Molecular phylogenetics of New Caledonian Diospyros (Ebenaceae) using plastid and nuclear markers

Highlights

• •Analyses showed resolution among 1/3 of the Diospyros species form NC clade III.
• •Some morphological distinct species could not be discriminated with the markers used.
• •Diospyros arrived relative recently (5–20 mya) in New Caledonia.
• •Chromosome counts confirmed the investigated species to be diploid.
• •Genome sizes varied nearly fourfold among species examined.

Abstract

To clarify phylogenetic relationships among New Caledonian species of Diospyros, sequences of four plastid markers (atpB, rbcL, trnK–matK and trnS–trnG) and two low-copy nuclear markers (ncpGS and PHYA) were analysed. New Caledonian Diospyros species fall into three clades, two of which have only a few members (1 or 5 species); the third has 21 closely related species for which relationships among species have been mostly unresolved in a previous study. Although species of the third group (NC clade III) are morphologically distinct and largely occupy different habitats, they exhibit little molecular variability. Diospyros vieillardii is sister to the rest of the NC clade III, followed by D. umbrosa and D. flavocarpa, which are sister to the rest of this clade. Species from coastal habitats of western Grande Terre (D. cherrieri and D. veillonii) and some found on coralline substrates (D. calciphila and D. inexplorata) form two well-supported subgroups. The species of NC clade III have significantly larger genomes than found in diploid species of Diospyros from other parts of the world, but they all appear to be diploids. By applying a molecular clock, we infer that the ancestor of the NC clade III arrived in New Caledonia around 9 million years ago. The oldest species are around 7 million years old and the youngest ones probably much less than 1 million years.

1. Introduction

New Caledonia is an island group located in the southwestern Pacific about 1300 km east of Australia, ranging from around 19° to 23° south with an land area of ca. 19,000 km². It consists of the main island Grande Terre (ca. 16,000 km²), Iles Belep (in the north), Ile des Pins (in the south), Loyalty Islands (in the east) and several other smaller islands. The continental part of New Caledonia (mainly Grande Terre) separated from Gondwanan during late Cretaceous (ca. 80 million years ago, mya; McLoughlin, 2001). During the Palaeocene to late Eocene, this continental sliver was submerged for at least 20 million years (myr), and a thick layer of oceanic mantle accumulated (Pelletier, 2006). After Grande Terre re-emerged in the late Eocene (37 mya), this heavy-metal rich oceanic material covered most of the land. Today, around 1/3 of the main island is still covered with ultramafic substrates. Because Grande Terre was totally submerged, it is highly unlikely that lineages that were already present in this area before the split from Gondwanan could have survived locally. Current hypotheses suggest that biota present today are derived from elements/ancestors that reached New Caledonia via long distance dispersal (e.g. Morat et al., 2012; Pillon, 2012; Grandcolas et al., 2008) mainly from Australia, New Guinea and Malaysia. Hypotheses of other islands between Australia and New Caledonia having served as stepping stones or refuges for Gondwanan taxa now endemic (e.g. Amborella) have been proposed by a few authors (Ladiges and Cantrill, 2007), but there is no consensus of when they existed or how large and numerous they might have been. The New Caledonian climate is tropical to subtropical. The main island is split by a mountain range into a humid eastern portion (2000–4000 mm precipitation per year) and a dry western part (1000 mm precipitation per year) with prevailing winds and rain coming from the south east. New Caledonia is one of the 34 biodiversity hotspots (Mittermeier et al., 2004; Myers et al., 2000), and nearly 75% of the native flora is endemic (Morat et al., 2012), which is the fourth highest for an island (Lowry, 1998). Among these endemic taxa are 98 genera and three families, Amborellaceae, Oncothecaceae and Phellinaceae (Morat et al., 2012). One of the reasons hypothesised for the high level of endemism found in New Caledonia is the ultramafic substrates, which have acted as a filter for colonising species that were already pre-adapted to this special soil (Pillon et al., 2010).

Ebenaceae are pantropical and belong to the order Ericales (APG, 2009); the majority of species occur in Africa (incl. Madagascar) and the Indo-Pacific region. Duangjai et al. (2006) divided Ebenaceae into two sub families, Lissocarpoideae and Ebenoideae. Lissocarpoideae are monogeneric (Lissocarpa, 8 species in northwestern South America), and Ebenoideae include Diospyros, Euclea (18 species in Africa) and Royena (17 species in Africa). This classification of Ebenaceae in two subfamilies and four genera has been also supported by palynological data (Geeraerts et al., 2009).

In this paper, we use the circumscription of Diospyros as proposed by Duangjai et al. (2006). Diospyros is the largest genus of Ebenaceae with more than 500 species, making it also one of the largest angiosperm genera. The greatest species of diversity is in Asia and the Pacific region (∼300 species). Fruits of some species (persimmons; e.g. D. kaki, D. lotus and D. virginiana) are edible, and ebony wood (e.g. D. ebenum) is one of the most expensive timbers. Species of Diospyros are shrubs or trees that occur in most tropical and subtropical habitats, where they are often important and characteristic elements. Duangjai et al. (2009) found 11 mostly well-resolved clades within Diospyros. In New Caledonia, there are 31 described Diospyros species, of which all but one are endemic, and they belong to three clades (Duangjai et al., 2009; Fig. 4, clades II, III and XI). The first clade (clade II) contains five species from New Caledonia that are related to Australian species of Diospyros. The second clade (clade III) includes species from Hawai‘i, Indian Ocean islands and 24 taxa from New Caledonia, within which the species from New Caledonia form a sublcade, here termed NC clade III. Although Duangjai et al. (2009) analysed more than 8000 base pairs of plastid DNA, low variability and little resolution was found among these endemic New Caledonian species. The third clade (clade XI), consisting of taxa from Asia, America, Pacific Islands and New Caledonia, includes two Diospyros species from New Caledonia, one endemic and the other found throughout the southern Pacific. These two species are not sister species, accounting for two more colonisations of New Caledonia (i.e. four in total). Similar, multiple colonisation events are also found among other organisms in New Caledonia (e.g. Murienne et al., 2005). Diospyros is observed in all types of New Caledonian vegetation except mangrove; the species range from sea level up to ca. 1250 m (New Caledonia’s highest point is 1628 m). There are several micro-endemics restricted to just a small area (White, 1992). Most New Caledonian Diospyros species from clade III are morphologically clearly defined and restricted by edaphic factors and occur on just one substrate type. For example, D. labillardierei (Fig. 1D) is distinctive with its long narrow leaves and Salix-like habit; it is a rheophyte on non-ultramafic substrates. Diospyros veillonii (Fig. 1F) is a remarkable species with coralloid inflorescence axes (unique among New Caledonian Diospyros) and large leaves, but is known from only a single locality in dry forest on black clay soil. Other species have broader distributions and ecologies, such as D. parviflora (Fig. 1J), which grows on both ultramafic and non-ultramafic substrates and is widespread throughout Grande Terre and Balabio Island in dense humid forests as well as in more open and dry vegetation. Some species can have similar ecological requirements, but are morphologically well differentiated; for example D. vieillardii (Fig. 1A) has a calyx narrower than its prune-like fruit, whereas D. glans (Fig. 1N) has a thick calyx much wider than its fruit, but both grow in maquis vegetation and co-occur at some sites.

Fig. 4.

One of 210 equally parsimonius trees of the plastid data set. Clades are named according to Duangjai et al. (2009). Bold branches have more than 70% support in all three analysis. New Caledonian taxa are coloured, red represents clade III NC.

Fig. 1.

Examples of Diospyros species from New Caledonia (A–N) and Map of New Caledonia with collection points (O). A: D. vieillardii; B: D. umbrosa; C: D. flavocarpa, D: D. labillardierei; E: D. pancheri, F: D. veillonii; G: D. minimifolia; H: D. pustulata; I: D. cherrieri; J: D. parviflora; K: D.perplexa; L: D. yaouhensis; M: D. revolutissima; N: D. glans; O: Map of New Caledonia with sampling localities. Photographs taken by: C. Chambrey (I), V. Hequet (F, K, L), J. Munzinger (A, B, C, E, G, H, J, M, N) and B. Turner (D).

For establishing phylogenetic relationships, sequences of low-copy nuclear genes are not as often used as regions from the plastid genome, often due to methodological difficulties. Low-copy genes are present in one or few copies in the genome, and primers are often highly specific for individual groups, requiring them therefore to be newly designed for each study. On the other hand, low-copy nuclear markers are normally highly informative and as they are biparentally inherited they may also help detect recent hybridization (e.g. Moody and Rieseberg, 2012). However, in a study of Hawaiian endemics in two unrelated genera, Pillon et al. (2013) found that although two low-copy nuclear loci displayed a high level of variability, they also exhibited heterozygosity, intraspecific variation, and retention of ancient alleles; allele coalescence was older than the species under study. Nonetheless, we hoped that inclusion of low-copy nuclear genes might provide additional insight into species relationships and thus included two such loci. Phytochrome A (PHYA) belongs to the gene family of the phytochromes, which has eight members across the seed plants (PHYA–PHYE in angiosperms and PHYN–PHYP in gymnosperms); PHYN/PHYA, PHYO/PHYC and PHYP/PHYBDE are orthologs, the rest being paralogs of the others (Mathews et al., 2010). Genes of this family encode photoreceptor proteins that mediate developmental responses to red and far red light. The three main paralogs (PHYA, PHYB and PHYC) are different enough to be amplified with specific primers (Zimmer and Wen, 2012). Sequences of phy genes have been used successfully across the flowering plants (e.g. Mathews et al., 2010; Nie et al., 2008; Bennett and Mathews, 2006) for phylogenetic reconstruction. The gene PHYA used in this study consists of four exons and three introns. Glutamine synthetase (GS), codes for a protein involved in nitrogen assimilation. There are two main types of GS genes, cytosolic- and chloroplast-expressed. Chloroplast-expressed glutamine synthetase (ncpGS) consists of 12 exons and 11 introns and has been shown to be a single-copy gene in plants (Emshwiller and Doyle, 1999). This combination of coding and non-coding regions has been shown to be highly informative for inferring phylogenetic trees of various groups (e.g. Oxalidaceae, Emshwiller and Doyle, 1999; Passiflora, Yockteng and Nadot, 2004; Spiraeanthemum, Pillon et al., 2009a; Codia, Pillon et al., 2009b; Achillea millefolium, Guo et al., 2012).

Beside phylogenetic relationships, the age of clades is of interest. In many cases, there are no fossils available for direct dating of a group of interest in a particular region, which is often the case for islands and is certainly true for New Caledonia (the few fossils recorded to date are older than the last emergence of the island and are not certain to be angiosperms; Salard and Avias, 1968). Rates of DNA divergence are generally consistent with a molecular clock (Zuckerkandl and Pauling, 1965), and therefore DNA data contain information about the relative ages of taxa. When substitution rates (e.g. Silvestro et al., 2011; Alba et al., 2000) or fossils belonging to defined clades (e.g. Pirie and Doyle, 2012; Magallón, 2010) are taken into consideration, the relative ages obtained can be transformed into absolute ages. Placement of fossils in the correct position in the phylogenetic tree is crucial for accurate interpretation (Forest, 2009). Some previous studies have has been published on the subject of the age of asterids (e.g. Millán-Martínez, 2010; Bell et al., 2010; Bremer et al., 2004) to which Ericales belong, and fossil Diospyros are known from some localities (mainly in India and North America), but none has been found in New Caledonia. Austrodiospyros cryptostoma (Basinger and Christophel, 1985), a fossil from Australia has many morphological similarities to D. australis of clade II (Duangjai et al., 2009). It is thus far the only fossil belonging to a clade that includes Diospyros species from New Caledonia. We treat A. cryptostoma as member of clade II in this study.

