to make contacts with other oligomeric viral protein complexes during replication or virus particle assembly. In fact, our cell culture replication and infectivity data highlight a few positions—L5, A6, and V9—that do not appear to be part of the NS4A dimer interface and that may be important for additional packing interactions with TM domains of the other NS proteins. One future goal is to establish whether the NS4A monomer-dimer equilibrium shifts between the stages of replication and viral particle assembly or if NS4A is a stable dimer throughout the viral life cycle.

Several systems have been developed to study the complete life cycle of HCV in cell culture, including functional cDNA clones for HCV genotypes 1a (strains H77 and TN), 1b (strain NC1), 2a (strains JFH-1, JFH-2, and J6), and 2b (strain J8) (77, 78, 104109). With the exception of strain JFH-1, most HCV isolates require adaptive mutations for efficient replication in cell culture. Li et al. (77) recently identified three key replication-enhancing mutations during cell culture adaptation of genotype 2a strain J6. Notably, these adaptive mutations led to high levels of replication and infectious virus production and could be used to adapt genetically distinct genotype 2b (strain J8) and genotype 1a (strain TN) isolates (77, 78). Of particular interest for our study was the identification of the adaptive mutation NS4A A15S (residue A1672 in HCV strain H77), one of the three amino acid positions we define as the core of the NS4A dimer. Previous work on the GxxxG motif revealed that glycine-to-serine substitutions have a higher propensity to form dimers than glycine-to-alanine substitutions in the context of the GpA TM domain (39). In addition, serines have been shown to help tightly pack two helical TM domains as evidenced by the serine zipper motif (110). Based on these considerations, we hypothesized that NS4A A15S increases the dimerization affinity of the NS4A TM domain, leading to higher levels of cell culture replication and assembly. To that end, we discovered that NS4A A15S caused a subtle increase in GALLEX dimerization relative to WT NS4A (see Fig. S7 in the supplemental material), rescued GALLEX defects of two NS4A mutants—G8A and A14L (Fig. 5B)—and rescued cell culture defects of three NS4A mutants—A6L, G8A, and A14L (Fig. 5C and D). Although our NS4A dimer model predicts that positions 6, 8, and 14 reside outside the dimer core, each position is still expected to provide an energetic contribution to the overall stability of the NS4A dimer (Fig. 3A). Thus, NS4A A15S may rescue virus replication and assembly by strengthening the NS4A TM dimer.

While the consequences of stronger NS4A dimer formation need further study, it is important to note that WT J6 and TN genomes are infectious in chimpanzee liver but unable to replicate in the Huh-7 cultured human hepatoma cell line (111, 112). Thus, the three cell culture-adaptive mutations identified by Li et al. (77, 78), including NS4A A15S, may influence critical virus-host interactions. Given that NS3-4A cleaves the MAVS antiviral signaling molecule at the ER-mitochondrion interface (113), one intriguing possibility is that the stability of the NS4A dimer may influence trafficking of NS3-4A to this compartment.

Interestingly, a new computational tool was successfully used to design peptides that target and disrupt GxxxG-mediated interactions between αIIb-/αv- integrins and the β3- integrin (114). The sequence of the NS4A TM domain is very well conserved across genotypes and could potentially be targeted by these “peptide interceptors” for future therapies with broad effect (115). In particular, our results suggest that the conserved “GGVLA” sequence in the NS4A TM domain may be an optimal target for this strategy.

Our report presents the first evidence of homodimerization between NS4A TM domains, which we show to be essential for HCV replication and virus particle assembly. Conceptual understanding of the quaternary structure within the HCV replication complex has been somewhat overlooked since the advent of an infectious HCV cell culture system. This inattention is unfortunate because so little is known about how each piece of the replication complex interacts, and, to date, attempts at reconstitution of the HCV replication complex from its individual components or exogenous RNA replication from isolated crude replicase extracts have been unsuccessful. The evidence for an NS4A TM dimer strongly suggests that more attention should be given to understanding how the TM domains interact during the HCV virus life cycle.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

We thank S. Somarowthu for help with the computational dimer model and F. Yang for help with the cell culture experiments.

This work was supported by U.S. Public Health Service grants AI089826 (to B.D.L. and A.M.P.) from the National Institute of Allergy and Infectious Diseases and GM073857 (to D.M.E.) from the National Institute of General Medicine. A.M.P. is an Investigator of the Howard Hughes Medical Institute.

Footnotes

Published ahead of print 30 October 2013

Supplemental material for this article may be found at http://dx.doi.org/10.1128/JVI.02052-13.

