Heart failure-induced changes of voltage-gated Ca²⁺ channels and cell excitability in rat cardiac postganglionic neurons

Abstract

Chronic heart failure (CHF) is characterized by decreased cardiac parasympathetic and increased cardiac sympathetic nerve activity. This autonomic imbalance increases the risk of arrhythmias and sudden death in patients with CHF. We hypothesized that the molecular and cellular alterations of cardiac postganglionic parasympathetic (CPP) neurons located in the intracardiac ganglia and sympathetic (CPS) neurons located in the stellate ganglia (SG) possibly link to the cardiac autonomic imbalance in CHF. Rat CHF was induced by left coronary artery ligation. Single-cell real-time PCR and immunofluorescent data showed that L (Ca_v1.2 and Ca_v1.3), P/Q (Ca_v2.1), N (Ca_v2.2), and R (Ca_v2.3) types of Ca²⁺ channels were expressed in CPP and CPS neurons, but CHF decreased the mRNA and protein expression of only the N-type Ca²⁺ channels in CPP neurons, and it did not affect mRNA and protein expression of all Ca²⁺ channel subtypes in the CPS neurons. Patch-clamp recording confirmed that CHF reduced N-type Ca²⁺ currents and cell excitability in the CPP neurons and enhanced N-type Ca²⁺ currents and cell excitability in the CPS neurons. N-type Ca²⁺ channel blocker (1 μM ω-conotoxin GVIA) lowered Ca²⁺ currents and cell excitability in the CPP and CPS neurons from sham-operated and CHF rats. These results suggest that CHF reduces the N-type Ca²⁺ channel currents and cell excitability in the CPP neurons and enhances the N-type Ca²⁺ currents and cell excitability in the CPS neurons, which may contribute to the cardiac autonomic imbalance in CHF.

nearly 5.1 million people in the United States have chronic heart failure (CHF) (26). CHF is considered to contribute to approximately 270,000 deaths a year (26). Epidemiological studies revealed that CHF patients are susceptible to severe ventricular arrhythmias including ventricular tachycardia and ventricular fibrillation, which serve as principal underlying causes of sudden cardiac death(43). CHF is characterized by increased sympathetic tone and decreased parasympathetic nerve activity (6, 15, 23, 49, 53, 56, 61). The imbalance of sympathetic and parasympathetic nerve activity is a predictive risk factor for ventricular arrhythmia and sudden cardiac death (33) and is associated with further worsening and mortality of CHF (10, 17, 24, 29, 41). The role of sympathetic hyperactivation in CHF is highlighted by the use of pharmacological blockade of sympathetic nervous system (β-adrenergic receptor blockers) as the key approach to the current therapy of CHF (14, 22, 25, 39, 47). Direct cardiac vagal nerve stimulation has been found to suppress the ventricular tachyarrhythmia and to improve the survival rate both in animal CHF models and in patients with CHF (12, 13, 18, 19, 32, 34, 35, 40, 52, 55–57, 71). Therefore, exploring the mechanism(s) responsible for the sympathetic hyperactivity and parasympathetic hypoactivity may provide a new therapeutic strategy for improving the prognosis of CHF and reducing the mortality of CHF.

It has been shown that the afferent limb and central neural component of the autonomic nervous system contribute to the sympathetic hyperactivity and parasympathetic hypoactivity in CHF (54, 63, 66, 67, 72, 73). However, the efferent component of the autonomic nervous system might also be involved in the imbalance of sympathetic and parasympathetic nerve activity in CHF because normally, many effects of cardiac sympathetic and parasympathetic nervous systems on cardiac function are mediated via neurotransmitters released from postganglionic sympathetic and parasympathetic neurons innervating the heart (65). Although the mechanisms governing neurotransmitter release at postganglionic sympathetic and parasympathetic neuron terminals are not completely understood, Ca²⁺ influx through the voltage-gated Ca²⁺ channels (Ca_v) is a key trigger for the release of neurotransmitters (1, 5, 11, 74). Cell membrane depolarization is necessary for opening voltage-gated Ca²⁺ channels and increasing intracellular Ca²⁺ levels (75–77). Therefore, we investigated the alteration of voltage-gated Ca²⁺ channels and cell excitability in cardiac postganglionic parasympathetic (CPP) neurons of the intracardiac ganglia (ICG) and sympathetic (CPS) neurons of the stellate ganglia (SG) from sham and coronary artery ligation-induced CHF rats.¹

MATERIALS AND METHODS

All experimental procedures were approved by the University of Nebraska Medical Center Institutional Animal Care and Use Committee and were carried out in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Publication No. 85-23, revised 1996) and the American Physiological Society's Guiding Principles for the Care and Use of Vertebrate Animals in Research and Training.

CHF animal model.