Genome sizes vary nearly 2400-fold across angiosperms (Pellicer et al., 2010). Most variation in DNA amount is caused by different amounts of non-coding, repetitive DNA, such as pseudogenes, retrotransposons, transposons and satellite repeats (Leitch, 2007; Bennett and Leitch, 2005; Parisod et al., 2009; Petrov, 2001). Genome sizes and chromosome numbers of Diospyros are within the range of those of other members of Ericales (Bennett and Leitch, 2010). Nuclear DNA amounts in Diospyros range from 0.78 pg (1C-value) in diploid D. rhodocalyx up to 4.06 pg in nonaploid D. kaki cultivars (Tamura et al., 1998). The basic chromosome number in Diospyros is 2n = 2x = 30, and most species seem to be diploid (e.g. Tamura et al., 1998; White, 1992). There are some reports of polyploid Diospyros, mostly from cultivated species (e.g. D. rhombifolia 4x, D. ebenum 6x, D. kaki 6x and 9x, D. virginiana 6x and 9x; Tamura et al., 1998). White (1992) provided chromosome counts for nine New Caledonian species of Diospyros (D. calciphila, D. fasciculosa, D. flavocarpa, D. minimifolia, D. olen, D. parviflora, D. umbrosa, D. vieillardii and D. yaouhensis), all of which are diploid.

Duangjai et al. (2009) found little sequence variation in the markers investigated among many species from NC clade III, which could indicate recent diversification. White (1992), who described most the New Caledonian Diospyros species, suspected some hybridization was taking place. The main aim of this study was to clarify relationships among New Caledonian Diospyros species, especially of those belonging to clade III (Duangjai et al., 2009). Furthermore, if we were able to find more variable than those previously studied, we wanted to elucidate potential factors underlying speciation (e.g. ecological speciation, hybrid speciation and introgression) and understand better differences in speciation rates of the clades that reached New Caledonia independently. We used low-copy nuclear markers, PHYA and ncpGS because they offered the prospect of resolving relationships within this clade and detecting possible hybrid species. We also included samples from nine additional species that were not available for the study of Duangjai et al. (2009). Moreover, we conducted dating analyses to obtain estimates of the ages for the lineages to which New Caledonian Diospyros species belong. We also present chromosome numbers and genome sizes of some additional New Caledonian species of Diospyros; we wished to examine further the hypothesis that polyploidy (perhaps involving hybridization) might have played a role in producing diversity in this comparatively species-rich clade.

2. Materials and methods

2.1. Material

Material from New Caledonian Diospyros species was collected by B. Turner (BT), J. Munzinger (JM), Yohan Pillon (YP) or Vanessa Hequet (VH). When fertile, a voucher was made with several duplicates sent to various herbaria. When sterile, one voucher per population was taken; this was compared to already existing collections in Noumea Herbarium (NOU) from the same location and referred to that species if similar. One putatively new species was detected while doing fieldwork for this project, here called D. sp. Pic N’ga. Other Ebenaceae samples are from previous studies (Duangjai et al., 2009). Outgroup taxa and a few Diospyros samples were taken from the Royal Botanic Gardens, Kew, DNA Bank (http://apps.kew.org/dnabank/homepage.html). Compared to the sampling of Duangjai et al. (2009), we added material of the following New Caledonian species: D. erudita, D. glans, D. impolita, D. inexplorata, D. margaretae, D. tireliae, D. tridentata, D. trisulca and D. veillonii (for details see Table 1). The three un-sampled species from New Caledonia (D. fastidiosa, D. nebulosa and D. neglecta) are rare and have not been seen after their description.

Table 1.

Table of accessions; showing all individuals used in this study. Sequences provided by S. Duangjai are indicated.

