Prevalence and genetic characterization of Cryptosporidium, Enterocytozoon, Giardia and Cyclospora in diarrheal outpatients in china

Abstract

Background

Cryptosporidium spp., Enterocytozoon spp., Giardia spp. and Cyclospora spp. are important intestinal protozoan parasites causing diarrhea in humans, livestocks and wildlife and have a significant impact on public health. No reports exist about simultaneous prevalence rates or genotyping data of these four parasites in outpatients from China.

Methods

Fecal specimens from 252 diarrhea patients in a pediatric clinic (n = 169) and an intestinal clinic (n = 83) of a hospital in Shanghai, China, were collected between October 2012 and March 2013. All samples were examined for the presence of the four parasites by using molecular methods.

Results

In total, 76/252 (30.16%) patients were positive for at least one intestinal parasite, of which Cryptosporidium spp., Enterocytozoon bieneusi and Giardia intestinalis were detected by nested PCR in 34 (13.49%), 34 (13.49%) and 17 (6.75%) of the fecal specimens, respectively. Sequence analysis showed that all Cryptosporidium-positive specimens were C. andersoni and that most G. intestinalis- positive patients were infected by assemblage C, which is usually found in canids, while only one sample was from assemblage B. Eight patients were co-infected with Cryptosporidium spp. and Enterocytozoon, while one was co-infected with Cryptosporidium and Giardia.

Conclusions

The patients infected with Cryptosporidium and Enterocytozoon bieneusi had higher infection rates in winter than in spring in this area. Data indicated that C. andersoni is the fourth major Cryptosporidium species infecting humans in addition to C. hominis, C. parvum and C. meleagridis. Our study also revealed a short-term outbreak of cryptosporidiosis and microsporidiosis and sporadic cases of giardiasis that occurred among humans in Shanghai, China.

Background

Cryptosporidiosis, microsporidiosis, giardiasis and cyclosporiasis are emerging infectious diseases. Cryptosporidium spp., Enterocytozoon spp., Giardia spp. and Cyclospora spp. are diarrhea-causing intestinal protozoans of humans (especially in AIDS patients), livestock and wildlife worldwide [1-4]. Although they are considered opportunistic pathogens, they have caused several outbreaks and emergency responses among humans and animals [5-9] These four parasites pose significant challenges to public health and water authorities, especially in developing countries because of the high prevalence and disease burden of the infections [10,11]. Furthermore, they exert negative pressure on the growth and cognitive functions of infected children and immunocompromised persons [1,12,13].

Cryptosporidium and microsporidia infect AIDS or immunodeficient patients, travelers, children and the elderly. C. parvum and C. hominis are the main human-pathogenic Cryptosporidium species, while C. muris and C. andersoni are minor zoonotic species, for which small numbers of human cases have recently been reported [14,15]. The prevalent microsporidia species E. bieneusi has been most frequently identified in human clinical fecal samples as well as in wild and domestic animals [16,17]. Molecular diagnostic tools have been used to trace the source of human infections and transmissions, thus confirming its zoonotic potential [18].

G. intestinalis is the etiologic agent of giardiasis, a common gastrointestinal disease in humans, livestock and companion animals. G. intestinalis is considered as a complex species and based on genetic analysis has been grouped into eight assemblages (A–H) [19,20]. Both assemblages A and B, which can be transmitted zoonotically, have a wide host range and are responsible for human infections [21,22]. Assemblages C–G appear to be strictly host-specific: C and D are found largely in canids, E in domestic mammals, F in cats, G in rodents and H in seals [1,23].

Cyclospora cayetanensis, an emerging human pathogen, causes severe diarrheal disease and has resulted in several foodborne outbreaks in humans [2,24,25]. The transmission dynamics of this parasite are still unknown. In previous studies, feces as well as contaminated water sources were considered as transmission routes [26,27].

Currently, no reports exist about simultaneous prevalence rates and genotyping data of cryptosporidiosis, microsporidiosis, giardiasis and cyclosporiasis in China. Therefore, this study focused on the prevalence and genetic characterizations of the four diseases in diarrhea outpatients of a pediatric clinic and an intestinal clinic in Shanghai and assessed their potential zoonotic transmission.

Methods

Ethical statement

Ethical clearance for the collection and examination of human feces samples was obtained from the Ethics Committee of the National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention, China (reference no. 2012–12). The objectives, procedures and potential risk were orally explained to all participants. Written informed consent was given to, and signed by all participating in the study. Parents/guardians provided consent on behalf of all infant participants.