Male Sprague-Dawley rats weighing 180–200 g were assigned randomly to one of two groups: CHF (n = 49) and sham (n = 48). CHF was produced by surgical ligation of the left coronary artery, as previously described (62, 63). On the day of the terminal experiment (12–14 wk), left ventricular end-diastolic pressure was measured using a Millar pressure transducer (model SPR 524, Millar Instruments, TX). Left femoral artery was cannulated with a polyethylene-50 catheter for blood pressure (BP) and heart rate (HR) monitoring. A digital image of the left ventricle was captured using a digital camera (Canon, Japan). Infarct size was determined using a colorimetric technique coupled to a computerized planimetric analysis (Adobe Photoshop CS5). The percentage of infarct size to total left ventricle area was quantified using Adobe Photoshop CS5 (Adobe Systems).

Labeling of CPP and CPS neurons.

The axons of the SG neurons project to the heart and other target organs. Additionally, although ICG are thought to contain pure cardiac vagal neurons(9, 50, 64), it is possible that other neurons (such as interneurons and local circuit neurons) also exist in the intracardiac ganglia (2, 3, 21, 30, 51). Therefore, we used a transported florescent dye (red color DiI) to retrograde-label CPP and CPS neurons. Rats were anesthetized with 2% isoflurane and artificially ventilated. The left thoracotomy was done. Twenty to twenty-five injections (2 μl DiI for each injection) were made subepicardially into left and right atria and ventricles using a glass micropipette connected to a 1 WPI Nanoliter 2000 microinjector (48). The surgical incision was closed, and terminal experiments were performed at least 3 days after labeling surgery because we found that 3 days are needed for dye diffusion to the neurons (data not shown).

Single-cell real-time RT-PCR for calcium channel mRNA.

Single-cell real-time RT-PCR was performed as described previously (36). Briefly, SG and ICG neurons were isolated (see below) and loaded in a chamber with regular extracellular solution (in mM): 137 NaCl, 5.4 KCl, 1 MgCl₂, 2 CaCl₂, 10 HEPES, and 10 glucose with pH 7.4. DiI-labeled CPP or CPS neurons were used for single-cell real-time RT-PCR. A patch-clamp pipette (1–3 MΩ resistance) was used to break the membrane of single neuronal cells. Under suction conditions, the cell and pipette's contents were expelled into a 0.2 ml PCR tube containing mRNA-preserving reagents and then mixed with RT reaction buffer. RT was performed at 42°C for 30 min, and the cDNA was then stored at −80°C. The primers (Table 1) were based on the cDNA sequences of RPL19 (housekeeping gene) and Ca²⁺ channel subunits (Ca_v1.2, Ca_v1.3, Ca_v2.1, Ca_v2.2, and Ca_v2.3). PCR reaction was performed in a 25 μl volume containing 12.5 μl iQ Syber Green Supermix (Bio-Rad), 200 nM (in the first round) or 300 nM (in the second round) of each primer. The cDNA was amplified by real-time quantitative PCR with an ABI StepOnePlus Real-Time PCR System. For quantification, Ca²⁺ channel genes were normalized to the expressed housekeeping gene RPL19. The data were analyzed by the 2^−ΔΔCt method (38).

Table 1.

Primer sequences

Gene Accession No.	Primer Name	Primer Sequence (5′–3′)
NM012517	Cav1.2-forward	GGCAATGCGACCATCTCTACC
	Cav1.2-reverse	CCCCTGCTTCTTGGGTTTCC
	Cav1.2-internal	ACTGCTGCCGCTTCCGCTGTGT
NM017298	Cav1.3-forward	TGTTCGTGGATGATGATGATGATG
	Cav1.3-reverse	CTGGTGCCTCTTGCATAGTTTG
	Cav1.3-internal	CGTGGTCCTCTTGCTGCTGCCGTT
NM012918	Cav2.1-forward	GGGAATAACTTCATCAACCTGAGC
	Cav2.1-reverse	ATCAGCAGACAGACATAAGGTAGG
	Cav2.1-internal	TTCTCCGCCTCTTCCGTGCTGCC
NM0147141	Cav2.2-forward	TCCTAGCCAGGTGTCCCATC
	Cav2.2-reverse	CTTTTCCAGGGACCTCTGCTTC
	Cav2.2-internal	CCACCACCACCGCTGCCACCG
NM019294	Cav2.3-forward	GAGCGGAGTCTGGATGAAGG
	Cav2.3-reverse	TCCTGAGTTCTCTCTTCTTCATGG
	Cav2.3-internal	TGGCTCCTTGCTCCTGTGGCTGCT
NM031103	RPL19-forward	CTGAAGGTCAAAGGGAATGTGTTC
	RPL19-reverse	TTCGTGCTTCCTTGGTCTTAGAC
	RPL19-internal	TGCGAGCCTCAGCCTGGTCAGCC

Ca_v, voltage-gated calcium channel.

Immunofluorescence staining for calcium channels.

Our previous study has reported that Western blot analysis could not be used as an appropriate method to measure the protein expression of the Ca²⁺ channel subunits in the ICG because of the limitation of the tiny ICG tissue (37). Therefore, we used immunofluorescence staining to measure protein expression of the Ca²⁺ channel subtypes in the ICG and SG.