Taxon	Acc.-nr.	Origin	Voucher	Herbarium	atpB	rbcL	matK & trnK intron	trnS–trnG	ncpGS	PHYA
D. abyssinica (Hiern) F. White	K1672	Africa	Gilbert & Sebseke 8803	K	DQ923883	EU980646	DQ923990	EU981061
D. affinis Thwaites	DY03	Sri Lanka	Yakandawala 03	PDA	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291310
D. affinis	DY05	Sri Lanka	Yakandawala 05	PDA	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291311
D. affinis	DY18	Sri Lanka	Yakandawala 18	PDA	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291312
D. affinis	Eb179	Sri Lanka	Samuel s.n.	PDA	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291313
D. affinis	Eb180	Sri Lanka	Samuel s.n.	PDA	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291314
D. cf. affinis	S09	Sri Lanka	Samuel 09	PDA	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291315
D. andamanica (Kurz) Bakh.	Eb002	Thailand	Duangjai 068	KUFF, W	DQ923884	EU980645	DQ923991	EU981060	KF291447	KF291624
D. andamanica	Eb104	Thailand	Duangjai 162	KUFF, W	DQ923950	EU980755	DQ924057	EU981170	KF291448	KF291625
D. anisandra S.F. Blake	W68	Guatemala	Wallnöfer 6012	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291316
D. anisandra	W80	Guatemala	Frisch 2006-1	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291317
D. apiculata Hiern	Eb006	Thailand	Duangjai 072	KUFF	EU980813	EU980647	EU980936	EU981062	KF291449	KF291626
D. areolata King & Gamble	Eb160	Brunei	Duangjai et al. 33	BRUN, W, WU	Duangjai unpubl	Duangjai unpubl	Duangjai unpubl	KF291318	KF291450	KF291627
D. artanthifolia Mart. ex Miq.	W15	Peru	Pirie 62	W	DQ923885	EU980648	DQ923992	EU981063
D. australis (R.Br) Hiern	Eb205	Australia	Wallnöfer & Duangjai 13944	WU	DQ923887	EU980650	DQ923994	EU981065
D. australis	K22548	Australia	Forster 7848	K	DQ923886	EU980649	DQ923993	EU981064
D. balansae Guillaumin	M3556	New Caledonia	Munzinger 3556	NOU015466	EU980814	EU980651	EU980937	EU981066	KF291451	KF291628
D. batocana Hiern	K21210	Namibia	Steyl 88	K	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291319
D. batocana	K22553	Zambia	Pope et al. 2196	K	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291320
D. bejaudii Lecomte	Eb011	Thailand	Duangjai 075	KUFF, W	DQ923888	EU980652	DQ923995	EU981067	KF291452	KF291629
D. bipindensis Gürke	K22452	Gabon	Stone & Niangadouma 3554	MO	DQ923889	EU980653	DQ923996	EU981068
D. borbonica I. Richardson	K23682	Reunion	Chase REU10042	REU, WU	EU980815	EU980654	EU980938	EU981069	KF291453	KF291630
D. borneensis Hiern	Eb015	Thailand	Duangjai 079	KUFF, W	DQ923890	EU980655	DQ923997	EU981070	KF291454	KF291631
D. bourdillonii Brandis	W82	India	DeFranceschi 18.12.2006	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291321
D. brandisiana Kurz	Eb017	Thailand	Duangjai & Sinbumrung 007	KUFF, W	DQ923891	EU980656	DQ923998	EU981071	KF291455	KF291632
D. brassica F. White	M2898	New Caledonia	Munzinger 2898	NOU007949	DQ923892	EU980657	DQ923999	EU981072	KF291456	KF291633
D. buxifolia (Blume) Hiern	Eb018	Thailand	Duangjai 081	KUFF, W	EU980816	EU980658	EU980939	EU981073
D. buxifolia	W85	India	DeFranceschi 18.12.2006	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291322
D. calciphila F. White	BT314	New Caledonia	Munziner et al. 6650	MPU, NOU, P	KF291801	KF291860	KF291919	KF291323	KF291457	KF291634
D. calciphila	BT316	New Caledonia	Munziner et al. 6650	MPU, NOU, P	KF291802	KF291861	KF291920	KF291324	KF291458	KF291635
D. calciphila	BT317	New Caledonia	Munziner et al. 6653	MPU, NOU, P					KF291459	KF291636
D. calciphila	YP124	New Caledonia	Pillon 124	NOU006325					KF291460	KF291637
D. capreifolia Mart. ex Hiern	W09	French Guiana	Prévost & Sabatier 3476	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291325
D. carbonaria Benoist	W10	French Guiana	Prévost & Sabatier 3470	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291326
D. caribaea (A.DC.) Standl.	W65	Cuba	Abbott 19004	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291327
D. castanea (Craib) Fletcher	Eb020	Thailand	Duangjai 083	KUFF, W	DQ923893	EU980660	DQ924000	EU981075
D. cauliflora Blume	Eb024	Thailand	Duangjai 087	KUFF, W	DQ923894	EU980661	DQ924001	EU981076	KF291461	KF291638
D. cavalcantei Sothers	W22	French Guiana	Prévost et al. 4671	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291328
D. cayennensis A.DC.	W03	French Guiana	Prévost 3430	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291329
D. celebica Bakh.	K1242	Indonesia	Chase 1242	K	DQ923897	EU980664	DQ924004	EU981079
D. cherrieri F. White	BT262	New Caledonia	Chambrey & Turner 16	NOU079551, WU062860	KF291803	KF291862	KF291921	KF291330	KF291463	KF291640
D. cherrieri	BT297	New Caledonia	Chambrey & Turner 17	NOU079547	KF291804	KF291863	KF291922	KF291331	KF291464	KF291641
D. cherrieri	VH3510	New Caledonia	Hequet 3510	NOU015245	EU980818	EU980665	EU980941	EU981080	KF291465	KF291642
D. cherrieri	VH3516	New Caledonia	Hequet 3516	NOU015251	EU980819	EU980666	EU980942	EU981081	KF291466	KF291643
D. cherrieri	VH3610	New Caledonia	Hequet 3610	NOU016962					KF291467	KF291644
D. cherrieri	VH3640	New Caledonia	Hequet 3640	NOU017014					KF291468	KF291645
D. chrysophyllos Poir.	K25758	Mauritius	Page 45	MAU	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291332
D. chrysophyllos	K25769	Mauritius	Page 71	MAU	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291333
D. clementium Bakh.	Eb154	Brunei	Duangjai et al. 24	BRUN, W, WU	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291334
D. confertiflora (Hiern) Bakh.	Eb028	Thailand	Duangjai 091	KUFF, W	DQ923898	EU980667	DQ924005	EU981082
D. consolatae Chiov.	K1673	Africa	Beentje 2168	K	DQ923899	EU980668	DQ924006	EU981083
D. cooperi (Hutchinson & Dalziel) F. White	K20604	Ghana	Merello et al. 1350	MO	DQ923900	EU980669	DQ924007	EU981084
D. crassinervis (Krug & Urb.) Standl.	W23	Cuba	Rainer s.n.	W	DQ923901	EU980670	DQ924008	EU981085
D. curranii Merr.	Eb031	Thailand	Duangjai 094	KUFF, W, WU	DQ923902	EU980671	DQ924009	EU981086	KF291469	KF291646
D. dasyphylla Kurz	Eb033	Thailand	Duangjai 096	KUFF, W	DQ923903	EU980672	DQ924010	EU981087
D. defectrix Fletcher	Eb097	Thailand	Duangjai 155	KUFF, WU	KF291805	KF291864	KF291923	KF291335	KF291470	KF291647
D. dendo Welw. ex Hiern	K21197	Central African Republic	Harris & Fay 1594	K	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291336
D. dichroa Sandwith	W13	French Guiana	Sabatier et al. 4457	W	DQ923904	EU980673	DQ924011	EU981088
D. dictyoneura Hiern	Eb038	Thailand	Duangjai 100	KUFF, W	EU980674	EU980820	EU980943	EU981089	KF291471	KF291648
D. diepenhorstii Miq.	Eb042	Thailand	Duangjai 103	KUFF, W	DQ923905	EU980675	DQ924012	EU981090	KF291472	KF291649
D. discolor Willd.	Eb088	Thailand	Duangjai 146	KUFF, WU	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291337	KF291473	KF291650
D. ebenum J. Koenig ex Retz	DY06	Sri Lanka	Yakandawala 06	PDA	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291338
D. ebenum	DY08	Sri Lanka	Yakandawala 08	PDA	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291339
D. ebenum	Eb174	Sri Lanka	Samuel s.n.	WU	EU980677	EU980821	EU980944	EU981092
D. ebenum	W83	India	Ramesh Diosass-2	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291340
D. ebenum	W84	India	DeFranceschi 21.12.2006	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291341
D. egrettarum I. Richardson	K25788	Mauritius	Page 122	MAU	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291342
D. ehretioides Wall. ex G. Don	Eb043	Thailand	Duangjai 104	KUFF, W	DQ923907	EU980678	DQ924014	EU981093	KF291474	KF291651
D. eriantha Charmp. ex Benth	W63	Taiwan	Chung & Anderberg 1401	HAST	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291343
D. erudita F. White	BT287	New Caledonia	Chambrey & Turner 20	NOU	KF291806	KF291865	KF291924	KF291344	KF291475	KF291652
D. erudita	M2359	New Caledonia	Munzinger et al. 2359	NOU003840	EU980845	EU980739	EU980968	EU981154	KF291476	KF291653
D. erudita/pustulata	M3010	New Caledonia	Munziner et al. 3010	NOU008358	EU980841	EU980735	EU980964	EU981150
D. fasciculosa (F. Muell.) F. Muell.	BT014	New Caledonia	Munzinger et al. 6617	NOU					KF291477	KF291654
D. fasciculosa	BT142	New Caledonia	MacKee 27341	NOU022840					KF291478	KF291655
D. fasciculosa	BT165	New Caledonia							KF291479	KF291656
D. fasciculosa	BT166	New Caledonia							KF291480	KF291657
D. fasciculosa	BT335	New Caledonia							KF291481	KF291658
D. fasciculosa	M2127	New Caledonia	Munzinger 2127	NOU003604	DQ923908	EU980679	DQ924015	EU981094	KF291482	KF291659
D. fasciculosa	YP243	New Caledonia	Pillon et al. 243	NOU010096	EU980822	EU980680	EU980945	EU981095	KF291483	KF291660
D. ferox Bakh.	Eb146	Brunei	Duangjai et al. 012	BRUN, W, WU	DQ923909	EU980681	DQ924016	EU981096	KF291484	KF291661
D. ferruginescens Bakh.	Eb143	Brunei	Duangjai et al. 007	BRUN, W, WU	DQ923911	EU980685	DQ924018	EU981100
D. filipendula Pierre ex Lecomte	Eb048	Thailand	Duangjai 109	KUFF	DQ923912	EU980686	DQ924019	EU981101	KF291485	KF291662
D. flavocarpa (Vieill. ex P. Parm.) F. White	BT126	New Caledonia	Munzinger et al. 6625	NOU	KF291807	KF291866	KF291925	KF291345	KF291486	KF291663
D. flavocarpa	BT127	New Caledonia	Munzinger et al. 6625	NOU	KF291808	KF291867	KF291926	KF291346	KF291487	KF291664
D. flavocarpa	BT156	New Caledonia	Munzinger et al. 6632	NOU					KF291488	KF291665
D. flavocarpa	K20607	New Caledonia	McPherson & Lowry 18563	NOU022877	DQ923913	EU980687	DQ924020	EU981102	KF291489	KF291666
D. flavocarpa	K20614	New Caledonia	Lowry et al. 5783	NOU023319	EU980870	EU980782	EU980993	EU981197
D. flavocarpa	M2235	New Caledonia	Munzinger 2235	NOU006659	EU980825	EU980688	EU980948	EU981103	KF291490	KF291667
D. flavocarpa	M2905	New Caledonia	Munzinger et al. 2905	NOU007977	EU980826	EU980689	EU980949	EU981104
D. fragrans Gürke	K22454	Gabon	SIMAB 010610	MO	DQ923914	EU980690	DQ924021	EU981105
D. frutescens Blume	Eb049	Thailand	Duangjai 110	KUFF, W	EU980827	EU980691	EU980950	EU981106
D. fulvopilosa Fletcher	Eb052	Thailand	Duangjai 113	KUFF, W	DQ923915	EU980692	DQ924022	EU981107	KF291491	KF291668
D. fuscovelutina Baker	RF938	Madagascar	RF 938	W	DQ923979	EU980803	DQ924088	EU981218
D. gabunensis Gürke	K22560	Tanzania	Bidgood et al. 2890	K	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291347
D. gilletii De Wild	K21198	Cameroon	Harris & Fay 884	K	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291348
D. glandulosa Lace	Eb053	Thailand	Duangjai 114	KUFF, W	DQ923916	EU980693	DQ924023	EU981108	KF291492	KF291669
D. glans F. White	BT019	New Caledonia			KF291809	KF291868	KF291927	KF291349
D. glans	BT093	New Caledonia	Turner et al. 093	MPU	KF291810	KF291869	KF291928	KF291350	KF291493	KF291670
D. glans	BT094	New Caledonia	Turner et al. 094	MPU	KF291811	KF291870	KF291929	KF291351	KF291494	KF291671
D. glaucifolia Metcalf	K14256	China	Chase 14256	K	DQ923917	EU980694	DQ924024	EU981109
D. cf. gracilipes Hiern	RF978	Madagascar	RNF 978	W	DQ923918	EU980695	DQ924025	EU981110
D. gracilis Fletcher	Eb058	Thailand	Duangjai 019	BK, BKF, KUFF, WU	KF291812	KF291871	KF291930	KF291352	KF291495	KF291672
D. greenweyi F. White	K21205	Somalia	Friis et al. 4991	K	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291353
D. grisebachii (Heirn) Standl.	W64	Cuba	Abbott 18937	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291354
D. guianensis (Aubl.) Gürke	W14	French Guiana	Prévost & Sabatier 4029	W	DQ923919	EU980696	DQ924026	EU981111
D. guianensis	W78	French Guiana	Mori 25921	NY, W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291355
D. hartmaniana S. Knapp	K22455	Panama	McPherson & Richardson 15959	MO	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291356
D. impolita F. White	BT102	New Caledonia	Schmid 5010	NOU019538	KF291813	KF291872	KF291931	KF291357	KF291496	KF291673
D. impolita	BT105	New Caledonia	Schmid 5010	NOU019538	KF291814	KF291873	KF291932	KF291358	KF291497	KF291674
D. inconstans Jacq.	W79	Ecuador	Rainer 1682	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291359
D. inexplorata F. White	BT304	New Caledonia	MacKee 22791	NOU005818	KF291815	KF291874	KF291933	KF291360	KF291498	KF291675