REFERENCES

  • 1.Lindenbach BD, Murray CL, Thiel HJ, Rice CM. 2013. Flaviviridae, p 712–746 In Knipe DM, Howley PM. (ed), Fields virology, 6th ed, vol 1 Lippincott Williams & Wilkins, Philadelphia, PA [Google Scholar]
  • 2.Simmonds P, Bukh J, Combet C, Deleage G, Enomoto N, Feinstone S, Halfon P, Inchauspe G, Kuiken C, Maertens G, Mizokami M, Murphy DG, Okamoto H, Pawlotsky JM, Penin F, Sablon E, Shin IT, Stuyver LJ, Thiel HJ, Viazov S, Weiner AJ, Widell A. 2005. Consensus proposals for a unified system of nomenclature of hepatitis C virus genotypes. Hepatology 42:962–973. 10.1002/hep.20819 [DOI] [PubMed] [Google Scholar]
  • 3.Nakano T, Lau GM, Lau GM, Sugiyama M, Mizokami M. 2012. An updated analysis of hepatitis C virus genotypes and subtypes based on the complete coding region. Liver Int. 32:339–345. 10.1111/j.1478-3231.2011.02684.x [DOI] [PubMed] [Google Scholar]
  • 4.Bartenschlager R, Frese M, Pietschmann T. 2004. Novel insights into hepatitis C virus replication and persistence. Adv. Virus Res. 63:71–180. 10.1016/S0065-3527(04)63002-8 [DOI] [PubMed] [Google Scholar]
  • 5.Tanji Y, Hijikata M, Satoh S, Kaneko T, Shimotohno K. 1995. Hepatitis C virus-encoded nonstructural protein NS4A has versatile functions in viral protein processing. J. Virol. 69:1575–1581 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Wölk B, Sansonno D, Kräusslich HG, Dammacco F, Rice CM, Blum HE, Moradpour D. 2000. Subcellular localization, stability, and trans-cleavage competence of the hepatitis C virus NS3-NS4A complex expressed in tetracycline-regulated cell lines. J. Virol. 74:2293–2304. 10.1128/JVI.74.5.2293-2304.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Gosert R, Jendrsczok W, Berke JM, Brass V, Blum HE, Moradpour D. 2005. Characterization of nonstructural protein membrane anchor deletion mutants expressed in the context of the hepatitis C virus polyprotein. J. Virol. 79:7911–7917. 10.1128/JVI.79.12.7911-7917.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Brass V, Berke JM, Montserret R, Blum HE, Penin F, Moradpour D. 2008. Structural determinants for membrane association and dynamic organization of the hepatitis C virus NS3-4A complex. Proc. Natl. Acad. Sci. U. S. A. 105:14545–14550. 10.1073/pnas.0807298105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Failla C, Tomei L, De Francesco R. 1994. Both NS3 and NS4A are required for proteolytic processing of hepatitis C virus nonstructural proteins. J. Virol. 68:3753–3760 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Lin C, Thomson JA, Rice CM. 1995. A central region in the hepatitis C virus NS4A protein allows formation of an active NS3-NS4A serine proteinase complex in vivo and in vitro. J. Virol. 69:4373–4380 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Kim JL, Morgenstern KA, Lin C, Fox T, Dwyer MD, Landro JA, Chambers SP, Markland W, Lepre CA, O'Malley ET, Harbeson SL, Rice CM, Murcko MA, Caron PR, Thomson JA. 1996. Crystal structure of the hepatitis C virus NS3 protease domain complexed with a synthetic NS4A cofactor peptide. Cell 87:343–355. 10.1016/S0092-8674(00)81351-3 [DOI] [PubMed] [Google Scholar]
  • 12.Kaneko T, Tanji Y, Satoh S, Hijikata M, Asabe S, Kimura K, Shimotohno K. 1994. Production of two phosphoproteins from the NS5A region of the hepatitis C viral genome. Biochem. Biophys. Res. Commun. 205:320–326. 10.1006/bbrc.1994.2667 [DOI] [PubMed] [Google Scholar]
  • 13.Asabe SI, Tanji Y, Satoh S, Kaneko T, Kimura K, Shimotohno K. 1997. The N-terminal region of hepatitis C virus-encoded NS5A is important for NS4A-dependent phosphorylation. J. Virol. 71:790–796 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Lindenbach BD, Prágai BM, Montserret R, Beran RK, Pyle AM, Penin F, Rice CM. 2007. The C terminus of hepatitis C virus NS4A encodes an electrostatic switch that regulates NS5A hyperphosphorylation and viral replication. J. Virol. 81:8905–8918. 10.1128/JVI.00937-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Phan T, Kohlway A, Dimberu P, Pyle AM, Lindenbach BD. 2011. The acidic domain of hepatitis C virus NS4A contributes to RNA replication and virus particle assembly. J. Virol. 85:1193–1204. 10.1128/JVI.01889-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lin C, Wu JW, Hsiao K, Su MS. 1997. The hepatitis C virus NS4A protein: interactions with the NS4B and NS5A proteins. J. Virol. 71:6465–6471 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Flajolet M, Rotondo G, Daviet L, Bergametti F, Inchauspe G, Tiollais P, Transy C, Legrain P. 2000. A genomic approach of the hepatitis C virus generates a protein interaction map. Gene 242:369–379. 10.1016/S0378-1119(99)00511-9 [DOI] [PubMed] [Google Scholar]