Isolated SG and ICG were postfixed in 4% paraformaldehyde, followed by soaking of the SG and ICG in 30% sucrose for 12 h at 4°C for cryostat protection. The SG and ICG were cut into 10-μm-thick sections at −20°C and then mounted on precoated glass slides. The sections were incubated with 10% donkey serum for 1 h followed by incubation with rabbit antibodies against calcium channel subtypes (Ca_v1.2, Ca_v1.3, Ca_v2.1, Ca_v2.2, or Ca_v2.3; Alomone Labs, Jerusalem, Israel) and goat anti-choline acetyltransferase (ChAT) antibody (a cholinergic neuronal marker for ICG, Abcam, Cambridge, MA) or mouse anti-tyrosine hydroxylase (TH) antibody (an adrenergic neuronal marker for SG, Sigma-Aldrich, St. Louis, MO) overnight at 4°C. Then the sections were incubated with fluorescence-conjugated secondary antibodies (Invitrogen, Carlsbad, CA) for 60 min at room temperature. Slides were observed under a Leica fluorescent microscope with corresponding filters. Pictures were captured by a digital camera system from one sham-operated animal and one CHF animal on the same day, and fixed exposure time was used for picture capturing of each gene. No staining was seen when PBS was used instead of the primary antibody in the above procedure.

Expression of Ca²⁺ channel subtypes was quantified using Adobe Photoshop CS5 (Photoshop Extended). Cells were selected using a Lasso tool. After a measurement scale was set (1 pixel = 1 pixel), the integrated density (optical density, OD) of the Ca²⁺ channel subtype image (red color) in each ChAT- or TH-positive cell was automatically measured by clicking record measurements in the analysis menu and normalized to the background signal (black area) in each picture. The data per rat were obtained by calculating 100 cells from 10 slices.

Isolation of ICG and SG neurons.

Isolated SG and ICG were placed in ice-cold modified Tyrode's solution (in mM): 140 NaCl, 5 KCl, 10 HEPES, and 5 glucose, respectively. The SG or ICG were minced into small pieces with microscissors and incubated for 30 min at 37°C in an enzymatic modified Tyrode's solution containing 0.1% collagenase and 0.1% trypsin. The tissues were then transferred to a modified Tyrode's solution containing 0.2% collagenase and 0.5% bovine serum albumin for 30 min of incubation at 37°C. The isolated cells from SG or ICG were cultured at 37°C in a humidified atmosphere of 95% air-5% CO₂ for 4 to 8 h before the patch-clamp experiments.

Whole cell recording for calcium currents and action potentials.

Ca_v currents and action potential were recorded only in DiI-labeled CPP or CPS neurons by the whole cell patch-clamp technique using Axopatch 200B patch-clamp amplifier (Axon Instruments) (37).

In the voltage-clamp experiment, resistance of the patch pipette was 4–6 MΩ when filled with the following solution (in mM): 120 CsCl, 1 CaCl₂, 40 HEPES, 11 EGTA, 4 MgATP, 0.3 Tris-GTP, 14 creatine phosphate, and 0.1 leupeptin (pH 7.3; 305 mosM). The extracellular solution consisted of (in mM): 140 TEA-Cl, 5 BaCl₂, 1 MgCl₂, 10 HEPES, 0.001 TTX, 2 4-AP, and 10 glucose (pH 7.4; 310 mosM). Series resistance of 5–13 MΩ was electronically compensated 30–80%. Junction potential was calculated to be +7.9 mV using pCLAMP 10.2 software, and all values of membrane potential given throughout were corrected using this value. Current traces were sampled at 10 kHz and filtered at 5 kHz. The holding potential was −80 mV and current-voltage (I–V) relationships were elicited by 5-mV step increments to potentials between −60 and 60 mV for 500 ms. Peak currents were measured for each test potential, and current density was calculated by dividing peak current by cell membrane capacitance (32.9 ± 2.9 pF in sham and 30.6 ± 2.8 pF in CHF CPP neurons, P > 0.05; 22.7 ± 2.8 pF in sham and 23.3 ± 2.4 pF in CHF CPS neurons, P > 0.05).

In the current-clamp experiments, action potential was elicited by a ramp current injection of 0–100 pA and the current threshold-inducing action potential or threshold potential was measured at the beginning of the first action potential. Frequency of action potentials was measured in a 1-s current clamp. Input resistance was determined from the linear fit of the neuronal voltage response to hyperpolarizing current injections (20-pA step decrement from 0 to −100 pA for 1 s). The patch pipette solution was composed of (in mM) 105 K-aspartate, 20 KCl, 1 CaCl₂, 5 MgATP, 10 HEPES, 10 EGTA, and 25 glucose (pH 7.2; 320 mosM). The bath solution was composed of (in mM) 140 NaCl, 5.4 KCl, 0.5 MgCl₂, 2.5 CaCl₂, 5.5 HEPES, 11 glucose, and 10 sucrose (pH 7.4; 330 mosM). Junction potential was calculated to be +12.3 mV and membrane potential was corrected using this value. P-clamp 10.2 program (Axon Instruments) was used for data acquisition and analysis. All experiments were done at room temperature (22–24°C).

Compounds.