D. inexplorata	BT311	New Caledonia	MacKee 22791	NOU005818	KF291816	KF291875	KF291934	KF291361	KF291499	KF291676
D. insidiosa Bakh.	Eb061	Thailand	Duangjai 120	KUFF, W	DQ923920	EU980697	DQ924027	EU981112
D. iturensis (Gürke) Letouzey & F. White	K21204	Cameroon	Harris & Fay 1513	K	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291362
D. kaki L.f.	K920	Japan	Chase 920	K	DQ923921	EU980698	DQ924028	EU981113	KF291500	KF291677
D. kirkii Hiern	K22551	Zimbabwe	Poilecot 7650	K	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291363
D. kupensis Gosline	AR62	Cameroon	Russell 62	K	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.		KF291501	KF291678
D. labillardierei F. White	BT121	New Caledonia	Munzinger et al. 6624	NOU	KF291817	KF291876	KF291935	KF291364	KF291502	KF291679
D. labillardierei	BT122	New Caledonia	Munzinger et al. 6624	NOU	KF291818	KF291877	KF291936	KF291365	KF291503	KF291680
D. labillardierei	BT179	New Caledonia							KF291504	KF291681
D. labillardierei	K20763	New Caledonia	McPherson & Munzinger 18038	MO	DQ923922	EU980699	DQ924029	EU981114
D. labillardierei	M2219	New Caledonia	Munzinger 2219	NOU006657	EU980828	EU980700	EU980951	EU981115	KF291505	KF291682
D. labillardierei	M3053	New Caledonia	Munzinger 3053	NOU008407	EU980829	EU980701	EU980952	EU981116	KF291506	KF291683
D. lanceifolia Roxb.	K1245	Indonesia	Chase 1245	K	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291366
D. leucomelas Poir.	K25752	Mauritius	Page 16	MAU	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291367
D. lotus L.	D16	Living coll. HBV	Turner D16	Living coll. HBV					KF291507	KF291684
D. lotus	K965	Living coll. Kew 1882-3501	Chase 965	K	DQ923924	EU980703	DQ924031	EU981118
D. macrocarpa (Vieill.) Hiern	BT043	New Caledonia							KF291508	KF291685
D. macrocarpa	BT044	New Caledonia							KF291509	KF291686
D. macrocarpa	BT048	New Caledonia							KF291510	KF291687
D. macrocarpa	BT049	New Caledonia							KF291511	KF291688
D. macrocarpa	BT050	New Caledonia							KF291512	KF291689
D. macrocarpa	M2014	New Caledonia	Munzinger 2014	NOU003637	EU980830	EU980704	EU980953	EU981119
D. macrocarpa	M2829	New Caledonia	Munzinger 2829	NOU008233	DQ923925	EU980705	DQ924032	EU981120
D. maingayi (Hiern) Bakh.	Eb073	Thailand	Duangjai 131	KUFF, W	DQ923926	EU980706	DQ924033	EU981121
D. malabarica (Desr.) Kostel.	Eb066	Thailand	Duangjai 006	KUFF, W	EU980708	DQ923928	DQ924035	EU981123
D. malabarica	K1247	Indonesia	Chase 1247	K	DQ923927	EU980707	DQ924034	EU981122
D. malabarica	W47	South East Asia, cult. USA	Abbott 14325	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291368
D. mannii Hiern	K20597	Ghana	Merello et al. 1348	MO	DQ923929	EU980709	DQ924036	EU981124
D. margaretae F. White	YP1267	New Caledonia	Pillon 1267	NOU049432, WU062863	KF291819	KF291878	KF291937	KF291369	KF291513	KF291690
D. maritima Blume	Eb209	Malaysia	Wallnöfer 13948	W	DQ923930	EU980710	DQ924037	EU981125
D. melanida Poir.	K25786	Mauritius	Page 112	MAU	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291370
D. melocarpa F. White	K22457	Gabon	SIMAB 012319	MO	DQ923931	EU980711	DQ924038	EU981126
D. mespiliformis Hochst. Ex A.DC.	Eb206	Tropical Africa	Wallnöfer & Duangjai 13945	W	DQ923932	EU980712	DQ924039	EU981127	KF291514	KF291691
D. mespiliformis	W60	Senegal	Prinz 2005-5	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291371
D. minimifolia F. White	BT131	New Caledonia	Dagostini 203	NOU019556	KF291820	KF291879	KF291938	KF291372	KF291515	KF291692
D. minimifolia	BT133	New Caledonia	Dagostini 203	NOU019556	KF291821	KF291880	KF291939	KF291373	KF291516	KF291693
D. minimifolia	BT231	New Caledonia	Veillon 7206	NOU019554					KF291517	KF291694
D. minimifolia	BT264	New Caledonia	Chambrey & Turner 24	NOU079549, WU062872					KF291518	KF291695
D. minimifolia	M2214	New Caledonia	Munzinger 2214	NOU006263	EU980831	EU980714	EU980954	EU981129	KF291519	KF291696
D. minimifolia	M2374	New Caledonia	Munzinger 2374	NOU006677	EU980832	EU980715	EU980955	EU981130	KF291520	KF291697
D. minimifolia/pustulata	BT143	New Caledonia							KF291521	KF291698
D. mollis Griff.	Eb074	Thailand	Duangjai 132	KUFF, W	DQ923934	EU980716	DQ924041	EU981131	KF291522	KF291699
D. montana Roxb.	Eb078	Thailand	Duangjai 136	KUFF, W	DQ923935	EU980717	DQ924042	EU981132
D. montana	Eb130	Thailand	Duangjai & Sinbumrung 017	KUFF, W	DQ923943	EU980733	DQ924050	EU981148
D. myriophylla (H. Perrier) G.E. Schatz & Lowry	W34	Madagascar	Sieder 209	W	DQ923974	EU980797	DQ924083	EU981212
D. natalensis (Harv.) Brenan	K22554	Zambia	Bingham 10635	K	DQ923936	EU980718	DQ924043	EU981133
D. nigra (J.F. Gmel.) Perrier	K212	Cult. Mexico	Chase 212	NCU	DQ923906	EU980676	DQ924013	EU981091
D. nigra	K1146	Cult. Mexico	Chase 1146	K	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291374
D. obliquifolia (Hiern ex Gürke) F. White	W91	Cameroon	Rainer 6.3.2007	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291375
D. oblonga Wall. Ex G. Don.	Eb083	Thailand	Duangjai 141	KUFF, W	DQ923937	EU980719	DQ924044	EU981134
D. olen Hiern	BT001	New Caledonia	Munzinger et al. 6609	NOU	KF291822	KF291881	KF291940	KF291376	KF291523	KF291700
D. olen	BT032	New Caledonia							KF291524	KF291701
D. olen	BT034	New Caledonia							KF291525	KF291702
D. olen	BT169	New Caledonia	Munzinger et al. 6634	NOU					KF291526	KF291703
D. olen	BT302	New Caledonia							KF291527	KF291704
D. olen	K20598	New Caledonia	Lowry et al. 5628	MO, NOU004840	DQ923938	EU980720	DQ924045	EU981135
D. olen	M2827	New Caledonia	Munzinger 2827	NOU008235	EU980833	EU980721	EU980956	EU981136
D. olen	YP153	New Caledonia	Pillon 153	NOU006438	EU980834	EU980722	EU980957	EU981137
D. oubatchensis Kosterm.	BT160	New Caledonia	LeCore et al. 768	NOU079472	KF291823	KF291882	KF291941	KF291377	KF291528	KF291705
D. oubatchensis	BT161	New Caledonia	LeCore et al. 768	NOU079472	KF291824	KF291883	KF291942	KF291378	KF291529	KF291706
D. oubatchensis	M3118	New Caledonia	Munzinger 3118	NOU009675	EU980835	EU980723	EU980958	EU981138
D. oubatchensis	M3333	New Caledonia	Munzinger 3333	NOU011201	EU980836	EU980724	EU980959	EU981139
D. ovalifolia Wight	DY10	Sri Lanka	Yakandawala 10	PDA	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291379
D. pancheri Kosterm.	BT027	New Caledonia	Munzinger et al. 6619	NOU	KF291825	KF291884	KF291943	KF291380	KF291530	KF291707
D. pancheri	BT028	New Caledonia	Munzinger et al. 6619	NOU	KF291826	KF291885	KF291944	KF291381	KF291531	KF291708
D. pancheri	BT029	New Caledonia	Munzinger et al. 6619	NOU					KF291532	KF291709
D. pancheri	BT030	New Caledonia	Munzinger et al. 6620	NOU					KF291533	KF291710
D. pancheri	BT031	New Caledonia	Munzinger et al. 6620	NOU					KF291534	KF291711
D. pancheri	BT033	New Caledonia	Munzinger et al. 6620	NOU	KF291827	KF291886	KF291945	KF291382	KF291535	KF291712
D. pancheri	BT035	New Caledonia	Munzinger et al. 6620	NOU					KF291536	KF291713
D. pancheri	BT076	New Caledonia							KF291537	KF291714
D. pancheri	M2138	New Caledonia	Munzinger 2138	NOU003868	EU980837	EU980725	EU980960	EU981140	KF291538	KF291715
D. pancheri/parviflora	M2338	New Caledonia	Munzinger 2338	NOU006586	EU980838	EU980726	EU980961	EU981141	KF291539	KF291716
D. parviflora (Schltr.) Bakh.	BT038	New Caledonia			KF291828	KF291887	KF291946	KF291383
D. parviflora	BT039	New Caledonia			KF291829	KF291888	KF291947	KF291384	KF291540	KF291717
D. parviflora	BT040	New Caledonia							KF291541	KF291718
D. parviflora	BT042	New Caledonia							KF291542	KF291719
D. parviflora	BT187	New Caledonia	Munzinger et al. 6636	NOU					KF291543	KF291720
D. parviflora	M2037	New Caledonia	Munzinger 2037	NOU002519	EU980839	EU980727	EU980962	EU981142	KF291544	KF291721
D. parviflora	M2071	New Caledonia	Munzinger 2071	NOU002608	EU980869	EU980776	EU980992	EU981191	KF291545	KF291722
D. parviflora	M2708	New Caledonia	Munzinger 2708	NOU006658	EU980728	EU980840	EU980963	EU981143
D. parviflora	M3035	New Caledonia	Munzinger 3035	NOU008397	EU980842	EU980736	EU980965	EU981151
D. pentamera (Woolls & F. Muell.) F. Muell.	K22549	Australia	Forster & Booth 25525	K	DQ923939	EU980729	DQ924046	EU981144
D. perplexa F. White	BT004	New Caledonia	Munzinger et al. 6611	NOU	KF291830	KF291889	KF291948	KF291385	KF291546	KF291723
D. perplexa	BT005	New Caledonia	Munzinger et al. 6611	NOU	KF291831	KF291890	KF291949	KF291386	KF291547	KF291724
D. perplexa	BT009	New Caledonia	Munzinger et al. 6611	NOU	KF291832	KF291891	KF291950	KF291387	KF291548	KF291725
D. perplexa	BT147	New Caledonia	Munzinger et al. 6630	NOU					KF291549	KF291726
D. perplexa	BT148	New Caledonia	Munzinger et al. 6630	NOU					KF291550	KF291727
D. perplexa	VH3614	New Caledonia	Hequet et al. 3614	NOU016957	EU980873	EU980786	EU980996	EU981201	KF291551	KF291728
D. philippinensis A.DC.	K1248	Indonesia	Chase 1248	K	DQ923940	EU980730	DQ924047	EU981145
D. philippinensis	W62	Taiwan	Chung & Anderberg 1400	HAST	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291388
D. pilosanthera Blanco	Eb091	Thailand	Duangjai 149	KUFF, W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291389
D. pilosiuscula G. Don	Eb092	Thailand	Duangjai 150	KUFF, W	DQ923941	EU980731	DQ924048	EU981146
D. preussii Gürke	LPJMO39	Cameroon	LPJMO39	YA	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291390
D. pruriens Dalzell	W81	India	DeFranceschi 18.12.2006	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291391
D. pseudomespilus Mildbr.	K20606	Gabon	Walters et al. 956	MO	DQ923942	EU980732	DQ924049	EU981147
D. puncticulosa Bakh.	Eb150	Brunei	Duangjai et al. 018	BRUN, W, WU	DQ923944	EU980734	DQ924051	EU981149
D. pustulata F. White	BT113	New Caledonia			KF291833	KF291892	KF291951	KF291392	KF291552	KF291729
D. pustulata	BT114	New Caledonia			KF291834	KF291893	KF291952	KF291393	KF291553	KF291730
D. pustulata	BT136	New Caledonia	Munzinger et al. 6629	NOU					KF291554	KF291731
D. pustulata	BT137	New Caledonia	Munzinger et al. 6629	NOU					KF291555	KF291732
D. pustulata	BT257	New Caledonia	Cambrey & Turner 21	NOU079548, WU062871					KF291556	KF291733
D. pustulata	M3580	New Caledonia	Munzinger 3580	NOU016720	EU980843	EU980737	EU980966	EU981152	KF291557	KF291734
D. pustulata	M3584	New Caledonia	Munzinger 3584	NOU016734	EU980844	EU980738	EU980967	EU981153	KF291558	KF291735
D. pustulata	VH3638	New Caledonia	Hequet et al. 3638	NOU017016					KF291559	KF291736
D. pustulata/yahouensis	BT259	New Caledonia	Chambrey & Turner 26	WU062855	KF291835	KF291894	KF291953	KF291394	KF291560	KF291737
D. racemosa Roxb.	Eb106	Thailand	Duangjai 164	KUFF	EU980856	EU980759	EU980979	EU981174	KF291561	KF291738
D. revaughanii I. Richardson	K25760	Mauritius	Page 47	MAU	Duangjai unpubl	Duangjai unpubl	Duangjai unpubl	KF291395
D. revolutissima F. White	BT116	New Caledonia	MacKee 22382	NOU023189	KF291836	KF291895	KF291954	KF291396	KF291562	KF291739
D. revolutissima	BT117	New Caledonia	MacKee 22382	NOU023189	KF291837	KF291896	KF291955	KF291397	KF291563	KF291740
D. revolutissima	BT218	New Caledonia	Munzinger et al. 6640	NOU					KF291564	KF291741
D. revolutissima	BT219	New Caledonia	Munzinger et al. 6640	NOU					KF291565	KF291742
D. revolutissima	YP204	New Caledonia	Pillon 204	NOU009155	EU980846	EU980740	EU980969	EU981155	KF291566	KF291743
D. rhodocalyx Kurz	Eb096	Thailand	Duangjai 154	KUFF, WU	KF291838	KF291897	KF291956	KF291398	KF291567	KF291744
D. rhombifolia Hemsl.	Eb129	Thailand	Duangjai & Sinbumrung 016	KUFF, W	DQ923945	EU980741	DQ924052	EU981156
D. cf. rhombifolia	W76	Cult. USA, (South East Asia)	Abbott 20824	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291399
D. ridleyi Bakh.	Eb138	Brunei	Duangjai et al. 002	BRUN, W, WU	DQ923946	EU980742	DQ924053	EU981157	KF291568	KF291745
D. rigida Hiern	Eb140	Brunei	Duangjai et al. 004	BRUN, W, WU	DQ923947	EU980743	DQ924054	EU981158
D. ropourea B. Walln.	W20	French Guiana	Wallnöfer 13459	W	DQ923948	EU980744	DQ924055	EU981159
D. salicifolia Humb. & Bonpl. ex Willd.	W66	Guatemala	Abbott 19765	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291400
D. salicifolia	W67	Guatemala	Abbott 19777	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291401