Specimen collection and DNA extraction

Fecal specimens from 252 diarrhea patients in a pediatric clinic (n = 169) and an intestinal clinic (n = 83) of a hospital in Pudong, Shanghai, China, were collected between October 2012 and March 2013. Patient details, including their age, gender, address, frequency of diarrhea and consistency of stools, were recorded. Specimens were collected from patients with fecal excretion heavier than 200 g and with no less than three events of diarrhea per day. The stools consistency was usually thin and mixed with mucus or blood. Sufficient samples were collected for DNA extraction and purification using the QIAamp DNA stool Mini Kit (QIAGEN, Hilden, Germany). The extracted DNA was stored at -30°C for polymerase chain reaction (PCR).

Parasite identification in clinical samples

The small subunit (SSU) rRNA gene of Cryptosporidium was identified using a nested PCR [28]. The presence of E. bieneusi, G. intestinalis and Cyclospora in the specimens was detected using individual nested PCR and sequence analysis of the SSU rRNA gene [29], the triose phosphate isomerase (TPI) gene [30] and the 18S rRNA gene [31], respectively.

All primers used in the study are listed in Table  1. Go Taq® Green Master Mix (containing Go Taq® DNA Polymerase, dNTP mixture, Green Go Taq Reaction Buffer, MgCl₂; Promega) was used to amplify the genes of Cryptosporidium and G. intestinalis, while Premix Taq® (containing Taq DNA Polymerase, dNTP mixture, Taq Buffer, Tartrazine/Xylene Cyanol FF; Takara) was used to identify Enterocytozoon and Cyclospora genes. Each 25 μl reaction mixture contained 12.5 μl Taq mix, 1 μl of 10 μM sense and antisense primers each, 1 μl DNA template and 12.5 μl nuclease-free water.

Table 1.

Primers used for protozoan gene amplification

Genus	Gene	Sequence of primers (5´ → 3´)	Amplicon size (bp)
Cryptosporidium	SSUrRNA	CryF1: TTCTAGAGCTAATACATGCG	~1325
		CryR1: CCATTTCCTTCGAAACAGGA
		CryF2: GGAAGGGTTGTATTTATTAGATAAAG	~840
		CryR2: CTCATAAGGTGCTGAAGGAGTA
Microsporidia	SSUrRNA	EF1: GATGGTCATAGGGATGAAGAGCTT	~1200
		ER1: AATACAGGATCACTTGGATCCGT
		EF2: AGGGATGAAGAGCTTCGGCTCTG	~600
		ER2: AATATCCCTAATACAGGATCACT
Giardia	TPI	TPIF1: AAATIATGCCTGCTCGTCG	~605
		TPIR1: CAAACCTTITCCGCAAACC
		TPIF2: CCCTTCATCGGIGGTAACTT	~530
		TPIR2: GTGGCCACCACICCCGTGCC
Cyclospora	18SrRNA	CYCLF1: AATGTAAAACCCTTCCAGAGTAAC	~1000
		CYCLR1: GCAATA ATCTATCCCCATCACG
		CYCLF2: AATTCCAGCTCCAATAGTGTAT	~500
		CYCLR2: CAGGAGAAGCCAAGGTAGGCRTTT

The thermal profile of Cryptosporidium PCR consisted of 94°C for 1 min, 35 cycles of 94°C for 50 s, 55°C for 30 s and 72°C for 1 min, followed by 72°C for 10 min, with a hold step at 4°C. A second reaction was carried out similarly. Each specimen was analyzed at least three times by PCR with positive and negative controls in each run. The other amplification conditions varied in annealing temperature and extension time. For Enterocytozoon, the annealing step was at 57.4°C, and the extension step was at 72°C for 90 s; the annealing step for Giardia was at 57.5°C, and the extension step was at 72°C for 1 min. The cycling conditions for Cyclospora were as follows: the primary cycle consisted of 94°C for 1 min, 35 cycles of 94°C for 50 s, 56°C for 30 s and 72°C for 90 s, followed by 72°C for 10 min, and termination at 4°C. The secondary step differed in extension time (72°C for 1 min).

Sequencing of each gene

Secondary PCR products were directly sequenced on an ABI 3730 DNA Analyzer (Applied Biosystems, Foster City, USA) using the secondary primers and a Big Dye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems). The sequence accuracy was confirmed by two-directional sequencing and by sequencing a new PCR product if necessary.