ω-Conotoxin GVIA (a specific N-type Ca²⁺ channel blocker, Alomone Labs) was used in the electrophysiological experiments. Based on the previous study (31) and our preliminary data, the concentration of ω-conotoxin GVIA (1 μM) used in the present study is a saturating concentration for inhibiting N-type Ca²⁺ channels.

Data analysis.

All data are presented as means ± SE. SigmaPlot 12 was used for data analysis. Statistical significance was determined by Student's unpaired t-test for hemodynamic, expression of Ca²⁺ channel subtypes. A two-way ANOVA with post hoc Bonferroni test was used in the electrophysiological parameters. Statistical significance was accepted when P < 0.05.

RESULTS

Hemodynamic and morphological characteristics of sham and CHF rats.

Table 2 summarizes the hemodynamic and morphological characteristics of the sham and CHF rats. In the CHF rats, a gross examination displayed a dense scar in the anterior ventricular wall and an average myocardial infarct size over 30% of the left ventricular area. Heart weight-to-body weight ratio was significantly higher in CHF rats compared with sham rats. In addition, left ventricular end-diastolic pressure was increased in CHF rats, compared with sham rats. Heart rate was mildly increased in CHF rats (P < 0.05). These data suggest the development of CHF. However, there were no significant differences in arterial blood pressure between sham and CHF rats.

Table 2.

Hemodynamic and morphological characteristics of sham and CHF rats

	Sham	CHF
n	48	49
Body weight, g	403.8 ± 1.6	406.6 ± 2.2
Mean blood pressure, mmHg	100.5 ± 0.7	103.4 ± 0.8
Heart rate, beats/min	343 ± 3	355 ± 4*
Heart weight/body weight, mg/g	3.55 ± 0.1	5.69 ± 0.10*
Infarct size, % of left ventricle	0	34.9 ± 0.6*
LVEDP, mmHg	1.9 ± 0.2	16.8 ± 0.4*

Data are means ± SE. CHF, chronic heart failure; LVEDP, left ventricular end-diastolic pressure.

^*P < 0.05 vs. sham.

mRNA expression of Ca²⁺ channel subtypes in CPP and CPS neurons from sham and CHF rats.

CPP neurons in ICG and CPS neurons in SG were identified by DiI retrograde-labeling (see details in materials and methods). At present, five subtypes (L, P/Q, N, R, and T) of the voltage-gated Ca²⁺ channel α-subunits have been identified on the basis of functional properties (42). We measured the mRNA expression of L (Ca_v1.2 and Ca_v1.3), P/Q (Ca_v2.1), N (Ca_v2.2), and R (Ca_v2.3) subtypes of the voltage-gated Ca²⁺ channel α-subunits in CPP and CPS neurons from sham and CHF rats because previous studies (42, 69) have reported that the T (Ca_v3.1, Ca_v3.2, and Ca_v3.3) subtype of Ca²⁺ channels could not be detected in the rat ICG and SG.

Single-cell real-time RT-PCR analysis of the Ca²⁺ channel α-subunits in the CPP and CPS neurons is shown in Fig. 1. The mRNA of Ca_v1.2, Ca_v1.3, Ca_v2.1, Ca_v2.2, and Ca_v2.3 was expressed in the CPP neurons. The mRNA expression of Ca_v2.2 in the CPP neurons from CHF rats was lower than that in CPP neurons from sham rats (Fig. 1). There was no significant difference in mRNA expression of the other Ca²⁺ channel α-subunits between sham and CHF rats.

Fig. 1.

Single-cell mRNA expression of L (Ca_v1.2 and Ca_v1.3)-, P/Q (Ca_v2.1)-, N (Ca_v2.2)-, and R (Ca_v2.3)-type Ca²⁺ channel α-subunits in the cardiac postganglionic parasympathetic (CPP) and sympathetic (CPS) neurons from sham-operated (Sham) and chronic heart failure (CHF) rats. Data are means ± SE; n = 20 neurons in each group. *P < 0.05 vs. sham rats.

In the CPS neurons, CHF did not induce the alteration in mRNA expression of the Ca²⁺ channel α-subunits, compared with that from sham rats (Fig. 1).

Protein expression of Ca²⁺ channel subtypes in ICG and SG from sham and CHF rats.

Using cholinergic neuronal marker (ChAT) and adrenergic neuronal marker (TH), we identified the postganglionic parasympathetic neurons in ICG and sympathetic neurons in SG, respectively (Figs. 2 and 3). In the postganglionic parasympathetic neurons, protein expression of voltage-gated Ca²⁺ channel α-subtypes (Ca_v1.2, Ca_v1.3, Ca_v2.1, Ca_v2.2, and Ca_v2.3) could be detected (Fig. 2). Additionally, an important finding was that CHF reduced the protein expression of N-type Ca²⁺ channel α-subunit (Ca_v2.2) but not the protein expression of other Ca²⁺ channel α-subtypes in the parasympathetic neurons, compared with sham parasympathetic neurons (Fig. 2).

Fig. 2.

Representative (A) and summary (B) data are shown for protein expression of the Ca²⁺ channel α-subunits in the intracardiac ganglia (ICG) neurons from sham and CHF rats. ChAT, choline acetyltransferase, a cholinergic neuronal marker. AU, arbitrary units. Data are means ± SE; n = 5 rats in each group (data per rat obtained by calculating 100 cells from 10 slices). *P < 0.05 vs. sham rats.