D. samoensis A. Gray	Eb176	Cult. Hawaii Bot Garden	Kiehn s.n.	WU	EU980745	EU980847	EU980970	EU981160
D. samoensis	M3593	Vanuatu	Munzinger 3593	NOU080070	EU980848	EU980746	EU980971	EU981161
D. samoensis	M3624	Vanuatu	Munzinger 3624	NOU080138, NOU080139	EU980849	EU980747	EU980972	EU981162	KF291569	KF291746
D. samoensis	M3691	Vanuatu	Munzinger 3691	NOU	EU980850	EU980748	EU980973	EU981163
D. sandwicensis (A.DC.) Fosberg	Eb175	Cult. Hawaii Bot Garden	Kiehn s.n.	WU	EU980851	EU980749	EU980974	EU981164	KF291570	KF291747
D. scabra (Chiov.) Cufod.	K21206	Ethiopia	Wondefrash & Tefera 9622	K	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291402
D. scalariformis Fletcher	Eb172	Thailand	Duangjai & Sinbumrung s.n.	KUFF, W	EU980750	EU980852	EU980975	EU981165
D. senensis Klotzsch	K22552	Zambia	Bingham 11092	K	EU980853	EU980751	EU980976	EU981166
D. squarrosa Klotzsch	K21207	Somalia	Friis et al. 4894	K	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291417
D. squarrosa	K22555	Zambia	Bingham & Downie 11465	K	EU980854	EU980752	EU980977	EU981167
D. styraciformis King & Gamble	Eb149	Brunei	Duangjai et al. 017	BRUN, W, WU	DQ923949	EU980753	DQ924056	EU981168
D. sumatrana Miq.	Eb099	Thailand	Duangjai 157	KUFF, W	EU980855	EU980754	EU980978	EU981169
D. tenuiflora A.C.Sm.	W32	Brazil	Maas et al. 9186	NY, W	DQ923923	EU980702	DQ924030	EU981117
D. tesselaria Poir.	K25751	Mauritius	Page 15	MAU	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291418
D. tetrandra Hiern	W31	French Guiana	Prévost & Sabatier 4713	W	DQ923951	EU980756	DQ924058	EU981171
D. tetrasperma Sw.	K14254	Mexico	Chase 14254	K, W	DQ923952	EU980757	DQ924059	EU981172
D. texana Scheele	Eb208	Middle America	Wallnöfer & Duangjai 13946	W	DQ923953	EU980758	DQ924060	EU981173	KF291575	KF291752
D. tireliae F. White	M5725	New Caledonia	Munzinger 5725	NOU051026	KF291843	KF291902	KF291961	KF291419	KF291576	KF291753
D. tridentata F. White	BT202	New Caledonia	Munzinger et al. 6639	NOU	KF291844	KF291903	KF291962	KF291420	KF291577	KF291754
D. tridentata	BT203	New Caledonia	Munzinger et al. 6639	NOU	KF291845	KF291904	KF291963	KF291421	KF291578	KF291755
D. trisulca F. White	BT185	New Caledonia	Hequet (leg. Butin) 3820	NOU031344	KF291846	KF291905	KF291964	KF291422	KF291579	KF291756
D. trisulca	BT189	New Caledonia	Hequet (leg. Butin) 3820	NOU031344	KF291847	KF291906	KF291965	KF291423	KF291580	KF291757
D. trisulca	BT192	New Caledonia	Hequet (leg. Butin) 3820	NOU031344	KF291848	KF291907	KF291966	KF291424	KF291581	KF291758
D. trisulca	BT197	New Caledonia	Munzinger et al. 6637	NOU					KF291582	KF291759
D. trisulca	M3179	New Caledonia	Munzinger 3179	NOU016896	EU980871	EU980784	EU980994	EU981199
D. trisulca	M3260	New Caledonia	Munzinger 3260	NOU016891, WU062868	EU980872	EU980785	EU980995	EU981200	KF291583	KF291760
D. cf. ulo Merr.	Eb152	Brunei	Duangjai et al. 021	BRUN, W, WU	EU980857	EU980760	EU980980	EU981175	KF291462	KF291639
D. umbrosa F. White	BT065	New Caledonia			KF291849	KF291908	KF291967	KF291425	KF291584	KF291761
D. umbrosa	BT066	New Caledonia							KF291585	KF291762
D. umbrosa	BT071	New Caledonia							KF291586	KF291763
D. umbrosa	BT246	New Caledonia	McPherson 2144	NOU023234	KF291850	KF291909	KF291968	KF291426	KF291587	KF291764
D. umbrosa	BT247	New Caledonia	McPherson 2144	NOU023234	KF291851	KF291910	KF291969	KF291427	KF291588	KF291765
D. umbrosa	BT256	New Caledonia	McPherson 2144	NOU023234					KF291589	KF291766
D. umbrosa	M2265	New Caledonia	Munzinger 2265	NOU006679	EU980858	EU980761	EU980981	EU981176	KF291590	KF291767
D. umbrosa	M2636	New Caledonia	Munzinger 2636	NOU006678	EU980859	EU980762	EU980982	EU981177	KF291591	KF291768
D. umbrosa	M2771	New Caledonia	Munzinger 2771	NOU007912	EU980860	EU980763	EU980983	EU981178	KF291592	KF291769
D. undulata Wall. Ex G. Don	Eb112	Thailand	Duangjai 170	KUFF, W	DQ923954	EU980764	DQ924061	EU981179
D. veillonii F. White	BT224	New Caledonia	Veillon 7919	NOU019582	KF291852	KF291911	KF291970	KF291428	KF291593	KF291770
D. veillonii	BT229	New Caledonia	Veillon 7919	NOU019582	KF291853	KF291912	KF291971	KF291429	KF291594	KF291771
D. veillonii	M.sn.	New Caledonia	Munzinger s.n.	Living coll. Hortus Veillonii	EU980861	EU980765	EU980984	EU981180	KF291595	KF291772
D. venosa Wall ex A.DC	Eb119	Thailand	Duangjai 177	KUFF, W	DQ923955	EU980767	DQ924062	EU981182	KF291596	KF291773
D. venosa	Eb131	Thailand	Duangjai 059	KUFF, W	EU980862	EU980766	EU980985	EU981181
D. vera (Lour.) A. Chev.	DY16	Sri Lanka	Yakandawala 16	PDA	EU980823	EU980682	EU980946	EU981097
D. vera	Eb045	Thailand	Duangjai 106	KUFF	DQ923910	EU980683	DQ924017	EU981098	KF291597	KF291774
D. vera	K21193	Central African Republic	Harris & Fay 2032	K	EU980824	EU980684	EU980947	EU981099
D. vestita Benoist	W01	French Guiana	Molino 1849	W	DQ923956	EU980768	DQ924063	EU981183
D. vieillardii (Hiern) Kosterm.	BT025	New Caledonia	Munzinger et al. 6618	NOU	KF291854	KF291913	KF291972	KF291430	KF291598	KF291775
D. vieillardii	BT026	New Caledonia	Munzinger et al. 6618	NOU	KF291855	KF291914	KF291973	KF291431	KF291599	KF291776
D. vieillardii	BT055	New Caledonia							KF291600	KF291777
D. vieillardii	BT057	New Caledonia							KF291601	KF291778
D. vieillardii	BT099	New Caledonia							KF291602	KF291779
D. vieillardii	BT100	New Caledonia							KF291603	KF291780
D. vieillardii	BT213	New Caledonia	MacKee 25141	NOU023242					KF291604	KF291781
D. vieillardii	BT214	New Caledonia	MacKee 25141	NOU023242					KF291605	KF291782
D. vieillardii	BT286	New Caledonia	Chambrey & Turner 13	NOU054004, WU062859					KF291606	KF291783
D. vieillardii	BT325	New Caledonia	Munzinger et al. 6657	NOU, P					KF291607	KF291784
D. vieillardii	M2106	New Caledonia	Munzinger 2106	NOU006676	EU980863	EU980769	EU980986	EU981184	KF291608	KF291785
D. vieillardii	M2776	New Caledonia	Munzinger 2776	NOU008207	EU980864	EU980770	EU980987	EU981185
D. vieillardii	M3476	New Caledonia	Munzinger 3476	NOU012947					KF291609	KF291786
D. vieillardii	M3572	New Caledonia	Munzinger 3572	NOU016733	EU980866	EU980772	EU980989	EU981187	KF291610	KF291787
D. vieillardii	YP146	New Caledonia	Pillon 146	NOU006400	EU980867	EU980773	EU980990	EU981052	KF291611	KF291788
D. virginiana L.	K14255	USA	Chase 14255	K	DQ923957	EU980774	DQ924064	EU981189	KF291612	KF291789
D. wallichii King & Gamble ex King	Eb122	Thailand	Duangjai 180	KUFF, W	EU980868	EU980775	EU980991	EU981190	KF291613	KF291790
D. wallichii	Eb165	Brunei	Duangjai et al. 41	BRUN, W, WU					KF291614	KF291791
D. winitii Fletcher	Eb123	Thailand	Duangjai 181	KUFF, WU					KF291615	KF291792
D. yahouensis (Schltr.) Kosterm.	BT237	New Caledonia	Schlechter 15059	P00057340	KF291856	KF291915	KF291974	KF291432	KF291616	KF291793
D. yahouensis	BT238	New Caledonia	Schlechter 15059	P00057340	KF291857	KF291916	KF291975	KF291433	KF291617	KF291794
D. yahouensis	BT239	New Caledonia	Schlechter 15059	P00057340					KF291618	KF291795
D. yahouensis	VH3637	New Caledonia	Hequet et al. 3637	NOU017017	KF291858	KF291917	KF291976	KF291434	KF291619	KF291796
D. yatesiana Standl.	W27	Guatemala	Frisch s.n.	W	DQ923958	EU980777	DQ924065	EU981192
D. sp. Pic N’ga	BT318	New Caledonia	Munzinger 6065	NOU	KF291839	KF291898	KF291957	KF291404	KF291572	KF291749
D. sp. Pic N’ga	BT319	New Caledonia	Munzinger 6065	NOU	KF291840	KF291899	KF291958	KF291405	KF291573	KF291750
D. sp. Pic N’ga	BT320	New Caledonia	Munzinger 6065	NOU	KF291841	KF291900	KF291959	KF291406	KF291574	KF291751
D. sp.	FS1637	Madagascar	Fischer & Sieder 1637	W	DQ923959	EU980778	DQ924066	EU981193
D. sp.	FS2217	Madagascar	Fischer & Sieder 2217	W	DQ923960	EU980779	DQ924067	EU981194
D. sp.	K20600	Madagascar	Rabenantoandro et al. 1246	MO	DQ923961	EU980780	DQ924068	EU981195
D. sp.	K20601	Madagascar	Rabevohitra et al. 3660	MO	DQ923973	EU980796	DQ924082	EU981211
D. sp.	K20613	Zambia	Zimba et al. 893	MO	DQ923962	EU980781	DQ924069	EU981196
D. sp.	K20616	Ghana	Schmidt et al. 2207	MO	DQ923963	EU980783	DQ924070	EU981198
D. sp.	K25759	Mauritius	Page 46	MAU	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291403
D. sp.	RF958	Madagascar	RNF 958	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291407
D. sp.	RF959	Madagascar	RNF 959	W	DQ923980	EU980804	DQ924089	EU981219
D. sp.	RF970	Madagascar	RNF 970	W	DQ923964	EU980787	DQ924071	EU981202
D. sp.	S10	Sri Lanka	Samuel 10	PDA	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291408
D. sp.	S12	Sri Lanka	Samuel 12	PDA	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291409
D. sp.	S18	Sri Lanka	Samuel 18	PDA	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291410
D. sp.	S22	Sri Lanka	Samuel 22	PDA	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291411
D. sp.	S25	Sri Lanka	Samuel 25	PDA	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291412
D. sp.	S26	Sri Lanka	Samuel 26	PDA	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291413
D. sp.	S28	Sri Lanka	Samuel 28	PDA	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291414
D. sp.	W33	Madagascar	Sieder 440	W	KF291842	KF291901	KF291960	KF291415	KF291571	KF291748
D. sp.	W36	Madagascar	Sieder et al. 258	W	DQ923965	EU980788	DQ924072	EU981203
D. sp.	W77	Madagascar	Sieder et al. 3079	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291416
Euclea crispa (Thunb.) Gürke	Eb202	Living coll. HBV (EB 4/2)	Wallnöfer 13949	W	DQ923966	EU980789	DQ924073	EU981204
Euclea crispa	K21188	Malawi	Chapman & Chapman 8085	K	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291435
Euclea divinorum Hiern	Eb201	Cult. HBV (EB 2/1, Salisburg 69)	Wallnöfer & Duangjai 13947	W	DQ923967	EU980790	DQ924074	EU981205
Euclea natalensis A.DC.	K21186	Zimbabwe	Timberlake & Cunliffe 4389	K	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291436
Euclea natalensis	W08	South Africa	Kurzweil E514	W	DQ923968	EU980791	DQ924075	EU981206
Euclea pseudobenus E. Mey. ex A.DC	K21190	Namibia	Ward 9205	K	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291437
Euclea racemosa L.	K21183	Somalia	Thulin 10739	K	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291438
Euclea sp.	W58	Tanzania	Kutalek 1-2001	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291439
Euclea sp.	W59	Tanzania	Mbeyela 2-2001	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291440
Euclea undulata Thunb.	Eb200	Cult. HBV (EB 5/2, 1973)	Wallnöfer 13897	W	EU980874	EU980792	DQ924076	EU981207	KF291620	KF291797
Royena cordata E. Mey ex A.DC	K1144	South Africa	Chase 1144	K	DQ923975	EU980799	DQ924084	EU981214
Royena glabra L.	W05	South Africa	Kurzweil 2097	W	DQ923976	EU980800	DQ924085	EU981215
Royena lucida L.	Eb203	South Africa	Wallnöfer & Duangjai 13943	W	DQ923977	EU980801	DQ924086	EU981216
Royena lucida	W06	South Africa	Kurzweil E513	W	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291442
Royena lycioides Desf. Ex A.DC	K977	South Africa	Chase 977	K	DQ923978	EU980802	DQ924087	EU981217
Royena sp.	K1145	South Africa	Chase 1145	K	KF291859	KF291918	KF291977	KF291444
Royena whyteana Hiern	Eb177	Africa	Kiehn s.n.	WU	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291443	KF291622	KF291799
Royena zombensis B.L. Burtt	K22558	Tanzania	Abdallah & Vollesen 95/106	K	Duangjai unpubl.	Duangjai unpubl.	Duangjai unpubl.	KF291445
Lissocarpa benthamii Gürke	W61	Venezuela	Berry et al. 7217	PORT	DQ923969	EU980793	DQ924077	EU981208
Lissocarpa guianensis Gleason	W04	Guyana	Arets s.n.	U	DQ923970	EU980794	DQ924078	EU981209
Lissocarpa stenocarpa Steyerm.	K20609	Peru	Vásquez & Ortiz-Gentry 25233	MO	DQ923971	EU980795	DQ924079	EU981210
Argania spinosa (L.) Skeels	K978	Morocco	Chase 978	K	DQ923981	EU980805	DQ924090	KF291308
Cleyera japonica Thunb.	K1690	Japan	Chase 1690	K	DQ923985	EU980811	DQ924094	KF291309
Halesia carolina L.	K910	USA	Chase 910	K					KF291621	KF291798
Madhuca macrophylla (Hassk.) H.J. Lam	K1363	Cult. Indonesia	Chase 1363	K	DQ923982	EU980806	DQ924091	KF291441
Styrax benzoin Dryand.	K1371	Indonesia	Chase 1371	K	DQ923989	EU980809	DQ924098	KF291446
Styrax officinalis L.	K872	Living coll. RGB Kew 1973-14474	Chase 872	K					KF291623	KF291800