  • 18.Stapleford KA, Lindenbach BD. 2011. Hepatitis C virus NS2 coordinates virus particle assembly through physical interactions with the E1-E2 glycoprotein and NS3-NS4A enzyme complexes. J. Virol. 85:1706–1717. 10.1128/JVI.02268-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ishido S, Fujita T, Hotta H. 1998. Complex formation of NS5B with NS3 and NS4A proteins of hepatitis C virus. Biochem. Biophys. Res. Commun. 244:35–40. 10.1006/bbrc.1998.8202 [DOI] [PubMed] [Google Scholar]
  • 20.Florese RH, Nagano-Fujii M, Iwanaga Y, Hidajat R, Hotta H. 2002. Inhibition of protein synthesis by the nonstructural proteins NS4A and NS4B of hepatitis C virus. Virus Res. 90:119–131. 10.1016/S0168-1702(02)00146-6 [DOI] [PubMed] [Google Scholar]
  • 21.Kato J, Kato N, Yoshida H, Ono-Nita SK, Shiratori Y, Omata M. 2002. Hepatitis C virus NS4A and NS4B proteins suppress translation in vivo. J. Med. Virol. 66:187–199. 10.1002/jmv.2129 [DOI] [PubMed] [Google Scholar]
  • 22.Kou YH, Chou SM, Wang YM, Chang YT, Huang SY, Jung MY, Huang YH, Chen MR, Chang MF, Chang SC. 2006. Hepatitis C virus NS4A inhibits cap-dependent and the viral IRES-mediated translation through interacting with eukaryotic elongation factor 1A. J. Biomed. Sci. 13:861–874. 10.1007/s11373-006-9104-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Li K, Foy E, Ferreon JC, Nakamura M, Ferreon AC, Ikeda M, Ray SC, Gale M, Jr, Lemon SM. 2005. Immune evasion by hepatitis C virus NS3/4A protease-mediated cleavage of the Toll-like receptor 3 adaptor protein TRIF. Proc. Natl. Acad. Sci. U. S. A. 102:2992–2997. 10.1073/pnas.0408824102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Meylan E, Curran J, Hofmann K, Moradpour D, Binder M, Bartenschlager R, Tschopp J. 2005. Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus. Nature 437:1167–1172. 10.1038/nature04193 [DOI] [PubMed] [Google Scholar]
  • 25.Saito T, Gale M., Jr 2008. Regulation of innate immunity against hepatitis C virus infection. Hepatol. Res. 38:115–122 [DOI] [PubMed] [Google Scholar]
  • 26.Hara H, Aizaki H, Matsuda M, Shinkai-Ouchi F, Inoue Y, Murakami K, Shoji I, Kawakami H, Matsuura Y, Lai MM, Miyamura T, Wakita T, Suzuki T. 2009. Involvement of creatine kinase B in hepatitis C virus genome replication through interaction with the viral NS4A protein. J. Virol. 83:5137–5147. 10.1128/JVI.02179-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Dimitrova M, Imbert I, Kieny MP, Schuster C. 2003. Protein-protein interactions between hepatitis C virus nonstructural proteins. J. Virol. 77:5401–5414. 10.1128/JVI.77.9.5401-5414.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.de Chassey B, Navratil V, Tafforeau L, Hiet MS, Aublin-Gex A, Agaugue S, Meiffren G, Pradezynski F, Faria BF, Chantier T, Le Breton M, Pellet J, Davoust N, Mangeot PE, Chaboud A, Penin F, Jacob Y, Vidalain PO, Vidal M, Andre P, Rabourdin-Combe C, Lotteau V. 2008. Hepatitis C virus infection protein network. Mol. Syst. Biol. 4:230. 10.1038/msb.2008.66 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Yao N, Hesson T, Cable M, Hong Z, Kwong AD, Le HV, Weber PC. 1997. Structure of the hepatitis C virus RNA helicase domain. Nat. Struct. Biol. 4:463–467. 10.1038/nsb0697-463 [DOI] [PubMed] [Google Scholar]
  • 30.Lesburg CA, Cable MB, Ferrari E, Hong Z, Mannarino AF, Weber PC. 1999. Crystal structure of the RNA-dependent RNA polymerase from hepatitis C virus reveals a fully encircled active site. Nat. Struct. Biol. 6:937–943. 10.1038/13305 [DOI] [PubMed] [Google Scholar]