Fig. 3.

Representative (A) and summary (B) data are shown for protein expression of Ca²⁺ channel subtypes in the stellate ganglia neurons from sham and CHF rats. TH, tyrosine hydroxylase, an adrenergic neuronal marker. Data are means ± SE; n = 5 rats in each group (data per rat obtained by calculating 100 cells from 10 slices).

Immunofluorescence data showed that there is no significant difference in the protein expression of voltage-gated Ca²⁺ channel α-subtypes in sympathetic neurons between sham and CHF rats (P > 0.05, Fig. 3).

Ca²⁺ currents and cell excitability in CPP neurons from sham and CHF rats.

As shown in Fig. 4A, CPP neurons were labeled by DiI and identified by the microscope with fluorescent filter. Ca²⁺ currents (Fig. 4) and action potentials (Fig. 5) were recorded in the CPP neurons from sham and CHF rats. CHF markedly reduced total Ca²⁺ currents in the CPP neurons, compared with sham conditions (Fig. 4, B and C). The saturating concentration of a specific N-type Ca²⁺ channel blocker (1 μM ω-conotoxin GVIA) significantly decreased Ca²⁺ currents to the same level in the CPP neurons from sham and CHF rats, which suggests that there is no significant difference in L-, P/Q-, and R-type Ca²⁺ currents of the CPP neurons between sham and CHF rats (Fig. 4, B and C). The N-type Ca²⁺ currents were obtained by subtracting the Ca²⁺ currents under treatment of ω-conotoxin GVIA from total Ca²⁺ currents (control, Fig. 4B). N-type Ca²⁺ currents were lower in the CPP neurons from CHF rats (Fig. 4D). Electrophysiological data further confirmed the single-cell real-time RT-PCR and immunofluorescent results (Figs. 1 and 2) that CHF lowered the function of only the N-type Ca²⁺ channels in the CPP neurons.

Fig. 4.

A: DiI-labeled ICG neuron (cardiac postganglionic vagal neuron) with white color in fluorescent light. B–D: original recording (B), total Ca²⁺ current density (I_Ca; C), and N-type Ca²⁺ current density (D) in the cardiac postganglionic vagal neurons from sham and CHF rats. Dotted lines indicate the zero current level in B. The N-type Ca²⁺ current density was obtained by subtracting the Ca²⁺ currents under treatment of ω-conotoxin GVIA from total Ca²⁺ currents (control). Mean data for Ca²⁺ currents elicited by 500-ms test pulse at −5 mV from holding potential of −80 mV are shown in C and D. ω-Conotoxin GVIA, a specific N-type Ca²⁺ channel blocker. Data are means ± SE; n = 9 neurons in each group. *P < 0.05 vs. sham control; #P < 0.05 vs. CHF control.

Fig. 5.

Current threshold-inducing action potential (A and B) and frequency of action potentials (C and D) are shown before and after treatment of ω-conotoxin GVIA (1 μM) in the cardiac postganglionic vagal neurons from sham and CHF rats. Data are means ± SE, n = 9 neurons in each group. *P < 0.05 vs. sham control; #P < 0.05 vs. CHF control.

We measured current threshold-inducing action potential and frequency of action potentials to compare cell excitability of the CPP neurons between sham and CHF rats (Fig. 5). The current threshold-inducing action potential was enhanced in the CPP neurons from CHF rats (56.9 ± 6.9 pA; P < 0.05), compared with the CPP neurons from sham rats (29.3 ± 1.6 pA, Fig. 5, A and B). ω-Conotoxin GVIA (1 μM) significantly raised the current threshold-inducing action potential in the CPP neurons from sham and CHF rats (Fig. 5B). Anther parameter of cell excitability, frequency of action potentials, is lower in the CPP neurons from CHF rats (7.8 ± 1.6 spikes/s) than that in sham neurons (16.4 ± 1.0 spikes/s; P < 0.05; Fig. 5, C and D). ω-Conotoxin GVIA (1 μM) markedly decreased the frequency of action potentials in CPP neurons from sham and CHF (Fig. 5D).

Additionally, CHF also slowed down the maximum rate of depolarization of action potentials, lengthened the action potential duration at 90% repolarization, and caused the threshold potential to become less negative in the CPP neurons (Table 3). However, there was no significant difference in resting membrane potential, input resistance, overshoot of the action potential, and afterhyperpolarization amplitude in the CPP neurons between sham and CHF rats (Table 3).

Table 3.