2.2. DNA extraction

For DNA extraction the sorbitol/high-salt CTAB method (Tel-Zur et al., 1999), modified for 2 ml micro-centrifuge tubes, was used. Tubes containing silica gel-dried material were frozen with liquid nitrogen (to keep material frozen during grinding to avoid enzymatic action) and then ground with glass-beads to a fine powder. Prior to extraction, ground material was washed three times with sorbitol buffer.

2.3. PCR and cycle sequencing

We sequenced four plastid regions: atpB, rbcL, trnK–matK (partial trnK intron and complete matK gene) and trnS–trnG, which collectively represent approximately 6.5 kb. Primers and PCR conditions are those of Duangjai et al. (2009). We added 136 accessions to the matrix of Duangjai et al. (2009).

Chloroplast-expressed glutamine synthetase (ncpGS) was amplified with primers designed for this study (GScpDio1F and GScpDioR; Table 4). Initial Diospyros sequences for primer design were obtained with the primers and PCR protocol of Yockteng and Nadot (2004). Primers were situated at the end of exon 7 (forward) and beginning of exon 11 (reverse), amplifying a fragment between 700 and 715 bp (Fig. 2). Primers used for PCR were also used for cycle sequencing (Tables 2 and 3).

Table 4.

Primers used in this study.

Primer name	Fragment	Sequence (5’-3’)	References
GScp839F	ncpGS	CACCAATGGGGAGGTTATGC	Yockteng and Nadot (2004)
GScp1056R	ncpGS	CATCTTCCCTCATGCTCTTTGT	Yockteng and Nadot (2004)
GscpDio1F	ncpGS	CCAATGGGGAGGTTATGCCTGGACAG	This study
GScpDioR	ncpGS	CATCTTCCCTCATGCTCTTTGTACTG	This study
PHYA upstream	phyA	GACTTTGARCCNGTBAAGCCTTAYG	Mathews and Donoghue (1999)
PHYA downstream	phyA	GDATDGCRTCCATYTCRTAGTC	Mathews and Donoghue (1999)
PhyADioF	phyA	GTBAAGCCTTAYGAAGTCCCGATGA	This study
PhyADioFi	phyA	GTCAAYGAGGGGGATGRAGAGGGAG	This study
PhyADioR	phyA	GCRTCCATYTCRTAGTCCTTCCAAG	This study
PhyADioRi	phyA	CTGATTYTCCAAYTCTAACTCCTTGTTGAC	This study

Fig. 2.

Schematic diagram of exon 7–exon 11 of ncpGS with primer positions and length of exons and introns. Numbers in parentheses give 5′ end of primers.

Table 2.

PCR reactions.

ncpGS		1st phyA		2nd phyA
18 μl	1.1xReddyMix (Thermo Scientific)	18 μl	1.1xReddyMix (Thermo Scientific)	18 μl	1.1xReddyMix (Thermo Scientific)
0.4 μl	Primer GScpDio1F (20 pM)	0.4 μl	Primer PHYA upstream (20 pM)	0.4 μl	Primer PhyADioF (20 pM)
0.4 μl	Primer GScpDioR (20 pM)	0.4 μl	Primer PHYA down-stream (20 pM)	0.4 μl	Primer PhyADioR (20 pM)
0.7 μl	Water	0.7 μl	Water	0.3 μl	Water
				0.4 μl	BSA (20 mg/ml)
0.5 μl	DNA	0.5 μl	DNA	0.5 μl	PCR product

BSA: bovine albumin serum (Thermo Scientific).

Table 3.

PCR conditions.

ncpGS		1st phyA		2nd phyA
95 °C for 2 min		95 °C for 2 min		95 °C for 2 min
95 °C for 30 s		95 °C for 30 s		95 °C for 30 s
58 °C for 30 s	35 cycles	52 °C for 30 s	35 cycles	60 °C for 30 s	35 cycles
72 °C for 2 min		70 °C for 2 min		72 °C for 1.5 min
72 °C for 7 min		70 °C for 7 min		72 °C for 7 min

Initial PCR products and sequences of PHYA were obtained with the locus-specific primers of Mathews and Donoghue (1999; PHYA upstream [2nd] and PHYA downstream [1st]). As these primers were not specific enough, we cloned the PCR products (see Section 2.4) to be able to design Diospyros-specific PHYA PCR and sequencing primers (PhyADioF, PhyADioR, PhyADioFi and PhyADioRi; Table 4; Fig. 3). However, as the new PCR primers designed for Diospyros did not amplify consistently, we used a two-step amplification protocol. In the first PCR, the universal PHYA primers were used, and then a second nested PCR was performed with the newly designed primers and the product from the first PCR as template. All primers are located in exon 1 of PHYA flanking a region of 1187 bp in length. PCR conditions and composition are provided in Tables 2 and 3. For cycle-sequencing, we used the two internal primers and the external reverse primer.

Fig. 3.

Schematic diagram of exon 1 of phyA with primer positions and length of exon. Numbers in parentheses give 5′ end of primers.

PCR products were cleaned with a mixture of exonuclease I and alkaline phosphatase (10 units exo I and one unit FastAP, both from Thermo Scientific) and incubated at 37 °C for 45 min followed by 15 min at 80 °C to inactivate enzymes. Cycle sequencing reactions were performed with 0.8 μl BigDye Terminator v3.1 (AB, Live Technologies), 1.0 μl primer (3.2 μM), 1.6 μl 5× sequencing buffer and 6.6 μl cleaned-up PCR product using 35 cycles of 96 °C for 10 s, 50 °C for 5 s and 60 °C for 3 min. Sequences were produced on a capillary sequencer (3730 DNA Analyzer, AB, Life Technologies) following the manufacturer’s protocols.

2.4. Cloning

Cloning was needed to produce PHYA from some accessions; these where than used for development of more specific primers. In addition, cloning of samples was necessary when we failed to obtain good sequences with the Diospyros-specific primers. PCR products were obtained using the universal PHYA primers, and after gel purification (Inivsorb Spin DNA Extraction Kit, Invitek), cleaned products were cloned using the pGEM-T Easy cloning system (Promega), following the manufacturer’s protocol. Cloned fragments were amplified using M13-f47 and M13-r48 primers and the following PCR conditions: initial denaturation 94 °C for 3 min, 35 cycles of denaturation 94 °C for 30 s, annealing 62 °C for 30 s and extension 72 °C for 2 min followed by a final extension at 72 °C for 7 min.

2.5. Sequence assembly, and editing, and phylogenetic analyses

Assembly and editing of sequences was done with the SeqMan Pro of the Lasergene v8.1 software package (DNASTAR); alignment was conducted with MUSCLE v3.8 (Edgar, 2004) and inspected visually using BioEdit v7.0.4 (Hall, 1999). Discrimination between the two copies of PHYA that were recovered from some species was done based on the alignment, and the ‘wrong’ (highly divergent) copy was excluded from further analyses. To test congruence between the data sets, ILD (incongruence length difference) test (Farris et al., 1994) implemented in PAUP^∗ v4b10 (Swofford, 2003; termed the “partition homogeny test”) was carried out with 100 replicates. To speed up this analysis, the neo-endemic clade (where resolution is low due to lack of variability and therefore congruence is unlikely to be detected) was reduced to two accessions (D. sp. Pic N’ga BT318 and D. vieillardii BT025). Results of the ILD test indicated congruence of the four plastid data sets, and therefore the plastid data sets were combined; jModeltest indicated the same model could be used in all analyses without partitioning. Phylogenetic analyses were performed using PAUP^∗ v4b10 (Swofford, 2003) for maximum parsimony (MP) and RaxML (Stamatakis, 2006) for maximum likelihood (ML) analyses. For both methods, bootstrap with 1000 replicates was performed to estimate clade support. For Bayesian inference, the program BEAST v1.7.4 (Drummond et al., 2012) was used. Parsimony and Bayesian analyses were run on the Bioportal computer cluster of the University Oslo (www.bioportal.uio.no), and likelihood analyses were run on CIPRS Science Gateway (http://www.phylo.org/portal2/; Miller et al., 2010). Estimation of evolutionary models and values was conducted with jModeltest v2.0.1 (Darriba et al., 2012; Guindon and Gascuel, 2003). For the Bayesian analyses the general time reversible nucleotide substitution model (GTR; Tavaré, 1986) with among site rate variation modelled with a gamma distribution (GTR + Γ) was used for ncpGS, whereas for plastid data the same model was used but with a proportion of invariable sites (GTR + Γ + I). For PHYA the Hasegawa–Kishino–Yano nucleotide substitution model (HKY; Hasegawa et al., 1985) was used with among site rate variation modelled with a gamma distribution and a proportion of invariable sites (HKY + Γ + I). Base frequencies (uniform), substitution rates between bases (gamma shape 10), alpha (gamma shape 10), kappa (gamma shape 10) and p-inv (uniform) were inferred by Modeltest from each data set. We used a relaxed uncorrelated log-normal clock model (Drummond et al., 2006). As speciation model, we used a Yule model (Gernhard, 2008; Yule, 1925). For further details see Supplementary material S1. Two independent Metropolis-coupled Markov chain Monte Carlo (MCMC) analyses each with 20 million generations were run sampling each 1000th generation. The initial 10% of trees obtained from each MCMC run were removed as burn in; the remaining trees of both runs were used to calculate a maximum clade credibility tree.

2.6. Dating the tree

To obtain an overarching dated tree, we used parts (atpB and rbcL sequences of Cornales and Ericales) of the data set of Bell et al. (2010) and combined it with our matrix. This matrix consisted of two plastid markers (atpB and rbcL), which were analysed as two partitions. Dating analyses were run in BEAST with an uncorrelated log-normal relaxed clock under the GTR + Γ + I model. The tree was calibrated with two fossils, Paleoenkianthus sayrevillensis (90 myr; Nixon and Crepet, 1993) as minimum age for Ericales and A. cryptostoma (34 myr; Basinger and Christophel, 1985) as minimum age for Diospyros clade II. Both groups (Ericales and Diospyros calde II) were defined as monophyletic, including the stem. Following tmrca (time of most recent common ancestor) settings used were: log normal prior distribution with a mean of 1.5, log standard deviation of 0.5 and an offset of 89 (Ericales) and 33 (Diospyros clade II). Priors for the molecular clock were: ucld.stdev: log normal, mean 0.9, log stdev 1, initial value 0.5, mean in real space; ucld.mean: CTMC rate reference (Ferreira and Suchard, 2008, initial value 1. Details of settings for BEAST analysis are provided in Section 2.5 (above) and Supplementary material S2. In addition to the plastid marker dating, we also conducted an analysis with our combined data set. We used the same settings as for the Bayesian analysis, but we added two calibration points: A. cryptostoma at 34 myr (Basinger and Christophel, 1985) as minimum age for Diospyros clade II and the split of Diospyros and its sister clade, Euclea plus Royena, 42 myr, which is the minimum age of that node based on dating exercises with the plastid markers. All settings for the molecular clock were the same as those for the plastid data set. The input file used for dating the combined analysis is provided in Supplementary material S3.

2.7. Chromosome counts of Diospyros

Chromosome preparations were made using Feulgen staining following the protocol from Weiss-Schneeweiss et al. (2009). Root tips were collected from plant material growing in the Botanical Garden of the University of Vienna (HBV) and a private garden in New Caledonia. To arrest mitotic spindles, root tips were treated with 0.002 M 8-hydroxquinoline for 2 h at room temperature and 2 h at 4 °C (always in darkness because 8-hydroxquinoline is light sensitive). Pre-treated material was fixed for 12 h at room temperature in 3:1 ethanol:acetic acid and then stored at −20 °C until examined. Fixed root tips were washed in distilled water to remove fixative, hydrolysed in 5 N HCl for 30 min, washed again with distilled water and stained with Schiff’s reagent for approximately 2 h in the dark. Squash preparations were made under a coverslip in a drop of 45% acetic acid. Counts could only be made for few species because obtaining young, actively growing root-tips from New Caledonian Diospyros is difficult. Collecting root-tips from forest trees and shrubs is not possible because there are too many roots in the soil to determine which is from the plant of interest. An alternative method is to grow seedlings in the lab/greenhouse. Obtaining seeds from tropical plants is not easy because these species do not produce fruit at a specific time of the year and flowering is diffuse (only few flowers produced at a time), so one would have to visit the plants regularly for at least 1 year to collect seed material. The logistics of this in process in New Caledonia were difficult. In addition, we found germination of seeds and maintenance of Diospyros seedlings highly problematic. Fortunately, the material we were able to obtain is well distributed among the genome sizes obtained, so we can conclude more than would otherwise be possible.