  • 31.Tellinghuisen TL, Marcotrigiano J, Rice CM. 2005. Structure of the zinc-binding domain of an essential component of the hepatitis C virus replicase. Nature 435:374–379. 10.1038/nature03580 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Love RA, Brodsky O, Hickey MJ, Wells PA, Cronin CN. 2009. Crystal structure of a novel dimeric form of NS5A domain I protein from hepatitis C virus. J. Virol. 83:4395–4403. 10.1128/JVI.02352-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Appleby TC, Anderson R, Fedorova O, Pyle AM, Wang R, Liu X, Brendza KM, Somoza JR. 2011. Visualizing ATP-dependent RNA translocation by the NS3 helicase from HCV. J. Mol. Biol. 405:1139–1153. 10.1016/j.jmb.2010.11.034 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Egger D, Wölk B, Gosert R, Bianchi L, Blum HE, Moradpour D, Bienz K. 2002. Expression of hepatitis C virus proteins induces distinct membrane alterations including a candidate viral replication complex. J. Virol. 76:5974–5984. 10.1128/JVI.76.12.5974-5984.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Gosert R, Egger D, Lohmann V, Bartenschlager R, Blum HE, Bienz K, Moradpour D. 2003. Identification of the hepatitis C virus RNA replication complex in Huh-7 cells harboring subgenomic replicons. J. Virol. 77:5487–5492. 10.1128/JVI.77.9.5487-5492.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Quinkert D, Bartenschlager R, Lohmann V. 2005. Quantitative analysis of the hepatitis C virus replication complex. J. Virol. 79:13594–13605. 10.1128/JVI.79.21.13594-13605.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Brass V, Gouttenoire J, Wahl A, Pal Z, Blum HE, Penin F, Moradpour D. 2010. Hepatitis C virus RNA replication requires a conserved structural motif within the transmembrane domain of the NS5B RNA-dependent RNA polymerase. J. Virol. 84:11580–11584. 10.1128/JVI.01519-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Schneider D, Engelman DM. 2003. GALLEX, a measurement of heterologous association of transmembrane helices in a biological membrane. J. Biol. Chem. 278:3105–3111. 10.1074/jbc.M206287200 [DOI] [PubMed] [Google Scholar]
  • 39.Schneider D, Engelman DM. 2004. Motifs of two small residues can assist but are not sufficient to mediate transmembrane helix interactions. J. Mol. Biol. 343:799–804. 10.1016/j.jmb.2004.08.083 [DOI] [PubMed] [Google Scholar]
  • 40.Finger C, Volkmer T, Prodohl A, Otzen DE, Engelman DM, Schneider D. 2006. The stability of transmembrane helix interactions measured in a biological membrane. J. Mol. Biol. 358:1221–1228. 10.1016/j.jmb.2006.02.065 [DOI] [PubMed] [Google Scholar]
  • 41.Dmitrova M, Younes-Cauet G, Oertel-Buchheit P, Porte D, Schnarr M, Granger-Schnarr M. 1998. A new LexA-based genetic system for monitoring and analyzing protein heterodimerization in Escherichia coli. Mol. Gen. Genet. 257:205–212. 10.1007/s004380050640 [DOI] [PubMed] [Google Scholar]
  • 42.Porte D, Oertel-Buchheit P, Granger-Schnarr M, Schnarr M. 1995. Fos leucine zipper variants with increased association capacity. J. Biol. Chem. 270:22721–22730. 10.1074/jbc.270.39.22721 [DOI] [PubMed] [Google Scholar]
  • 43.Russ WP, Engelman DM. 1999. TOXCAT: a measure of transmembrane helix association in a biological membrane. Proc. Natl. Acad. Sci. U. S. A. 96:863–868. 10.1073/pnas.96.3.863 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Kolmar H, Hennecke F, Gotze K, Janzer B, Vogt B, Mayer F, Fritz HJ. 1995. Membrane insertion of the bacterial signal transduction protein ToxR and requirements of transcription activation studied by modular replacement of different protein substructures. EMBO J. 14:3895–3904 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Ottemann KM, Mekalanos JJ. 1995. Analysis of Vibrio cholerae ToxR function by construction of novel fusion proteins. Mol. Microbiol. 15:719–731 [DOI] [PubMed] [Google Scholar]
  • 46.Langosch D, Brosig B, Kolmar H, Fritz HJ. 1996. Dimerisation of the glycophorin A transmembrane segment in membranes probed with the ToxR transcription activator. J. Mol. Biol. 263:525–530. 10.1006/jmbi.1996.0595 [DOI] [PubMed] [Google Scholar]
  • 47.Ottemann KM, Mekalanos JJ. 1996. The ToxR protein of Vibrio cholerae forms homodimers and heterodimers. J. Bacteriol. 178:156–162 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Joce C, Wiener AA, Yin H. 2011. Multi-Tox: application of the ToxR-transcriptional reporter assay to the study of multi-pass protein transmembrane domain oligomerization. Biochim. Biophys. Acta 1808:2948–2953. 10.1016/j.bbamem.2011.07.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Furthmayr H, Marchesi VT. 1976. Subunit structure of human erythrocyte glycophorin A. Biochemistry 15:1137–1144. 10.1021/bi00650a028 [DOI] [PubMed] [Google Scholar]