CHF-induced electrophysiological changes on action potentials in rat cardiac postganglionic parasympathetic and sympathetic neurons

	RMP, mV	Ri, GΩ	Vmax, mV/ms	Overshoot, mV	AHP Amplitude, mV	APD90, ms	Threshold Potential, mV
CPP neurons
Sham	−59.8 ± 2.0	0.80 ± 0.09	149.5 ± 6.6	78.3 ± 3.9	11.2 ± 1.0	3.9 ± 0.2	−36.0 ± 1.5
Sham + ω-conotoxin GVIA	−60.6 ± 2.4	0.77 ± 0.12	91.4 ± 8.9*	75.3 ± 3.5	9.7 ± 1.5	5.1 ± 0.3*	−22.2 ± 1.6*
CHF	−60.4 ± 1.8	0.62 ± 0.11	111.0 ± 3.8*	75.5 ± 2.4	9.7 ± 1.5	5.0 ± 0.5*	−25.2 ± 1.4*
CHF + ω-conotoxin GVIA	−61.2 ± 2.7	0.60 ± 0.06	81.9 ± 4.3#	74.9 ± 3.7	8.6 ± 0.8	5.6 ± 0.4	−19.8 ± 2.4#
CPS neurons
Sham	−53.5 ± 2.1	0.88 ± 0.10	124.4 ± 8.1	79.6 ± 2.4	10.4 ± 1.2	3.7 ± 0.1	−26.1 ± 1.0
Sham + ω-conotoxin GVIA	−53.1 ± 2.1	0.84 ± 0.13	93.6 ± 7.4*	77.6 ± 3.3	9.1 ± 1.2	4.6 ± 0.2*	−19.7 ± 1.3*
CHF	−53.0 ± 2.1	1.05 ± 0.20	164.5 ± 11.2*	81.2 ± 2.0	12.4 ± 2.1	3.1 ± 0.2*	−33.0 ± 2.0*
CHF + ω-conotoxin GVIA	−52.3 ± 2.0	1.00 ± 0.12	102.0 ± 11.7#	78.5 ± 2.2	10.8 ± 0.9	4.3 ± 0.3#	−22.5 ± 1.0#

Data are means ± SE. CPP, cardiac postganglionic parasympathetic neurons; CPS, cardiac postganglionic sympathetic neurons; RMP, resting membrane potential; R_i, input resistance; V_max, maximum rate of depolarization of action potentials; AHP, afterhyperpolarization; APD₉₀, action potential duration at 90% repolarization. n = 9 cells/group for CPP neurons and n = 8 cells/group for CPS neurons.

^*P < 0.05 vs. Sham;

^#P < 0.05 vs. CHF.

Ca²⁺ currents and cell excitability in the CPS neurons from sham and CHF rats.

Similarly, we also measured the Ca²⁺ currents and cell excitability in the CPS neurons from sham and CHF rats (Fig. 6). Total Ca²⁺ currents were increased in the CPS neurons from CHF rats, compared with the CPS neurons from sham rats (Fig. 6, A–a and A–b). ω-Conotoxin GVIA (1 μM) inhibited the Ca²⁺ currents to the same level in the CPS neurons from sham and CHF rats (Fig. 6, A–b), which suggests that there is no significant difference in L-, P/Q-, and R-type Ca²⁺ currents of the CPS neurons between sham and CHF rats. Similarly, the N-type Ca²⁺ currents were obtained by subtracting the Ca²⁺ currents under treatment of ω-conotoxin GVIA from total Ca²⁺ currents (control). CHF increased the N-type Ca²⁺ currents in the CPS neurons, compared with sham neurons (Fig. 6, A–c).

Fig. 6.

A: original recording (a), total Ca²⁺ current density (b), and N-type Ca²⁺ current density (c) in the cardiac postganglionic sympathetic neurons (DiI-labeled stellate ganglia neurons) from sham and CHF rats. Dotted lines indicate the zero current level in A–a. The N-type Ca²⁺ current density was obtained by subtracting the Ca²⁺ currents under treatment of ω-conotoxin GVIA from total Ca²⁺ currents (control). Mean data for Ca²⁺ currents elicited by 500-ms test pulse at 0 mV from holding potential of −80 mV are shown in A–b and A–c. B: original recording of action potentials (a), current threshold-inducing action potential (b), and frequency of action potentials (c) in the cardiac postganglionic sympathetic neurons from sham and CHF rats. ω-Conotoxin GVIA, a specific N-type Ca²⁺ channel blocker. Data are means ± SE; n = 8 neurons in each group. *P < 0.05 vs. sham control; ^#P < 0.05 vs. CHF control.

CHF decreased current threshold-inducing action potential and increased frequency of action potentials in the CPS neurons (21.6 ± 2.4 pA and 26.3 ± 3.9 spikes/s), compared with the CPS neurons from sham rats (31.4 ± 2.8 pA and 15.9 ± 2.8 spikes/s; P < 0.05; Fig. 6B). ω-Conotoxin GVIA (1 μM) raised current threshold-inducing action potential and lowered frequency of action potentials in the CPS neurons from sham and CHF rats (Fig. 6, B–b and B–c).

Furthermore, CHF increased the maximum rate of depolarization of action potentials, shortened the action potential duration at 90% repolarization, and caused the threshold potential to shift to more negative in the CPS neurons (Table 3). However, CHF did not significantly alter the resting membrane potential, input resistance, overshoot of the action potential, and afterhyperpolarization amplitude in the CPS neurons (Table 3).