2.8. Genome size estimations of Diospyros

Genome size was determined using flow cytometry performed on leaf material. Fresh tissue was used from plants growing in the HBV. In addition, recently collected silica-gel dried material from New Caledonia was used for several measurements because it was not possible to transport fresh leaf material from New Caledonia to the laboratory. Samples were chopped in Otto I buffer (Otto et al., 1981) together with leaves of the internal standard species, Solanum pseudocapsicum, 1C = 1.30 pg (Temsch et al., 2010) or Pisum sativum ´Kleine Rheinländeriń, 1C = 4.42 pg (Greilhuber and Ebert, 1994), according to the method of Galbraith et al. (1983). The isolate was filtered through a 30 μm nylon mesh, and RNA was digested with 15 mg/l RNase A for 30 min at 37 °C. Subsequently, DNA was stained in propidium iodide (50 mg/l) supplemented with Otto II buffer (Otto et al., 1981). Mean fluorescence intensity of a total of 15,000 particles was measured with a CyFlow cytometer (Partec, Münster, Germany) equipped with a green laser (Cobolt Samba, Cobolt AB, Stockholm, Sweden); the 1C-value was calculated according to the formula: (MFI_object/MFI_Standard) × 1C-value_Standard, where MFI is the mean fluorescence intensity of the G1 nuclei population. Statistical significance of asymmetry between the results obtained from Diospyros species belonging to clade III and those from clades VII–XI was tested using SPSS 15.0 (SPSS, Chicago; IL, USA) and the non-parametric Mann–Whitney U-test because of non-homogeneity of variances between the two groups of variables (Levene’s test for equality of variances, p < 0.05).

3. Results

The data characteristics and statistics from the maximum parsimony analyses of all three individual and the combined data sets are provided in Table 5. Since the focus of this paper is the New Caledonian Diospyros species from clade III, only results pertaining to this group will be discussed in detail. The other species have been included to (i) investigate the utility of these markers for resolving phylogenetic relationships within Diospyros and (ii) further evaluate the hypothesis (proposed by Duangjai et al., 2009) that not all New Caledonian Diospyros resulted from a single colonisation event.

Table 5.

Data characteristics and statistics from the maximum parsimony analyses of all three individual and the combined data sets.

	Combined plastid markers	ncpGS	phyA	Combined data set
Total no. of accessions	294	177	177	129
No. of outgroup accessions other than Ebenaceae	4	2	2	1
No. of outgroup accessions from Ebenaceae	21	2	2	2
No. of Diospyros accessions	269	173	173	126
No. of Diospyros species	149	64	64	64
No. of New Caledonian accessions	98	134	134	86
No. of New Caledonian species	28	28	28	28
No. of New Caledonian neoendemic accessions	83	112	112	74
No. of New Caledonian neoendemic species	21	21	21	21
Length of alignment	6556	1039	1187	8542
No. of variable characters	1880	532	374	1845
No. of parsimony informative characters	1126 (17.2%)	341 (32.8%)	223 (18.8%)	863 (10%)
No. of parsimony informative characters NCnc	44 (0.7%)	28 (2.7%)	14 (1.2%)	79 (0.9%)
Tree length of best parsimony tree (steps)	3808	1171	689	3259
Trees saved (parsimony analysis)	210	4810	1870	930
Consistency index	0.603	0.663	0.685	0.692
Retention index	0.857	0.857	0.893	0.848
Best fitting model	GTR + Γ + I	GTR + Γ	HKY + Γ + I

3.1. Plastid markers

Parsimony analysis of the plastid data set produced 210 equally parsimonious trees, one of which (randomly selected) is shown to demonstrate comparative levels of divergence (Fig. 4). Clade names correspond to those of Duangjai et al. (2009). Resolution among the New Caledonian taxa of clade III is low, but monophyly of these taxa is strongly supported: bootstrap percentage MP (BMP) 88; bootstrap percentage ML (BML) 97; Bayesian posterior probability (BPP) 0.95. Furthermore, D. vieillardii (BMP 99, BML 98, BPP 1.00) and its position as sister (BMP 97, BML 96, BPP 1.00) to the rest of the clade are well supported. Within the NC clade III, only one group of three taxa (D. calciphila, D. inexplorata and D. sp. Pic N’ga) is supported in all three analyses (BMP 91, BML 92, BPP 1.00); this includes all accessions of each species forming unique clusters. There are a few more, weakly supported small groups in which individuals of one population fall together, but they are not consistent among the three analyses and fail to include all accessions of these species.

3.2. Low-copy nuclear markers

Nuclear markers contained proportionally more parsimony informative characters (ncpGS 2.7%, PHYA 1.2%) than the plastid markers (0.7%), but variation was still low. Some species form groups (Fig. 5), but they lack bootstrap and Bayesian posterior probability support. Among the three methods of analysis used for the ncpGS data set, Bayesian inference provides the best resolution (tree not shown), placing D. vieillardii (BBP 0.99) sister (BPP 1.00) to the rest of the NC clade. The relationship between D. veillonii and D. cherrieri (BPP 0.84) is weakly supported, but their position as subsequent sister of the rest of this clade is well supported (BPP 0.99). All individuals of D. umbrosa form a group with two individuals of D. trisulca (BBP 0.91). This set of accessions is subsequently sister (BBP 0.95) to the rest of the clade, within which there is no resolution. In the PHYA tree, there are only a few clades with strong support regardless of method of analysis. Clade III (BMP 100, BML 100, BPP 1.00) as monophyletic unit is confirmed, as well as the monophyly of NC clade III within it (BMP 77, BML 78, BPP 1.00). All included individuals of D. cherrieri fall together (BMP 84, BML 81, BPP 1.00) in the PHYA analyses. Only a single copy of ncpGS was recovered from all accessions investigated, as well as from most of the accessions of PHYA. Species from which two copies of PHYA were obtained when cloned are found in clades IX, X and XI (Fig. 4). The paralogous (divergent) copies of PHYA were easily detected and excluded from the phylogenetic analyses.

Fig. 5.

Maximum parsimony trees inferred from the nuclear data sets, branch length scaled to same value on both trees. Bold branches have more than 70% support in all three analysis. New Caledonian taxa are coloured, red represents clade III NC. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.3. Combined data set

The ILD test found the trees of the plastid and low-copy nuclear markers to be congruent with p-values of 0.01, which indicates that combined analysis was appropriate. In trees inferred from the combined data set (Fig. 6), species of clade III were highly supported (BMP 100, BML 100, BPP 1.00); they include the species of NC clade III, Indian Ocean islands, Thailand and Hawai‘i. Diospyros vera is sister to D. sandwicensis (BMP 100, BML 100, BPP 1.00) and then the NC clade III. NC clade III is moderately to well supported (BMP 83, BML 96, BPP 0.96). The position of D. vieillardii (BMP 100, BML 99, BPP 1.00) as sister to the rest of the clade is strongly supported (BMP 92, BML 98, BPP 1.00). All accessions of each of the two species, D. umbrosa (BMP < 70, BML 75, BPP 1.00) and D. flavocarpa (BMP < 70, BML < 70, BPP 0.99), form unique groups, which together are sister (BMP 100, BML 100, BPP 1.00) to the rest of the group. A sister relationship between D. cherrieri (BMP 96, BML 99, BPP 1.00) and D. veillonii (BMP 78, BML 86, BPP 1.00) is supported (BMP 75, BML 88, BPP 1.00). A clade comprising D. calciphila, D. inexplorata (both on coralline substrates) and D. sp. Pic N’ga (ultramafic substrate) is well supported (BMP 97, BML 99, BPP 1.00).

Fig. 6.

Baysian maximum clade credibility tree inferred from the combined data set. Bold branches have more than 70% support in all three analysis, nodes with at least one support value ⩾70% are indicated with blue dots (BPP/BMP/BML). New Caledonian taxa are coloured, red represents clade III NC. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.4. Dating analysis

We performed two dating analyses. The first one was based on a joint matrix of our plastid sequences together with the data set of Bell et al. (2010), which included many families across the whole Ericales with Cornales as outgroup. This dating analysis was used to get age estimates for the crown node of Ebenaceae, the two subfamilies Ebenoideae and Lissocarpoideae, the split of the three genera of Ebenoideae (Diospyros versus Euclea/Royena) and the main clades of Diospyros. The second dating analysis was based on our combined data set, which was used to infer ages of clades and species within Diospyros. The dating analysis of the over-arching matrix of plastid markers (Fig. S4, Supplementary material) indicates that the two subfamilies of Ebenaceae, Lissocarpoideae and Ebenoideae, diverged around 54 mya (42–65; 95% highest posterior density interval). The split of Diospyros from its sister genera, Euclea plus Royena occurred around 42 mya (35–50). The following conclusions are based on the dating analysis of the combined data set (Fig. 7). The Australian clade of Diospyros (clade II, Fig. 4), including five species from New Caledonia, separated from the rest of the genus around 34 mya (33–36), the New Caledonian and Australian members of this clade diverged around 20 mya (11–29). Divergence among the New Caledonian members began only about 6 mya (3–10). The two large main groups (clades V–XI and clade III, Fig. 4) diverged about 32 mya (25–35). The last common ancestor of D. fasciculosa and D. olen existed around 15 mya (11–19). Diospyros olen is around 5 myr (3–9) old and D. fasciculosa about 6 myr (3–10). Lineages of clade III started to diversify about 19 mya (13–21). Lineages forming NC clade III arrived in New Caledonia around 9 mya (6–13). Diospyros vieillardii is around 7 myr (5–10) old. The clade comprising D. cherrieri and D. veillonii is around 5 myr (3–8) old, and the two species separated around 3 mya (1–5). The clade including D. flavocarpa, D. umbrosa and one accession of D. trisulca is 5 myr (3–7) old. Diospyros flavocarpa is around 4 myr (3–6) old. The relationship between D. umbrosa and D. trisulca is not highly supported, but suggests an age of around 3 myr (2–5) for D. umbrosa. The group comprising D. calciphila, D. inexplorata and D. sp. Pic N’ga appears to be around 2 myr (1–3) old and started to diversify around 0.9 mya (0.5–2). Resolution between other species is too limited to say anything about their ages.

Fig. 7.

Chronogram based on the combined data set. Ages are given (in million years) for nodes with more than 0.85 BPP. Nodes which were calibrated are marked with a black dot. Yellow bars represent the 95% highest posterior density interval. New Caledonian taxa are coloured, red represents clade III NC.

3.5. Chromosome counts and genome size

Chromosome counts made for Diospyros fasciculosa, D. inconstans, D. macrocarpa, D. minimifolia, D. pentamera, D. pustulata, D. texana, D. veillonii and D. yatesiana indicate that they are all diploid, 2n = 30. The counts from the underlined species are here reported for the first time in literature. The other counts confirm results of White (1992).

Measurements of genome size showed differences among the New Caledonian species of Diospyros. Diospyros olen has with 1C = 0.86 pg, the smallest genome of the New Caledonian Diospyros species examined, followed by D. fasciculosa with 1C = 1.13 pg (both clade XI). The investigated species from the NC clade III have larger genomes (mean value 1C = 1.90 pg) than the two mentioned above (Table 6). We were not able to examine New Caledonian species from clade II. Finally, across whole genus Diospyros there is a significant difference (Mann Whitney U test, p < 0.001) in genome size between clade III on the one hand and clades VI–XI on the other (Fig. 8). However, D. pentamera of clade II has a comparatively large genome (1C = 1.97 pg).

Table 6.

Genome size of Diospyros and other genera from Ebenoideae. S.D.: standard deviation, N: number of measurements (replicates), S.p.: Solanum pseudocapsicum, P.s.: Pisum sativum ‘Kleine Rheinländerin’.

Name	Acc. nr	1C-value	S.D.	N	Standard	Material
D. calciphila	BT313	1.99		1	S.p.	Dry
D. calciphila	BT316	1.97		1	P.s.	Silicagel
D. cherrieri	BT262	1.65	0.0092	5	S.p.	Dry
D. cherrieri	BT293	1.57	0.0117	2	S.p.	Silicagel
D. discolor	EBE100026	0.92	0.0020	3	S.p.	Fresh
D. erudita	BT260	2.17		1	S.p.	Dry
D. erudita	BT261	2.13	0.0367	3	S.p.	Dry
D. erudita	BT280	1.88	0.0253	3	S.p.	Silicagel
D. fasciculosa	BT012	1.19	0.0031	3	P.s.	Silicagel
D. fasciculosa	BT106	1.13	0.0064	3	P.s.	Silicagel
D. fasciculosa	BT144	1.22	0.0032	3	P.s.	Silicagel
D. fasciculosa	BT167	1.02	0.0318	4	P.s.	Silicagel
D. fasciculosa	BT212	1.09	0.0227	2	P.s.	Silicagel
D. fasciculosa	BT335	1.14	0.0300	3	P.s.	Silicagel
D. glans	BT019	2.03		1	S.p.	Silicagel
D. glans	BT093	2.02	0.0153	3	S.p.	Dry
D. impolita	BT101	1.79		1	P.s.	Silicagel
D. impolita	BT105	1.90	0.0132	3	P.s.	Silicagel
D. inconstans		1.13	0.0019	3	S.p.	Fresh
D. inexplorata	BT304	1.94	0.0693	3	P.s.	Silicagel
D. kaki	Sharon	2.29	0.0121	3	S.p.	Dry
D. lotus	EBE	0.87	0.0075	8	S.p.	Fresh
D. lotus	EBE03002	0.86	0.0012	3	S.p.	Fresh
D. mespiliformis	EBE000001	1.24	0.0029	3	P.s.	Fresh
D. mespiliformis	EBE100027	1.27	0.0035	3	P.s.	Fresh
D. minimifolia	BT230	1.57	0.0445	3	P.s.	Silicagel
D. olen	BT001	0.82	0.0062	3	S.p.	Silicagel
D. olen	BT036	0.87	0.0475	3	S.p.	Silicagel
D. olen	BT096	0.86	0.0042	3	S.p.	Dry
D. olen	BT186	0.90	0.0041	3	S.p.	Dry
D. pancheri	BT077	2.28	0.0129	3	S.p.	Dry
D. parviflora	BT085	2.16	0.0493	3	P.s.	Dry
D. pentamera	EBE030020	1.97	0.0020	3	S.p.	Fresh
D. perplexa	BT002	2.27		1	S.p.	Silicagel
D. pustulata	BT137	1.54	0.0490	2	P.s.	Silicagel
D. revolutissima	BT222	2.05	0.0148	4	P.s.	Dry
D. texana	EBE020015	0.89	0.8849	3	S.p.	Fresh
D. texana	EBE100029	0.89	0.0019	3	S.p.	Fresh
D. tridentata	BT205	2.21	0.0246	2	S.p.	Dry
D. tridentata	BT206	2.09		1	P.s.	Dry
D. umbrosa	BT171	1.61		1	P.s.	Silicagel
D. umbrosa	BT247	1.51	0.0894	3	P.s.	Silicagel
D. vieillardii	BT100	1.55		1	P.s.	Dry
D. vieillardii	BT216	1.57	0.0238	3	P.s.	Dry
D. yatesiana		0.60	0.0010	5	S.p.	Fresh
E. divinorum	EBE000002	1.98	0.0014	3	S.p.	Fresh
E. undulata	EBE100002	0.74	0.0220	3	S.p.	Fresh
R. whyteana	EBE030021	0.79	0.0031	3	S.p.	Fresh
R. whyteana	EBE030022	0.78	0.0007	3	S.p.	Fresh

Fig. 8.

Boxplot of genome size differences between taxa from clade III and those from clades VII–XI.

4. Discussion

Previous phylogenetic studies of Diospyros based on plastid markers demonstrated low levels of sequence divergence among New Caledonian species belonging to clade III (Duangjai et al., 2009), and inclusion of additional species in our investigation did not improve resolution in this group. Low-copy nuclear markers have been shown to be highly informative and useful for resolving phylogenetic relationships at lower taxonomic levels in some taxa (e.g. Passiflora: Yockteng and Nadot, 2004; Paeonia: Tank and Sang, 2001). The low-copy markers ncpGS and PHYA used here, however, did not improve resolution in this clade of 21 closely related species, thus preventing detection of hybrids and elucidation of geographical patterns (Fig. 5). There are also examples where low-copy nuclear markers were not able to fully resolve phylogenetic relationships between closely related species, especially on islands (e.g. Pillon et al., 2009a, 2013; Green et al., 2011). Nonetheless, the analysis based on combined plastid and nuclear data provides some resolution of relationships within the NC clade III. Of the 21 entities included in the analyses, seven species and one unidentified taxon formed well defined and inclusive clusters (Fig. 6). The remaining 14 species failed to form groups including all individuals of a particular species, but in many cases it was simply that some accessions were part of a polytomy and did not cluster consistently with any group.

In light of our results, members of the NC clade III appear little diverged but still form a strongly supported clade, which our dating analyses indicate are the result of recent rapid radiation. Only a few studies have examined the adaptive basis and processes involved in speciation in New Caledonia (e.g. Pillon et al., 2009b; Murienne et al., 2009). Rapid radiation has been observed in isolated areas such as islands (e.g. Givnish et al., 2009; Knope et al., 2012), high mountains (e.g. Hughes and Eastwood, 2006) and valleys (e.g. Givnish et al., 2007, 2011; Richardson et al., 2001). Island floras often show high levels of endemism and closely related species groups that result from a single colonisation event followed by rapid speciation, some of which have been hypothesised to represent adaptive radiations (e.g. Hawaiian silverswords, Baldwin and Sanderson, 1998; Hawaiian Bidens, Knope et al., 2012; Araucaria in New Caledonia, Gaudeul et al., 2012). The low levels of variation and resolution detected in the NC clade III prevent us from examining factors that may be promoting speciation on New Caledonia.

As all lineages of New Caledonian Diospyros seem to have arrived relatively recent on this island, the terms paleo-endemics and neo-endemics used by Duangjai et al. (2009) were not used here. The common ancestor of clade III diverged about 19 mya (Fig. 7), and the earlier diverging species occur mainly in Africa and on islands of the western Indian Ocean (e.g. Madagascar). Our results in combination with the DIVA analysis from Duangjai et al. (2009) indicate that, from there, this group spread eastwards via Southeast Asia, where it arrived around 15 mya, and then reached the Hawaiian Archipelago and New Caledonia around 9–10 mya. This time of colonisation is consistent with that found for other plant groups (reviewed in Pillon, 2012) and animals (e.g. Nattier et al., 2011). The close relationship of New Caledonian and Hawaiian endemic Diospyros shows that migration around the Pacific Ocean has taken place, but to make more definite conclusions about the direction of dispersal, data from species present on other islands between New Caledonia and Hawai‘i are needed. In contrast to long-held hypotheses that many taxa are Gondwanan relicts (e.g. Lowry II, 1998; Swenson et al., 2001), our results suggest that all groups of New Caledonian Diospyros are much younger than 37 myr (when New Caledonia re-emerged) and arrived, like many others, via long-distance dispersal (e.g. Bartish et al., 2011; Espeland and Murienne, 2011; Murienne, 2009).

The closely related species of the NC clade III are distinguishable from one another by morphological characters (e.g. leaf, flower, fruit and calyx characters), and many of them are found in different habitats (e.g. humid/dry, different substrate types, different elevations, etc.). Leaf morphology shows adaptation to the environment in which a species occurs (e.g. species found in dry habitats have sclerophyllous leaves; for details of species descriptions see White, 1992, 1993). In most plant groups, closely related species rarely occur in sympatry, but not in New Caledonia where this seems to be a common pattern in several groups (J. Munzinger pers. obs.), including Diospyros. However, Diospyros has been reported to be one of the few genera outside New Caledonia (e.g. Madagascar) with several co-occurring species (pers. comm. P.S. Ashton). The habitats occupied by the New Caledonian Diospyros species belonging to clade III can be roughly divided into seven groups (Table 7). D. vieillardii, a common species found all over Grande Terre and the islands north of the main island in maquis vegetation, occurs on a variety of substrates, including ultramafic. Diospyros umbrosa/D. flavocarpa are sister to the remainder of the clade excluding D. vieillardii (Fig. 6). D. umbrosa occurs only on ultramafic substrates in comparatively humid forests mainly consisting of Nothofagus and Araucaria. D. flavocarpa is found on schist in middle elevation forests in northeastern Grande Terre. Diospyros cherrieri (a local endemic in dry forests on basalts at the western coast of Grande Terre, Fig. 1I) and D. veillonii (a local endemic in dry coastal forests on black clay on the western side of Grande Terre, Fig. 1F) are together sister to the rest of the clade (minus those mentioned above). The clade comprising D. calciphila, D. inexplorata (littoral forests on coralline substrates) and D. sp. from Pic N’ga (maquis on ultramafic substrate on Ile des Pins) is well supported. Relationships among all other members of the clade could not be resolved with the markers used, although most of them are morphologically and ecologically well defined. This phenomenon (morphological and ecological distinctiveness, but no resolution) is found, for example, in D. labillardieri (lanceolate leaves, hanging branches; river edges in middle elevation forests on schist, Fig 1D), D. pancheri (obcordate pubescent leaves, hanging branches, humid forests at low elevation on ultramafic soils, Fig. 1E) and many others. Due to the poor resolution of the phylogenetic trees, possible grouping of New Caledonian Diospyros species according to their ecological niches remains untested.

Table 7.

Main habitats of New Caledonian neoendemic Diospyros species.

Habitat		Species
Maquis on ultramafic substrates		D. erudita, D. pancheri, D. parviflora, D. tireliae, D. vieillardii
Dry forests on non-ultramafic substrates		D. cherrieri, D. perplexa, D. yahouensis
Humid forests at low elevations	Ultramafic substrates	D. pancheri, D. parvilfora, D. umbrosa
	Calcareous rocks	D. tridentata
Humid mountain forests on schist		D. flavocarpa, D. labillardierei, D. trisulca
Dry coastal forests	Black clays	D. veillonii, D. minimifolia, D. pustulata (the latter two can also occur on calcareous substrates)
	Schist	D. impolita
	Ultramafic substrates	D. revolutissima
	Various substrates	D. pancheri
Coastal forests on coralline substrates		D. calciphila, D. impolita
Humid forests on the east coast		D. glans

A greater than threefold variation within the genome size of Diospyros is observed, although the chromosome counts performed here and elsewhere indicates that they are diploid with 2n = 30, and we hypothesize that the most recent common ancestor of Diospyros had a large genome because species belonging to earlier diverging clades (e.g. E. divinorum and D. pentamera) have large genomes. Developing firmer ideas about evolution of genome size in Diospyros would require many more measurements of species from throughout the phylogenetic tree, especially species from islands in the Indian and Pacific Ocean, which will be key to assessing evolution of genome size in NC clade III. The limited data available today suggest that polyploidy seems to be rare among wild Diospyros species. The diversification of species of the NC clade III remains an overall poorly understood subject, despite our extensive efforts to find variation relevant to addressing these questions. It seems that we can eliminate polyploidy as one feature of their evolution, but the question of the involvement of hybridization cannot be eliminated without the use of more variable markers. To address patterns of speciation and factors promoting divergence, we will have to turn more markers used in population genetic studies, such as AFLPs, microsatellites or fingerprinting methods based on next generation sequencing methods.

Appendix A. Supplementary material

Supplementary Figure 1.

Dated phylogeny of Ericales based on the a joint matrix the data set of Bell et al. (2010) together with our plastid sequences. Taxa from families other than Ebenaceae are collapsed to family level, taxa other than Diospyros are collapsed to generic level. Multiple accessions of a species are collapsed to species level. The NC clade III part of the tree is mostly collapsed due to lack of support of respective nodes. Nodes which were calibrated with fossils are marked with a black dot. Yellow bars represent the 95% highest posterior density interval. New Caledonian taxa are coloured, red represents clade III NC.

Supplementary data 1

BEAST input file for the Bayesian analysis of the combined data set. For Bayesian analyses of the individual data sets we used the same settings as in the combined analysis for the respective data set.

Supplementary data 2

BEAST input file for dating analysis of the plastid marker data set from Bell et al. (2010) merged with our data.

Supplementary data 3

BEAST input file for dating analysis of the combined data set.