  • 50.Lemmon MA, Flanagan JM, Treutlein HR, Zhang J, Engelman DM. 1992. Sequence specificity in the dimerization of transmembrane alpha-helices. Biochemistry 31:12719–12725. 10.1021/bi00166a002 [DOI] [PubMed] [Google Scholar]
  • 51.Fleming KG, Ackerman AL, Engelman DM. 1997. The effect of point mutations on the free energy of transmembrane alpha-helix dimerization. J. Mol. Biol. 272:266–275. 10.1006/jmbi.1997.1236 [DOI] [PubMed] [Google Scholar]
  • 52.MacKenzie KR, Prestegard JH, Engelman DM. 1997. A transmembrane helix dimer: structure and implications. Science 276:131–133. 10.1126/science.276.5309.131 [DOI] [PubMed] [Google Scholar]
  • 53.Anbazhagan V, Schneider D. 2010. The membrane environment modulates self-association of the human GpA TM domain—implications for membrane protein folding and transmembrane signaling. Biochim. Biophys. Acta 1798:1899–1907. 10.1016/j.bbamem.2010.06.027 [DOI] [PubMed] [Google Scholar]
  • 54.Brosig B, Langosch D. 1998. The dimerization motif of the glycophorin A transmembrane segment in membranes: importance of glycine residues. Protein Sci. 7:1052–1056 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Russ WP, Engelman DM. 2000. The GxxxG motif: a framework for transmembrane helix-helix association. J. Mol. Biol. 296:911–919. 10.1006/jmbi.1999.3489 [DOI] [PubMed] [Google Scholar]
  • 56.Kleiger G, Grothe R, Mallick P, Eisenberg D. 2002. GXXXG and AXXXA: common alpha-helical interaction motifs in proteins, particularly in extremophiles. Biochemistry 41:5990–5997. 10.1021/bi0200763 [DOI] [PubMed] [Google Scholar]
  • 57.Melnyk RA, Kim S, Curran AR, Engelman DM, Bowie JU, Deber CM. 2004. The affinity of GXXXG motifs in transmembrane helix-helix interactions is modulated by long-range communication. J. Biol. Chem. 279:16591–16597. 10.1074/jbc.M313936200 [DOI] [PubMed] [Google Scholar]
  • 58.Senes A, Gerstein M, Engelman DM. 2000. Statistical analysis of amino acid patterns in transmembrane helices: the GxxxG motif occurs frequently and in association with beta-branched residues at neighboring positions. J. Mol. Biol. 296:921–936. 10.1006/jmbi.1999.3488 [DOI] [PubMed] [Google Scholar]
  • 59.Mendrola JM, Berger MB, King MC, Lemmon MA. 2002. The single transmembrane domains of ErbB receptors self-associate in cell membranes. J. Biol. Chem. 277:4704–4712. 10.1074/jbc.M108681200 [DOI] [PubMed] [Google Scholar]
  • 60.Senes A, Ubarretxena-Belandia I, Engelman DM. 2001. The Calpha—H···O hydrogen bond: a determinant of stability and specificity in transmembrane helix interactions. Proc. Natl. Acad. Sci. U. S. A. 98:9056–9061. 10.1073/pnas.161280798 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Okonechnikov K, Golosova O, Fursov M; UGENE team 2012. Unipro UGENE: a unified bioinformatics toolkit. Bioinformatics 28:1166–1167. 10.1093/bioinformatics/bts091 [DOI] [PubMed] [Google Scholar]
  • 62.Zhang X, Bremer H. 1995. Control of the Escherichia coli rrnB P1 promoter strength by ppGpp. J. Biol. Chem. 270:11181–11189. 10.1074/jbc.270.19.11181 [DOI] [PubMed] [Google Scholar]
  • 63.Russel M, Model P. 1982. Filamentous phage pre-coat is an integral membrane protein: analysis by a new method of membrane preparation. Cell 28:177–184. 10.1016/0092-8674(82)90387-7 [DOI] [PubMed] [Google Scholar]
  • 64.Finger C, Escher C, Schneider D. 2009. The single transmembrane domains of human receptor tyrosine kinases encode self-interactions. Sci. Signal. 2:ra56. 10.1126/scisignal.2000547 [DOI] [PubMed] [Google Scholar]
  • 65.Adams PD, Arkin IT, Engelman DM, Brunger AT. 1995. Computational searching and mutagenesis suggest a structure for the pentameric transmembrane domain of phospholamban. Nat. Struct. Biol. 2:154–162. 10.1038/nsb0295-154 [DOI] [PubMed] [Google Scholar]
  • 66.Adams PD, Engelman DM, Brunger AT. 1996. Improved prediction for the structure of the dimeric transmembrane domain of glycophorin A obtained through global searching. Proteins 26:257–261. 10.1002/(SICI)1097-0134(199611)26:3<257::AID-PROT2>3.0.CO;2-B [DOI] [PubMed] [Google Scholar]
  • 67.Humphrey W, Dalke A, Schulten K. 1996. VMD: visual molecular dynamics. J. Mol. Graph. 14:33–38, 27–28 [DOI] [PubMed] [Google Scholar]