Statistical analysis

ContigExpress was used to assemble sequences. Sequences were aligned using the program ClustalX 1.83 (ftp://ftp-igbmc.u-strasbg.fr/pub/ClustalX/). All statistical analyses were performed using SPSS version 17.0 (SPSS Inc., Chicago, IL). The chi-squqre test was used to analyse the data, with P < 0.05 considered to indicate significant differences.

Nucleotide sequence accession numbers

Representative nucleotide sequences were deposited in GenBank under the accession numbers KF271440 to KF271519.

Results

Occurrence of Cryptosporidium, Enterocytozoon, Giardia and Cyclospora

Cryptosporidium spp., E. bieneusi and G. intestinalis were detected by nested PCR in 34 (13.49%), 34 (13.49%) and 17 (6.75%) of the 252 fecal specimens, respectively (Table  2). Cyclospora was not detected. The Cryptosporidium-, E. bieneusi- and Giardia-positive patients were not restricted to a particular clinic. Polyparasitism was observed in nine of the 252 patients, eight of which were co-infected with Cryptosporidium and Enterocytozoon, while one was co-infected with Cryptosporidium and Giardia. No age-associated differences in the patients involved (ranging from 1 month to 77 years) was found in our study.

Table 2.

Sex ratio of Cryptosporidium , Enterocytozoon , Giardia and Cyclospora

Genus	Number of positive specimens (%)
	Male	Female	Total	Species/genotype
Cryptosporidium	23 (15.13)	11 (10.00)	34 (13.49)	C. andersoni
Enterocytozoon	22 (14.47)	12 (12.00)	34 (13.49)	-
Giardia	11 (7.24)	6 (6.00)	17 (6.75)	Assemblage C (16) Assemblage B (1)
Cyclospora	0	0	0	-
Total patients	152	100	252

Cryptosporidium species

Sequence analysis of Cryptosporidium indicated that all positive specimens belonged to C. andersoni, which is usually found in cattle. Patients tested in winter had a higher positivity rate (17.31%) than those tested in spring (7.29%, P = 0.024, Figure  1). However, no sex- or age-associated differences in detection rates were found (P > 0.05; Figure  2).

Figure 1.

Seasonal patterns of Cryptosporidium, Enterocytozoon and Giardia infections in humans. ▲: Chi-square analysis of seasonal differences in the rates of infection by Cryptosporidium: P < 0.05 (P = 0.024); Δ: Chi-square analysis of seasonal differences in the rates of infection by Enterocytozoon: P < 0.0001. ▀: Chi-square analysis of seasonal differences in the rates of infection by Giardia:P > 0.05 (P = 0.123).

Figure 2.

Age distribution of Cryptosporidium-, Enterocytozoon- and Giardia-positive patients in Shanghai, China.: total number of patients investigated in different months; : positive cases of Cryptosporidium; (dark gray square): Enterocytozoon-positive cases; (light gray square): positive cases of Giardia; ^*Chi-square analysis of age differences in the rates of infection by the three parasites: P > 0.05.

Enterocytozoon infections

Based on sequence analysis of the SSU rRNA gene, the microsporidia-positive outpatients were identified as E. bieneusi. Univariate analysis did not show any significant age- or sex-associated differences in E. bieneusi infection rates. However, patients showed higher detection rates for microsporidiosis in winter than in spring (P < 0.05; Figure  1).

Giardia genotyping

Of the 17 Giardia-positive patients, most isolates belonged to assemblage C, whereas only one belonged to assemblage B; this result differs from previous reports [4,21]. In addition, we found no differences associated with age, sex or season.

Discussion

Intestinal parasitic infections remain an important pathogenic factor of diarrhea in developing countries, especially among HIV-positive patients [32]. This study reports the epidemiological and genetic characterizations of four opportunistic intestinal parasites of outpatients from the pediatric clinic and intestinal clinic of a hospital in Shanghai, China. Using nested PCR and sequence analysis in this cross-sectional study, Cryptosporidium (13.49%), Enterocytozoon (13.49%) and Giardia (6.75%) were possible etiologic agents in this area. However, Cyclospora was not detected in these patients. A high proportion (3.17%) of polyparasitism was observed. The presence of co-infections was supported by the finding that these patients exhibited the most severe symptoms, with diarrhea frequencies reaching eight episodes per day.