DISCUSSION

The findings in the present study are that 1) CHF significantly reduced mRNA, protein, and current density of the N-type Ca²⁺ channels and lowered the cell excitability in the CPP neurons (Figs. 1, 2, 4, and 5); and 2) although CHF did not affect mRNA and protein expression of the voltage-gated Ca²⁺ channels, CHF markedly increased current density of the N-type Ca²⁺ channels and cell excitability in the CPS neurons (Figs. 1, 3, and 6). These results suggest that CHF can induce molecular and cellular alterations of the CPP and CPS neurons. The changes of CPP and CPS neurons might contribute to the withdrawal of cardiac vagal activity and the sympathetic hyperactivity reported in the CHF state (6, 15, 23, 49, 53, 56, 61).

Parasympathetic nervous system and dysfunction of CPP neurons in CHF.

Although abundant evidence shows that overactivation of the sympathetic nervous system is associated with a worse outcome in CHF patients (46), involvement of the disordered parasympathetic function in disease progression and prognosis of CHF patients is only beginning to be recognized (44, 45).

The preganglionic parasympathetic (vagal) fibers originate within the central nervous system at the level of the brainstem (nucleus ambiguous and nucleus tractus solitaries). In the heart, the axons of these preganglionic vagal efferents extend to the ICG located in cardiac fat pads to form synapses with the CPP neurons (44, 60). In general, as a final common pathway for the vagal control of the cardiac function, the CPP neurons can generate action potentials to activate acetylcholine release (a primary neurotransmitter involved in the vagal innervation of the heart) after receiving and integrating neurohumoral inputs from cardiac preganglionic vagal efferents (2, 3, 70). Acetylcholine released from CPP neuron terminals can bind to muscarinic acetylcholine receptors to regulate cardiac function (2, 60). Our previous study has demonstrated that baroreflex sensitivity is attenuated in coronary artery ligation-induced CHF rats(63). Additionally, parasympathetic activation and its physiological role in the heart are blunted in CHF state (8, 44). The results from CHF dogs indicate that CHF-blunted vagal control of the heart is due to the abnormal peripheral efferent limb of the parasympathetic nervous system, probably a defect at the ganglion level (7). In the present study, we found that the N-type Ca²⁺ channel expression and activation and the cell excitability of the CPP neurons were decreased in CHF rats (Figs. 1, 2, 4, and 5). Therefore, our data further provide the evidence that the decreased CPP neuron excitability might link to the blunted vagal control of the heart in CHF state. However, we did not measure the cardiac postganglionic vagal activity in the present study because very short cardiac postganglionic vagal fiber prevents us from a direct-recording of the nerve activity. Therefore, further studies are needed to clarify the correlation between the CPP neuron dysfunction and the blunted cardiac vagal tone in CHF.

In the present study, we found that repetitive action potentials were elicited in all CPP neurons from adult rats in response to a depolarizing current injection (100 pA, 1 s; Fig. 5). However, at least two firing patterns (phasic- and tonic-firing) in rat ICG neurons have been observed by other studies (58, 68). This discrepancy could be due to one or more of the following reasons. 1) The ICG plexus is complex and contains CPP neurons, interneurons, and local circuit neurons (2, 3, 21, 30, 51). Only CPP neurons (DiI-labeled ICG neurons) were used for the present study, whereas all types of the ICG neurons were employed in previous studies (58, 68). 2) The majority of adult rat ICG neurons are tonic firing, whereas just 15% of neonatal rat ICG neurons showed the repetitive action potentials in response to sustained depolarizing currents injection (16). The CPP neurons were obtained from adults rats in the present study; however, the action potential was recorded in neonatal rat ICG neurons in Cuevas's study (68). 3) The firing rate of ICG neurons is much higher at 22°C than at 37°C (16). Our whole cell patch-clamp recording for the action potential was done at 22–24°C. 4) Animal species and experimental conditions (such as in vivo or in vitro electrophysiological recording) possibly are the influencing factors. Additionally, it has been observed that the ability of local-circuit neurons to regulate cardiodynamics was impaired in the canines with pacing-induced early-stage heart failure (4). Combining with the results in the present study, we consider that all types of the ICG neurons were impacted by CHF. Therefore, care should be taken when extrapolating the data obtained in the present study to in vivo experiments and clinical analyses.

Voltage-gated Ca²⁺ channels are involved in the neuronal excitability and the release of neurotransmitters including acetylcholine (1, 5, 11, 74). CHF reduced the N-type Ca²⁺ channel mRNA level and protein expression but did not affect other type Ca²⁺ channel mRNA levels and protein expressions in the CPP neurons, compared with sham rats (Figs. 1 and 2). The patch-clamp data also showed that CHF only induced a decline of the N-type Ca²⁺ currents (Fig. 4), which was associated with lowered cell excitability in the CPP neurons from CHF rats (Fig. 5). These data indicate that CHF modulates the transcription and/or translation of the N-type Ca²⁺ channels to lower the N-type Ca²⁺ currents. Our previous study has shown that type 2 diabetes also decreases expression and current density of the N-type Ca²⁺ channels in the CPP neurons (37). From these data, we consider that CHF and type 2 diabetes might share the same endogenous signaling pathway to trigger the alteration of the N-type Ca²⁺ channels, which should be evaluated in further study.

Sympathetic nervous system and alterations of CPS neurons in CHF.

In contrast to the parasympathetic nervous system, the sympathetic nervous system is overactivated by CHF (15, 23, 49, 53, 56, 61). Data from the direct-recording of the cardiac postganglionic sympathetic nerve activity showed that CHF significantly enhanced the cardiac sympathetic nerve activity (data not shown), which further confirms that the cardiac sympathetic hyperactivity is observed in CHF state. Much evidence demonstrates that the activity of sympathetic nerves is determined by central neurons in the medulla oblongata that receive inputs from central and peripheral sensory afferents (28, 60). However, peripheral CPS neurons cannot be ignored. These neurons also influence the cardiac sympathetic nerve activity because they represent a key relay station for the sympathetic nervous system (27). Our present results demonstrate that the N-type Ca²⁺ currents and cell excitability were increased in CPS neurons from CHF rats (Fig. 6). Therefore, we believe that overexcitability of the CPS neurons probably links to the cardiac sympathetic nerve hyperactivity in CHF rats.

Although CHF increased the N-type Ca²⁺ currents in the CPS neurons, CHF did not affect mRNA level and protein expression of the Ca²⁺ channel α-subtypes in these neurons (Figs. 1 and 3). The results suggest that CHF-enhanced N-type Ca²⁺ currents are not due to transcriptional and translational modulations of Ca²⁺ channel α-subtypes in the CPS neurons from CHF rats. Overactivation of the N-type Ca²⁺ channels is possibly induced by some posttranslational modulations, such as phosphorylation of the N-type Ca²⁺ channels (59) and allosteric modulation of ion channels (20). Further study is needed to clarify the mechanism(s) responsible for CHF-enhanced N-type Ca²⁺ currents in the CPS neurons.

Other considerations.

We cannot confirm the protein expression of Ca²⁺ channel subtypes in the CPP and CPS neurons due to the limitation of the method (DiI labeling was lost from cells during the immunofluorescent staining procedure). However, single-cell real-time RT-PCR and electrophysiological data were obtained in the CPP and CPS neurons (DiI-labeled neurons). Additionally, the CPP or CPS neurons are a component of the ICG or SG neurons. It is reasonable to assume that our measurement in the present study represents the protein expression of Ca²⁺ channel subtypes in the CPP and CPS neurons.

Although we used a transported florescent dye (red color DiI) to retrograde-label cardiac sympathetic and vagal neurons, it is possible that DiI could affect the cell excitability in ICG and SG neurons. Using isolated neurons, we checked this possibility and found that DiI did not affect the cell excitability in the ICG and SG neurons (data not shown).

We realize that voltage-gated Na⁺ and K⁺ channels also are key factors in the initiation and propagation of action potential. In the present study, CHF caused the changes in the maximum rate of depolarization of action potentials and the action potential duration at 90% repolarization in the CPP and CPS neurons (Table 3). One possibility is that CHF also induces the alterations of voltage-gated Na⁺ and K⁺ channels in the CPP and CPS neurons. Further study is needed to evaluate this.

One limitation in the present study is that we could not distinctly separate the neurons from different parts of the heart (atria and ventricles) although we retrograde-labeled the neurons projecting to the heart. It is possible that the neurons projecting to different parts of the heart are heterogeneous. This issue should be addressed in further study.

In summary, CHF decreases the N-type Ca²⁺ channel currents and the cell excitability in the CPP neurons, whereas CHF increases the N-type Ca²⁺ currents and the cell excitability in the CPS neurons. These data suggest that CHF can induce the different alterations in the different peripheral ganglionic neurons through the different signaling transduction pathways. More importantly, CHF-induced alterations in the cardiac postganglionic vagal and sympathetic neurons might be involved in the cardiac vagal hypoactivity and sympathetic hyperactivity in CHF state. The findings provide potential therapeutics such as pharmaceutical and genetic therapies targeting N-type Ca²⁺ channels. The potential therapeutics can reduce mortality through improving cardiac vagal and sympathetic tone and suppressing the fatal ventricular tachyarrhythmia.

GRANTS

This study was supported in part by National Heart, Lung, and Blood Institute Grant HL-098503 (to Y. L. Li).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).

AUTHOR CONTRIBUTIONS

H.T., J.L., D.Z., and Y.L.L. conception and design of research; H.T., J.L., D.Z., and K.G.C. performed experiments; H.T., J.L., D.Z., H.Z., K.P.P., K.G.C., W.Z.W., R.L.M., and Y.L.L. analyzed data; H.T., J.L., D.Z., H.Z., K.P.P., K.G.C., W.Z.W., R.L.M., and Y.L.L. interpreted results of experiments; H.T., J.L., D.Z., and Y.L.L. prepared figures; H.T., J.L., D.Z., H.Z., K.P.P., K.G.C., W.Z.W., R.L.M., and Y.L.L. approved final version of manuscript; Y.L.L. drafted manuscript; Y.L.L. edited and revised manuscript.