  • 68.Krieger E, Joo K, Lee J, Lee J, Raman S, Thompson J, Tyka M, Baker D, Karplus K. 2009. Improving physical realism, stereochemistry, and side-chain accuracy in homology modeling: four approaches that performed well in CASP8. Proteins 77(Suppl 9):114–122. 10.1002/prot.22570 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Zviling M, Kochva U, Arkin IT. 2007. How important are transmembrane helices of bitopic membrane proteins? Biochim. Biophys. Acta 1768:387–392. 10.1016/j.bbamem.2006.11.019 [DOI] [PubMed] [Google Scholar]
  • 70.Doura AK, Kobus FJ, Dubrovsky L, Hibbard E, Fleming KG. 2004. Sequence context modulates the stability of a GxxxG-mediated transmembrane helix-helix dimer. J. Mol. Biol. 341:991–998. 10.1016/j.jmb.2004.06.042 [DOI] [PubMed] [Google Scholar]
  • 71.Faham S, Yang D, Bare E, Yohannan S, Whitelegge JP, Bowie JU. 2004. Side-chain contributions to membrane protein structure and stability. J. Mol. Biol. 335:297–305. 10.1016/j.jmb.2003.10.041 [DOI] [PubMed] [Google Scholar]
  • 72.White SH, Wimley WC. 1998. Hydrophobic interactions of peptides with membrane interfaces. Biochim. Biophys. Acta 1376:339–352. 10.1016/S0304-4157(98)00021-5 [DOI] [PubMed] [Google Scholar]
  • 73.Braun P, von Heijne G. 1999. The aromatic residues Trp and Phe have different effects on the positioning of a transmembrane helix in the microsomal membrane. Biochemistry 38:9778–9782. 10.1021/bi990923a [DOI] [PubMed] [Google Scholar]
  • 74.Doura AK, Fleming KG. 2004. Complex interactions at the helix-helix interface stabilize the glycophorin A transmembrane dimer. J. Mol. Biol. 343:1487–1497. 10.1016/j.jmb.2004.09.011 [DOI] [PubMed] [Google Scholar]
  • 75.Moore DT, Berger BW, DeGrado WF. 2008. Protein-protein interactions in the membrane: sequence, structural, and biological motifs. Structure 16:991–1001. 10.1016/j.str.2008.05.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Arkin IT, Adams PD, Brunger AT, Smith SO, Engelman DM. 1997. Structural perspectives of phospholamban, a helical transmembrane pentamer. Annu. Rev. Biophys. Biomol. Struct. 26:157–179. 10.1146/annurev.biophys.26.1.157 [DOI] [PubMed] [Google Scholar]
  • 77.Li YP, Ramirez S, Gottwein JM, Scheel TK, Mikkelsen L, Purcell RH, Bukh J. 2012. Robust full-length hepatitis C virus genotype 2a and 2b infectious cultures using mutations identified by a systematic approach applicable to patient strains. Proc. Natl. Acad. Sci. U. S. A. 109:E1101–1110. 10.1073/pnas.1203829109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Li YP, Ramirez S, Jensen SB, Purcell RH, Gottwein JM, Bukh J. 2012. Highly efficient full-length hepatitis C virus genotype 1 (strain TN) infectious culture system. Proc. Natl. Acad. Sci. U. S. A. 109:19757–19762. 10.1073/pnas.1218260109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Fisher LE, Engelman DM, Sturgis JN. 1999. Detergents modulate dimerization, but not helicity, of the glycophorin A transmembrane domain. J. Mol. Biol. 293:639–651. 10.1006/jmbi.1999.3126 [DOI] [PubMed] [Google Scholar]
  • 80.Fisher LE, Engelman DM, Sturgis JN. 2003. Effect of detergents on the association of the glycophorin a transmembrane helix. Biophys. J. 85:3097–3105. 10.1016/S0006-3495(03)74728-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Mackenzie KR. 2006. Folding and stability of alpha-helical integral membrane proteins. Chem. Rev. 106:1931–1977. 10.1021/cr0404388 [DOI] [PubMed] [Google Scholar]
  • 82.Cymer F, Veerappan A, Schneider D. 2012. Transmembrane helix-helix interactions are modulated by the sequence context and by lipid bilayer properties. Biochim. Biophys. Acta 1818:963–973. 10.1016/j.bbamem.2011.07.035 [DOI] [PubMed] [Google Scholar]
  • 83.Yang W, Sun Y, Hou X, Zhao Y, Fabrycki J, Chen D, Wang X, Agarwal A, Phadke A, Deshpande M, Huang M. 29 April 2013. ACH-806, an NS4A antagonist, inhibits hepatitis C virus replication through altering the composition of viral replication complexes. Antimicrob. Agents Chemother. 10.1128/AAC.02630-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Yang W, Zhao Y, Fabrycki J, Hou X, Nie X, Sanchez A, Phadke A, Deshpande M, Agarwal A, Huang M. 2008. Selection of replicon variants resistant to ACH-806, a novel hepatitis C virus inhibitor with no cross-resistance to NS3 protease and NS5B polymerase inhibitors. Antimicrob. Agents Chemother. 52:2043–2052. 10.1128/AAC.01548-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Chen GQ, Gouaux E. 1999. Probing the folding and unfolding of wild-type and mutant forms of bacteriorhodopsin in micellar solutions: evaluation of reversible unfolding conditions. Biochemistry 38:15380–15387. 10.1021/bi9909039 [DOI] [PubMed] [Google Scholar]