C. andersoni is primarily found in cattle or in contaminated water [33,34], while few studies have reported C. andersoni infection in humans [15,35]. However, all Cryptosporidium-positive patients in this study were found to be infected with C. andersoni. The reasons for the occurrence of C. andersoni infection might be attributed to the environment, patient populations and geographic locations. Interestingly, our results were consistent with a recent study, which showed C. andersoni to be the dominant species in source and tap water in Shanghai [33]. Through genotyping, the researchers concluded that the contamination of source and tap water originated mainly from animal farms, especially, cattle farms. Similarly, C. andersoni was the most common species in the patients from our study, and sequence analysis suggested that contaminated water or infected cattles might be the possible transmission routes. In addition, the Yangtze River and Pudong Canal, which run through this area, are used for irrigation, livestock feeding and drinking water for residents. Extensive studies have reported seasonal differences in the distribution of C. parvum and C. hominis in the United Kingdom and New England, USA [36-38]. In Shanghai, increased C. andersoni detection rates during winter may have been due to changes in animal breeding, rainfall, travel and recreational activities.

Although E. bieneusi is nowadays considered to be an opportunistic pathogen in HIV-infected or organ transplant recipients, E. bieneusi infections have also been found in HIV-negative patients, immunocompetent and other healthy persons [39-42]. A recent study described a healthy man infected with a novel species of Microsporidium[43]. In the present study, 11 diarrheal adults (13.25%) and 23 children (13.61%) were detected with E. bieneusi, which suggested that this infection was not correlated with age in the study area(P > 0.05). However, humans were more susceptible to microsporidiosis in winter than in spring. The reason for this might be a reduced immunity and resistance during winter. Studies have reported E. bieneusi to be associated with acute and chronic diarrhea [44,45]. The sources of microsporidia infecting humans and its modes of transmission remain unclear. Due to the release of spores into the environment via stool and respiratory secretions, possible sources of infection might be humans or animals infected with microsporidia [4].

Genotyping results of G. intestinalis indicated that all but one positive specimens belonged to assemblage C, which is usually found in canids [46], thus suggesting that dogs may serve as sources of zoonotic transmission of giardiasis in this region. Sequence analyses of the TPI gene revealed that the only specimen from assemblage B had a high homology with an isolate from a primate in Japan [47].

Overall, patients in Shanghai were found to be detected with C. andersoni, E. bieneusi and G. intestinalis. These three intestinal protozoa can be transmitted through the fecal-oral or oral-oral routes, inhalation of aerosols or ingestion of food or water contaminated with fecal material [4,48]. Therefore, it can be speculated that family members may also be infected, although more questionnaires and comprehensive epidemiological investigations are required to confirm this hypothesis. It has been reported that contamination of food or water by animals such as cattle or canids are causes of several foodborne and waterborne outbreaks of cryptosporidiosis [49-51]. In order to better understand the source of infection, we will attempt to seek the cooperation of patients involved in future studies to investigate their habits, such as contact with animals, drinking water and water conditions. In addition, we will continue to monitor the patients from the intestinal clinic and the pediatric clinic to determine whether the observed prevalence rates will persist. We also aim to extend the investigation to family members to determine the existence of a household cluster outbreak.

Conclusions

Based on our study, intestinal parasites were common among the study population of diarrheal outpatients in this area in Shanghai, China, between October 2012 and March 2013, C. andersoni, E. bieneusi and G. intestinalis (mainly assemblage C) were the major parasite species. The source of these infections remains to be tracked to determine their potential zoonotic transmission route.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

Conceived and designed the experiments: Y.S. J.C. H.L. Performed the experiments: HL YS JY ZY YX YJ WP YH Analyzed the data: YS HL JY JC Contributed reagents/materials/analysis tools: J.C. Y.S. Wrote the paper: HL YS JC. All authors read and approved the final version of the manuscript.

Pre-publication history

The pre-publication history for this paper can be accessed here:

http://www.biomedcentral.com/1471-2334/14/25/prepub

Acknowledgments

We thank Yifei Fu and Yi Fei (Shanghai Pudong District Center for Disease Control and Prevention), and the hospital personnel for assistance in specimen collection. We also thank Professor Longxian Zhang (College of Animal Science and Veterinary Medicine, Henan Agricultural University Zhengzhou, Henan, China) for kindly gift the positive samples of Enterocytozoon bieneusi as positive control. This work was supported by grants from the Shanghai Public Health Outstanding Academic Leader (No. GWDTR201214, to Y.S.), the National S & T Major Program (Nos. 2012ZX10004-201 and 2013ZX10004805, to J.C.). Chinese Special Program for Scientific Research of Public Health (No. 201302004, to Y.S.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.