  • 86.Thévenin D, Lazarova T, Roberts MF, Robinson CR. 2005. Oligomerization of the fifth transmembrane domain from the adenosine A2A receptor. Protein Sci. 14:2177–2186. 10.1110/ps.051409205 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Mackintosh SG, Lu JZ, Jordan JB, Harrison MK, Sikora B, Sharma SD, Cameron CE, Raney KD, Sakon J. 2006. Structural and biological identification of residues on the surface of NS3 helicase required for optimal replication of the hepatitis C virus. J. Biol. Chem. 281:3528–3535. 10.1074/jbc.M512100200 [DOI] [PubMed] [Google Scholar]
  • 88.Levin MK, Wang YH, Patel SS. 2004. The functional interaction of the hepatitis C virus helicase molecules is responsible for unwinding processivity. J. Biol. Chem. 279:26005–26012. 10.1074/jbc.M403257200 [DOI] [PubMed] [Google Scholar]
  • 89.Jennings TA, Mackintosh SG, Harrison MK, Sikora D, Sikora B, Dave B, Tackett AJ, Cameron CE, Raney KD. 2009. NS3 helicase from the hepatitis C virus can function as a monomer or oligomer depending on enzyme and substrate concentrations. J. Biol. Chem. 284:4806–4814. 10.1074/jbc.M805540200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Serebrov V, Beran RK, Pyle AM. 2009. Establishing a mechanistic basis for the large kinetic steps of the NS3 helicase. J. Biol. Chem. 10.1074/jbc.M805460200 284:2512–2521 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Patel SS, Donmez I. 2006. Mechanisms of helicases. J. Biol. Chem. 281:18265–18268. 10.1074/jbc.R600008200 [DOI] [PubMed] [Google Scholar]
  • 92.Pang PS, Jankowsky E, Planet PJ, Pyle AM. 2002. The hepatitis C viral NS3 protein is a processive DNA helicase with cofactor enhanced RNA unwinding. EMBO J. 21:1168–1176. 10.1093/emboj/21.5.1168 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93.Assenberg R, Mastrangelo E, Walter TS, Verma A, Milani M, Owens RJ, Stuart DI, Grimes JM, Mancini EJ. 2009. Crystal structure of a novel conformational state of the flavivirus NS3 protein: implications for polyprotein processing and viral replication. J. Virol. 83:12895–12906. 10.1128/JVI.00942-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94.Ding SC, Kohlway AS, Pyle AM. 2011. Unmasking the active helicase conformation of nonstructural protein 3 from hepatitis C virus. J. Virol. 85:4343–4353. 10.1128/JVI.02130-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Luo D, Wei N, Doan DN, Paradkar PN, Chong Y, Davidson AD, Kotaka M, Lescar J, Vasudevan SG. 2010. Flexibility between the protease and helicase domains of the dengue virus NS3 protein conferred by the linker region and its functional implications. J. Biol. Chem. 285:18817–18827. 10.1074/jbc.M109.090936 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96.Clarke D, Griffin S, Beales L, Gelais CS, Burgess S, Harris M, Rowlands D. 2006. Evidence for the formation of a heptameric ion channel complex by the hepatitis C virus p7 protein in vitro. J. Biol. Chem. 281:37057–37068. 10.1074/jbc.M602434200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97.Luik P, Chew C, Aittoniemi J, Chang J, Wentworth P, Dwek RA, Biggin PC, Vénien-Bryan C, Zitzmann N. 2009. The 3-dimensional structure of a hepatitis C virus p7 ion channel by electron microscopy. Proc. Natl. Acad. Sci. U. S. A. 106:12712–12716. 10.1073/pnas.0905966106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Lorenz IC, Marcotrigiano J, Dentzer TG, Rice CM. 2006. Structure of the catalytic domain of the hepatitis C virus NS2-3 protease. Nature 442:831–835. 10.1038/nature04975 [DOI] [PubMed] [Google Scholar]
  • 99.Gouttenoire J, Roingeard P, Penin F, Moradpour D. 2010. Amphipathic alpha-helix AH2 is a major determinant for the oligomerization of hepatitis C virus nonstructural protein 4B. J. Virol. 84:12529–12537. 10.1128/JVI.01798-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Paul D, Romero-Brey I, Gouttenoire J, Stoitsova S, Krijnse-Locker J, Moradpour D, Bartenschlager R. 2011. NS4B self-interaction through conserved C-terminal elements is required for the establishment of functional hepatitis C virus replication complexes. J. Virol. 85:6963–6976. 10.1128/JVI.00502-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101.Hwang J, Huang L, Cordek DG, Vaughan R, Reynolds SL, Kihara G, Raney KD, Kao CC, Cameron CE. 2010. Hepatitis C virus nonstructural protein 5A: biochemical characterization of a novel structural class of RNA-binding proteins. J. Virol. 84:12480–12491. 10.1128/JVI.01319-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 102.Qin W, Luo H, Nomura T, Hayashi N, Yamashita T, Murakami S. 2002. Oligomeric interaction of hepatitis C virus NS5B is critical for catalytic activity of RNA-dependent RNA polymerase. J. Biol. Chem. 277:2132–2137. 10.1074/jbc.M106880200 [DOI] [PubMed] [Google Scholar]
  • 103.Jennings TA, Chen Y, Sikora D, Harrison MK, Sikora B, Huang L, Jankowsky E, Fairman ME, Cameron CE, Raney KD. 2008. RNA unwinding activity of the hepatitis C virus NS3 helicase is modulated by the NS5B polymerase. Biochemistry 47:1126–1135. 10.1021/bi701048a [DOI] [PubMed] [Google Scholar]
  • 104.Wakita T, Pietschmann T, Kato T, Date T, Miyamoto M, Zhao Z, Murthy K, Habermann A, Krausslich HG, Mizokami M, Bartenschlager R, Liang TJ. 2005. Production of infectious hepatitis C virus in tissue culture from a cloned viral genome. Nat. Med. 11:791–796. 10.1038/nm1268 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 105.Zhong J, Gastaminza P, Cheng G, Kapadia S, Kato T, Burton DR, Wieland SF, Uprichard SL, Wakita T, Chisari FV. 2005. Robust hepatitis C virus infection in vitro. Proc. Natl. Acad. Sci. U. S. A. 102:9294–9299. 10.1073/pnas.0503596102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 106.Yi M, Villanueva RA, Thomas DL, Wakita T, Lemon SM. 2006. Production of infectious genotype 1a hepatitis C virus (Hutchinson strain) in cultured human hepatoma cells. Proc. Natl. Acad. Sci. U. S. A. 103:2310–2315. 10.1073/pnas.0510727103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 107.Lindenbach BD, Evans MJ, Syder AJ, Wolk B, Tellinghuisen TL, Liu CC, Maruyama T, Hynes RO, Burton DR, McKeating JA, Rice CM. 2005. Complete replication of hepatitis C virus in cell culture. Science 309:623–626. 10.1126/science.1114016 [DOI] [PubMed] [Google Scholar]
  • 108.Date T, Kato T, Kato J, Takahashi H, Morikawa K, Akazawa D, Murayama A, Tanaka-Kaneko K, Sata T, Tanaka Y, Mizokami M, Wakita T. 2012. Novel cell culture-adapted genotype 2a hepatitis C virus infectious clone. J. Virol. 86:10805–10820. 10.1128/JVI.07235-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 109.Date T, Morikawa K, Tanaka Y, Tanaka-Kaneko K, Sata T, Mizokami M, Wakita T. 2012. Replication and infectivity of a novel genotype 1b hepatitis C virus clone. Microb. Immunol. 56:308–317. 10.1111/j.1348-0421.2012.00437.x [DOI] [PubMed] [Google Scholar]
  • 110.Adamian L, Liang J. 2002. Interhelical hydrogen bonds and spatial motifs in membrane proteins: polar clamps and serine zippers. Proteins 47:209–218. 10.1002/prot.10071 [DOI] [PubMed] [Google Scholar]
  • 111.Sakai A, Takikawa S, Thimme R, Meunier JC, Spangenberg HC, Govindarajan S, Farci P, Emerson SU, Chisari FV, Purcell RH, Bukh J. 2007. In vivo study of the HC-TN strain of hepatitis C virus recovered from a patient with fulminant hepatitis: RNA transcripts of a molecular clone (pHC-TN) are infectious in chimpanzees but not in Huh7.5 cells. J. Virol. 81:7208–7219. 10.1128/JVI.01774-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 112.Yanagi M, Purcell RH, Emerson SU, Bukh J. 1999. Hepatitis C virus: an infectious molecular clone of a second major genotype (2a) and lack of viability of intertypic 1a and 2a chimeras. Virology 262:250–263. 10.1006/viro.1999.9889 [DOI] [PubMed] [Google Scholar]
  • 113.Horner SM, Park HS, Gale M., Jr 2012. Control of innate immune signaling and membrane targeting by the hepatitis C virus NS3/4A protease are governed by the NS3 helix alpha0. J. Virol. 86:3112–3120. 10.1128/JVI.06727-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 114.Yin H, Slusky JS, Berger BW, Walters RS, Vilaire G, Litvinov RI, Lear JD, Caputo GA, Bennett JS, DeGrado WF. 2007. Computational design of peptides that target transmembrane helices. Science 315:1817–1822. 10.1126/science.1136782 [DOI] [PubMed] [Google Scholar]
  • 115.Najumudeen AK. 2010. Receptor tyrosine kinase transmembrane domain interactions: potential target for “interceptor” therapy. Sci. Signal. 3:jc6. 10.1126/scisignal.3138jc6 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES