Skip to main content
NCBI home page
Evidence-based Complementary and Alternative Medicine : eCAM logoLink to Evidence-based Complementary and Alternative Medicine : eCAM
. 2014 Jan 28;2014:971890. doi: 10.1155/2014/971890

Olive Leaf Extract Attenuates Obesity in High-Fat Diet-Fed Mice by Modulating the Expression of Molecules Involved in Adipogenesis and Thermogenesis

Ying Shen 1, Su Jin Song 1, Narae Keum 1, Taesun Park 1,*
PMCID: PMC3927866  PMID: 24624222

Abstract

The present study aimed to investigate whether olive leaf extract (OLE) prevents high-fat diet (HFD)-induced obesity in mice and to explore the underlying mechanisms. Mice were randomly divided into groups that received a chow diet (CD), HFD, or 0.15% OLE-supplemented diet (OLD) for 8 weeks. OLD-fed mice showed significantly reduced body weight gain, visceral fat-pad weights, and plasma lipid levels as compared with HFD-fed mice. OLE significantly reversed the HFD-induced upregulation of WNT10b- and galanin-mediated signaling molecules and key adipogenic genes (PPARγ, C/EBPα, CD36, FAS, and leptin) in the epididymal adipose tissue of HFD-fed mice. Furthermore, the HFD-induced downregulation of thermogenic genes involved in uncoupled respiration (SIRT1, PGC1α, and UCP1) and mitochondrial biogenesis (TFAM, NRF-1, and COX2) was also significantly reversed by OLE. These results suggest that OLE exerts beneficial effects against obesity by regulating the expression of genes involved in adipogenesis and thermogenesis in the visceral adipose tissue of HFD-fed mice.

1. Introduction

Obesity is an energy balance disorder in which energy intake exceeds energy expenditure, resulting in excessive accumulation of white adipose tissue (WAT) [1]. Adipogenesis is the process by which the mesenchymal precursor cells differentiate into adipocytes [2]. Research over the past decade has established the Wnt/β-catenin signaling pathway as an important regulator of adipogenesis [3]. WNT10b expression inhibits adipogenesis by suppressing the expression of transcription factors, proliferator-activated receptor gamma (PPARγ), and CCAAT/enhancer-binding protein alpha (C/EBPα) [4], thereby inhibiting WAT development in vivo. Galanin has also been reported to play an essential role in regulating adipogenesis in animal models [5]. HFD-induced adipogenesis in the visceral adipose tissue of mice can be activated through the expression of galanin and its receptors together with the expression of the downstream molecules such as Ras, c-Raf, protein kinase C delta (PKCδ), and extracellular signal-regulated kinases (ERKs) that stimulate the activation of PPARγ and C/EBPα [5]. Thus, therapeutic agents that increase WNT10b expression and decrease galanin expression may suppress the expression of adipogenic molecules, thereby inhibiting adipogenesis [6].

Unlike WAT, brown adipose tissue (BAT) is an essential component of energy expenditure as it dissipates energy in the form of heat [7], a process known as thermogenesis. Adipose mitochondria play a pivotal role in adaptive thermogenesis, the key adipose-specific metabolic pathway that is regulated by peroxisome proliferator-activated receptor γ coactivator-1alpha (PGC-1α) [8]. This pathway oxidizes lipids and dissipates heat energy as a result of the uncoupling of the mitochondrial electron transport chain due to ATP production by uncoupling protein 1 (UCP1). Thermogenesis is elevated in the mitochondria-rich BAT, and it is also observed in WAT, which contains brown-like cells [9, 10]. Thermogenesis has been demonstrated to be modified by macronutrient content in the diet, dietary carbohydrate, and fat type [11, 12]. Phytochemicals like resveratrol [13] and epigallocatechin gallate [14] have been reported to increase energy expenditure and thermogenesis in animals and humans. Therefore, it is possible that novel therapeutic agents activating or elevating the expression of PGC-1α and UCP1 would have crucial impacts on increasing the energy expenditure to ultimately prevent obesity.

Olive (Olea europaea) leaf has been widely used in traditional remedies as well as in human diet as an extract, in herbal tea and in the powder form in the European and Mediterranean countries [15]. Olive leaf extract (OLE) is marketed as a natural nutraceutical with wide-ranging health benefits. In recent years, research has mainly focused on the effects of extracts from olive leaves related to the prevention of hypertension [16], atherosclerosis [17], cancer [18], diabetes [19], and cardiovascular diseases [20, 21]. Olive leaves contain several different compounds collectively termed as olive biophenols, which impart the therapeutic properties. The most abundant biophenol is oleuropein, followed by other biophenols such as verbascoside, luteolin, rutin, catechin, and hydroxytyrosol in lower quantities [22]. Our previous study demonstrated that the addition of oleuropein to HFD decreased body weight gain and improved the lipid profiles in the plasma of mice [23]. Although several studies have investigated the biochemical roles of olive leaves and olive leaves preparations, their protective effect against diet-induced obesity has never been reported. Therefore, the objective of this study was to investigate the weight-reducing effect of a well-defined OLE by supplementation in HFD-induced mice and to investigate the underlying mechanisms of this effect, with a particular focus on the expression of molecules involved in adipogenesis and thermogenesis.

2. Materials and Method

2.1. Materials

Dry OLE was obtained from Frutarom Switzerland Ltd. (Wädenswil, Switzerland) under the trade name of Benolea. The extract was manufactured from the dried leaves of Olea europaea L., applying an ethanol (80%, m/m) extraction procedure. After a patented filtration process (EFLA Hyperpure), the crude extract was dried. Finally, 15% (m/m) Acaciae Gummi Ph. Eur was added as a carrier together with <0.5% (m/m) of silica colloidalis anhydrica Ph. Eur. The extract is characterized by a DER of 3–7 = 1 (5 = 1). Characteristic component is 16–24% (m/m) oleuropein. Sibutramine was purchased from Sigma-Aldrich (MA, USA).

2.2. High-Performance Liquid Chromatography (HPLC) Analysis of OLE

HPLC analysis was conducted using the Nova-Pak C18 column (150 mm × 3.9 mm, 60 A, Waters Associates, Harrow, UK) at 25°C at a flow rate of 1 mL/min by using a gradient mobile phase (water : methanol in 600 : 400 ratio) as the initial condition of the chromatography. The sample injection volume used was 10 μL. The absorption signal of oleuropein was examined at 233 nm by using the UV detector (Agilent Technologies, DE, USA).

2.3. Animal and Diets

Five-week-old male C57BL/6N mice (Orient Bio, Gyeonggi-do, Korea) were housed in a pathogen-free facility at 21 ± 2.0°C, with 50 ± 5% relative humidity and a 12 h light/dark cycle; the mice were provided access to rodent chow and tap water ad libitum for 1 week. Thereafter, the mice were divided into the following 4 groups matched for body weight (n = 8 in each group): the chow diet (CD), high-fat diet (HFD), 0.15% (w/w) OLE-supplemented diet (OLD), and 0.01% (w/w) sibutramine-supplemented diet (SD) groups. The HFD consisted of 200 g fat/kg body weight (170 g of lard and 30 g of corn oil) and 1% (w/w) cholesterol. The OLD was identical to the HFD and contained 0.15% OLE. The SD was also identical to the HFD, except that it was supplemented with 0.01% sibutramine. The composition of the experimental diets including total energy (kcal/kg diet) is shown in Table 1. All the diets were provided in the form of pellets for 8 weeks.

Table 1.

Composition of the experimental diets.

Ingredients HFD
(g/kg diet)		 OLD
(g/kg diet)		 SD
(g/kg diet)
Casein 200 200 200
DL-methionine 3 3 3
Corn starch 111 109.5 110.9
Sucrose 370 370 370
Cellulose 50 50 50
Corn oil 30 30 30
Lard 170 170 170
Mineral mixture1 42 42 42
Vitamin mixture2 12 12 12
Choline bitartrate 2 2 2
Cholesterol 10 10 10
tert-Butylhydroquinone3 0.04 0.04 0.04
Olive leaf extract — 1.5 —
Sibutramine — — 0.1
Total (g) 1,000 1,000 1,000
Fat (% calories) 40 40 40
Total energy (kcal/kg diet) 4,616 4,616 4,616
Open in a new tab

1AIN-76A mineral mix.

2AIN-76A vitamin mix.

3Antioxidant agent: 0.01 g/50 g lipids.

The food intake was monitored daily, and body weights were recorded on a weekly basis. At the end of the experimental period, the mice were anesthetized with diethyl ether after they were fasted for 16 h. Blood samples were drawn from the inferior vena cava into an ethylene-diamine-tetra-acetic acid (EDTA)-coated tube, and the plasma samples were obtained by centrifuging the blood at 4000 ×g for 15 min at 4°C. The epididymal, retroperitoneal, mesenteric, and perirenal fat-pads were dissected, removed, weighed, and immediately snap-frozen in liquid nitrogen and stored at −80°C until further use. All animal experiments were performed in accordance with the Korea Food and Drug Administration (KFDA) guidelines. All the experimental protocols were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the Yonsei Laboratory Animal Research Center (YLARC).

2.4. Histological Analysis

The epididymal fat-pads were fixed in 10% buffered formalin and embedded in paraffin blocks. The paraffin blocks were sectioned and stained with hematoxylin-eosin (H&E). The sectional areas of the epididymal fat-pads were analyzed to quantify the size of the fat droplets.

2.5. Biochemical Analysis

Plasma concentrations of total cholesterol, triglyceride, HDL cholesterol, free fatty acid, and glucose were enzymatically determined using commercial kits (Bio-Clinical System, Gyeonggi-do, South Korea). Plasma levels of LDL + VLDL cholesterol were calculated by subtracting the HDL cholesterol level from the total cholesterol level. Plasma level of leptin was measured using a commercially available mouse enzyme-linked immunosorbent assay (ELISA) kit (Millipore, MA, USA).

2.6. RNA Extraction and Semiquantitative Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)

Total RNA was isolated from the epididymal adipose tissue of each mouse by using TRIzol (Invitrogen, CA, USA) and was reverse-transcribed using the superscript II kit (Invitrogen) according to the manufacturer's instructions. The GenBank accession numbers of the relevant templates and the forward (F) and reverse (R) primer sequences are shown in Table 2. The PCR was programmed as follows: 10 min at 94°C, 30–35 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, and 10 min incubation at 72°C. Then, 5 μL of each PCR product was mixed with 1 μL of 6-fold concentrated loading buffer; this solution was run on a 2% agarose gel containing ethidium bromide. The band intensities were quantified using the Quantity One Analysis Software (Bio-Rad, CA, USA). The mRNA levels were normalized to that of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcript.

Table 2.

Primer sequences and RT-PCR conditions.

Gene description Primers Sequences (5′→3′) T m (°C) Size (bp)
Peroxisome proliferator-activated receptor γ (PPARγ) F TTCGGAATCAGCTCTGTGGA 55 148
R CCATTGGGTCAGCTCTTGTG
CCAAT/enhancer binding-protein α (C/EBPα) F AAGGCCAAGAAGTCGGTGGA 55 189
R CCATAGTGGAAGCCTGATGC
Leptin F CTCCAAGGTTGTCCAGGGTT 55 143
R AAAACTCCCCACAGAATGGG
Cluster of differentiation 36 (CD36) F ATGACGTGGCAAAGAACAGC 55 160
R GAAGGCTCAAAGATGCCTCC
Fatty acid synthase (FAS) F TTGCCCGAGTCAGAGAACC 55 171
R CGTCCACAATAGCTTCATAGC
Wingless-type MMTV integration site family, member 10b (WNT10b) F TTTTGGCCACTCCTCTTCCT 61 183
R TCCTTTTCCAACCGAAAACC
Secreted frizzled-related protein 5 (SFRP5) F CTGATGGCCTCATGGAACAG 55 155
R CTTGGTGTCCTTGCGCTTTA
Galanin F GAGCCTTGATCCTGCACTGA 60 121
R AGTGGCTGACAGGGTCACAA
Galanin receptor 1 (GalR1) F CCAAGGGGGTATCCCAGTAA 55 147
R GGCCAAACACTACCAGCGTA
Galanin receptor 2 (GalR2) F ATAGTGGTGCTCATGCTGGAA 60 134
R AGGCTGGATCGAGGGTTCTA    
Protein kinase C δ (PKCδ) F CTGAGCGCTGCAAGAAGAAC 60 146
R TGGAAACTTTGATCCTGCACTGA
Peroxisome proliferative activated receptor γ coactivator 1α (PGC-1α) F TAAATCTGCGGGATGATGGA 55 117
R GTTTCGTTCGACCTGCGTAA
Uncoupling protein 1 (UCP1) F GGTTTTGCACCACACTCCTG 55 111
R ACATGGACATCGCACAGCTT
Cyclin D (cyc-D) F TGGGAAGTTTTGTTGGGTCA 55 144
R TCCTTGTCCAGGTAATGCCA
E2F1 F CCTGGAGCATGTTAAAGAAG 55 102
R CCTCGAGACCAAAGTGATAG
Sirtuin 1 (SIRT1) F AGCTCCTTGGAGACTGCGAT 55 182
R ATGAAGAGGTGTTGGTGGCA
Cytochrome C oxidase subunit 2 (COX2) F CCGAGTCGTTCTGCCAATAG 55 159
R AACCCTGGTCGGTTTGATGT
Mitochondrial transcription factor A (TFAM) F AGTGTGGCAGTCCATAGGCA 55 123
R CAGTGCTTTTAGCACGCTCC
Nuclear respiratory factor-1 (NRF-1) F TTTCATGGACCCAGGCATTA 55 119
R TGGTGGCCTGAGTTTGTGTT
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) F AGAACATCATCCCTGCATCC 55 321
R TCCACCACCCTGTTGCTGTA
Open in a new tab

2.7. Western Blotting

The epididymal adipose tissue samples obtained from each mouse were homogenized in an extraction buffer containing 100 mM Tris-HCl (pH 7.4), 5 mM EDTA, 50 mM NaCl, 50 mM sodium pyrophosphate, 50 mM NaF, 100 mM orthovanadate, 1% Triton X-100, 1 mM phenylmethanesulfonyl fluoride, 2 μg/mL aprotinin, 1 μg/mL pepstatin A, and 1 μg/mL leupeptin. The homogenates were centrifuged at 1,300 ×g for 20 min at 4°C. The protein concentrations of the tissue extracts were measured by Bradford assay (Bio-Rad). The protein samples were separated by 8% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and then electrophoretically transferred to nitrocellulose membranes (Amersham, Buckinghamshire, UK). The nitrocellulose membranes were incubated overnight with primary antibodies (diluted 1 : 1,000) at 4°C. Antibodies to the following proteins were commercially obtained from the indicated sources: β-catenin and β-actin from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and extracellular signal-related kinase (ERK), phospho-ERK (Thr202/Tyr204), cyclic AMP-responsive element-binding protein (CREB), and phospho-CREB (Ser133) from Cell Signaling Technology (MA, USA). The membranes were incubated with the corresponding secondary antibodies and the immunoreactive signals were detected using a chemiluminescent detection system (Amersham), followed by quantification using the Quantity One Analysis Software (Bio-Rad).

2.8. Statistical Analysis

The results on body weight gain, plasma biochemistries, and adipocyte diameter are presented as the mean ± standard error of mean (SEM) of 8 mice in each group. The RT-PCR and western blotting data are shown as the means ± SEM of three independent experiments (n = 2 or 3 per experiment) for each group, cumulatively including 8 mice. The statistical significance of difference was determined using one-way analysis of variance, followed by Duncan's multiple-range tests. All statistical analyses were performed with SPSS 21.0 software. P ≤ 0.05 was considered statistically significant.

3. Results

3.1. HPLC Analysis of OLE

HPLC analysis revealed that the OLE used in the present study, Benolea, contained 16% oleuropein (Figure 1).

Figure 1.

Figure 1

Open in a new tab

High-performance liquid chromatography (HPLC) chromatogram of the olive leaf extract (OLE). The peak was assigned based on the isolation of oleuropein.

3.2. Effects of OLE on Body and Visceral Fat-Pad Weights

HFD-fed mice showed significant increases in final body weight (38%, P < 0.05) and cumulative body weight gain (162%, P < 0.05) as compared with CD-fed mice. OLD-fed mice showed a 37% reduction in final body weight and an 80% decrease in body weight gain as compared with HFD-fed mice (Figures 2(a) and 2(b)). The food intake was also significantly lower in OLD-fed mice (−26%, P < 0.05) than in HFD-fed mice during the 8-week feeding period. The food efficiency ratio (FER) (−74%, P < 0.05) of OLD-fed mice was significantly lower than that of HFD-fed mice (Figures 2(c) and 2(d)). The cumulative caloric intake over 8 weeks was 26% less in OLD-fed mice than in HFD-fed mice (660 versus 887 kcal). The OLD group also showed significantly lower values for total visceral (epididymal, mesenteric, perirenal, and retroperitoneal) fat-pad weights (−72%, P < 0.05) than those observed in the HFD group. Histological sections from the epididymal adipose tissue of HFD-fed mice presented a greater adipocyte diameter as compared with CD-fed mice; this change in the adipocyte size was significantly reversed by OLE supplementation (−47%, P < 0.05) (Figures 2(e) and 2(f)). OLE had greater effects on lowering body weight, food intake, total visceral fat-pad weights, and adipocyte size than did sibutramine (Figures 2(a)–2(f)).

Figure 2.

Figure 2

Open in a new tab

Effects of OLE on body weight gain, food efficiency ratio (FER), and visceral fat-pad weights of HFD-fed mice. Mice were fed CD, HFD, OLD, or SD for 8 weeks. Changes in the (a) body weight, (b) body weight gain, (c) food intake, (d) FER, and (e) visceral fat-pad weights. (f) Histological analysis of the epididymal adipose tissue from each group was conducted to quantify the size of adipocyte. (Left) Representative pictures of hematoxylin-eosin (H&E)-stained fat cells from the mice epididymal adipose tissue (×100). (Right) Densitometric analysis of the average adipocyte diameter in the epididymal adipose tissue of mice. Values are presented as means ± SEM (n = 8). Mean values indicated with different letters indicate statistical significance (P < 0.05); FER = Body weight gain for experimental period (g)/food intake for experimental period (g).

3.3. Effects of OLE on Plasma Biochemistries

OLE supplementation resulted in significantly lower concentrations of triglyceride (−55%, P < 0.05), total cholesterol (−28%, P < 0.05), LDL + VLDL cholesterol (−62%, P < 0.05), FFA (−42%, P < 0.05), glucose (−17%, P < 0.05), and leptin (−69%, P < 0.05) in the plasma of HFD-fed mice (Figures 3(a)–3(f)). The effect of OLE on reducing the plasma levels of triglyceride, total cholesterol, and LDL + VLDL cholesterol was significantly greater than that of sibutramine (Figures 3(a)–3(c)). OLE significantly reduced the plasma FFA and leptin levels, similar to sibutramine (Figures 3(d) and 3(f)); however, OLE was less effective in reducing the plasma glucose level than was sibutramine (Figure 3(e)).

Figure 3.

Figure 3

Open in a new tab

Effects of OLE on plasma levels of lipids, glucose, and leptin in HFD-fed mice. (a) Triglyceride, (b) total cholesterol, (c) LDL + VLDL cholesterol, (d) free fatty acid, (e) glucose, and (f) leptin. Bars represent the mean ± SEM (n = 8). Mean values indicated with different letters indicate statistical significance (P < 0.05).

3.4. Effects of OLE on the Expression of Molecules That Regulate Adipogenesis

We investigated whether OLE affected HFD-induced activation of adipogenesis in the epididymal adipose tissue of mice. In the present study, we found that OLE significantly upregulated the expression of wingless-type MMTV integration site family, member 10b (WNT10b) (79%, P < 0.05), and low-density lipoprotein receptor-related protein 5 (LRP5) (26%, P < 0.05) and downregulated the expression of secreted frizzled-related protein 5 (SFRP5) (−59%, P < 0.05) in the epididymal adipose tissue of HFD-fed mice (Figure 4(a)). Western blotting of the epididymal adipose tissue of mice revealed a significantly higher protein level of β-catenin (300%, P < 0.05) in OLD-fed mice relative to HFD-fed mice (Figure 4(b)). Furthermore, compared with HFD-fed mice, OLD-fed mice showed significantly lower expression of galanin (−65%, P < 0.05), galanin receptor 1 (GalR1) (−62%, P < 0.05), galanin receptor 2 (GalR2) (−62%, P < 0.05), PKCδ (−74%, P < 0.05), cyclin D (Cyc-D) (−68%, P < 0.05), and E2F1 (−25%, P < 0.05) in the epididymal adipose tissue of mice (Figure 4(c)). OLE supplementation resulted in decreased protein levels of phosphorylated ERK (Thr202/Tyr204) (−38%, P < 0.05) in HFD-fed mice (Figure 4(d)). The mRNA levels of C/EBPα, PPARγ, and its target genes (CD36, FAS, and leptin) were significantly downregulated in OLD-fed mice as compared with those in HFD-fed mice (Figure 4(e)).

Figure 4.

Figure 4

Open in a new tab

Effects of OLE on genes regulating adipogenesis in the epididymal adipose tissue of HFD-fed mice. (a) Gene expression of SFRP5, WNT10b, and LRP5, (b) protein levels of β-catenin, (c) mRNA expression of genes involved in the galanin-mediated signaling pathway, (d) protein levels of p-ERK and total ERK, (e) expression of PPARγ2, C/EBPα, and their target genes. Reverse transcriptase-polymerase chain reaction (RT-PCR) data represent the relative density normalized to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Protein levels were normalized to the β-actin level. Data represent the results of three independent experiments (n = 2 or 3 per experiment); P < 0.05 indicates statistical significance. Values are the means ± SEM, n = 8 for each group.

3.5. Effects of OLE on the Expression of Molecules Involved in Thermogenesis

We next assessed whether OLE can induce thermogenesis in the epididymal adipose tissue of mice. The mRNA levels of mitochondrial protein cytochrome C oxidase subunit 2 (COX2) (93%, P < 0.05), mitochondrial transcription factor A (TFAM) (71%, P < 0.05), nuclear respiratory factor-1 (NRF-1) (53%, P < 0.05), sirtuin 1 (SIRT1) (87%, P < 0.05), PGC-1α (89%, P < 0.05), and UCP1 (77%, P < 0.05) were significantly elevated in OLD-fed mice than in HFD-fed mice (Figure 5(a)). OLE supplementation increased the protein level of phosphorylated CREB (450%, P < 0.05) in the epididymal adipose tissue of HFD-fed mice (Figure 5(b)).

Figure 5.

Figure 5

Open in a new tab

Effects of OLE on the expression of genes involved in thermogenesis in the epididymal adipose tissue of HFD-fed mice. (a) The expression of genes involved in uncoupled respiration and mitochondrial biogenesis was determined by RT-PCR and normalized to that of GAPDH; (b) protein levels of p-CREB and total CREB were determined by western blotting and normalized to β-actin protein levels. Data represent the results of three independent experiments (n = 2 or 3 per experiment); P < 0.05 indicates statistical significance. Values are the means ± SEM, n = 8 for each group.

4. Discussion

OLE is best known for its blood pressure-lowering effect in the global market of functional food industry. In 2008, OLE, under the trade name Benolea, was approved by KFDA as a health functional food that exerts blood pressure-lowering effect at a daily recommended dose of 500–1000 mg. In addition, a clinical trial conducted by Perrinjaquet-Moccetti et al. confirmed that no adverse event was observed at a daily given dose of 1000 mg [21]. The concentration of OLE (0.15%) used in the present study was in the same range as it was equivalent to an intake of approximately 732 mg/60 kg human body weight, when calculated on the basis of normalization to the body surface area as described by the recommendations by Reagan-Shaw et al. [24] and the US Food and Drug Administration (http://www.fda.gov/cder/cancer/animalframe.htm). Sibutramine is a monoamine-reuptake inhibitor [25] which was approved as an antiobesity drug by the FDA in 1997 and was marketed until 2010. In the present study, sibutramine was used as a positive control to evaluate the antiobesity effects of OLE.

OLE significantly decreased visceral fat-pad weight and plasma levels of triglyceride and FFA in HFD-fed mice. The decreased visceral fat accumulation might result in the reduced plasma level of FFA. The lower content of FFA, which flows into the liver through the portal vein, may cause less triglyceride synthesis in the liver, resulting in the decreased plasma level of triglyceride in OLD-fed mice. Histological analysis revealed a significantly decreased adipocyte size and an increased number of adipocyte in the OLD group than in the HFD group.

Several olive leaf constituents have been reported to exert beneficial effects against obesity both in vitro and in vivo. Oleuropein [23, 26], hydroxytyrosol [26, 27], luteolin [28], apigenin [29, 30], rutin [31], and caffeic acid [32] were found to decrease the accumulation of intracellular lipid, as detected by Oil Red O staining, and the expression of adipogenic transcription factors such as PPARγ and C/EBPα in 3T3-L1 cells. Hydroxytyrosol also exerts beneficial effects on the promotion of mitochondrial biogenesis via stimulation of the PGC-1α and its downstream target genes in 3T3-L1 cells [27]. Oleuropein and rutin decreased body weight gain and improved plasma lipid profiles and hepatic steatosis in HFD-fed mice [23, 31]. Caffeic acid also exhibited antiobesity effects by reducing body and visceral fat-pad weights, plasma levels of lipids, and obesity-related hormones such as leptin and insulin in HFD-fed mice [32]. On the basis of the results of these studies, we speculate that the weight-lowering effects of OLE can be derived from the combination of various weight-suppressing components.

Oleuropein, the bitter principle in olive leaf, accounted for 16% of the OLE used in this study. In our previous research, 0.03% oleuropein supplementation significantly reduced body weight gain (−55%) and plasma lipid levels in HFD-fed mice for 10 weeks [23]. In the present study, OLD (0.15% OLE-supplemented diet) contained 0.024% oleuropein and significantly decreased body weight gain (−80%) and obesity-related plasma biomarkers in mice after 8 weeks of feeding. Although OLD in the present study contained less oleuropein and was fed for a shorter period, it exerted better weight-lowering effects than those exhibited by oleuropein-supplemented diet in our previous study [23]. In addition, OLE significantly reduced food intake in the present study, whereas oleuropein alone did not affect food intake in mice [23]. Therefore, we suggest that the body weight-lowering effect of OLE can be derived not only from oleuropein but also from other active components present in olive leaves that may act concomitantly to reduce food intake and body weight gain.

OLE significantly reduced food intake by 26% in HFD-fed mice for 8 weeks. Several animal studies on OLE investigated its effects on glucose metabolism, ultraviolet B irradiation-induced skin changes, and wound healing [33–35]. Unfortunately, none of the studies presented data for daily food intake. It is well-known that GLP-1 is a satiety-signaling hormone that inhibits food intake by upregulating the expression of anorexigenic neuropeptides such as proopiomelanocortin (POMC) and cocaine- and amphetamine-regulated transcript (CART) [36]. In the present study, the plasma GLP-1 level was not measured because freshly collected plasma samples were not treated with dipeptidyl peptidase IV (DPP IV) inhibitor; without DPP IV inhibitor, GLP-1 is rapidly degraded in plasma. Green et al. demonstrated that oral gavage of dichloromethane extract of olive leaves improved glucose metabolism by significantly increasing plasma GLP-1 concentrations in mice [33]. Among the constituents of OLE, apigenin is known to inhibit food intake at the dosage of 0.05% by increasing the expression of POMC and CART in HFD-fed mice [29]. OLD used in the present study may contain much less apigenin than 0.05%, as, in an earlier report, leaf extract of Olea europaea L. contained 1.37% apigenin [37]. Further investigation is needed to confirm whether the food intake-reducing effect of OLE is exerted by its apigenin component.

Food efficiency ratio (FER), which is the ratio of body weight gain (g) to food intake (g), assesses utilization of food consumed. The unchanged FER demonstrates that the weight-lowering effect of a certain antiobesity agent is completely attributable to reduction in food intake. In the present study, OLE significantly decreased FER in HFD-fed mice, indicating that weight-lowering effect of OLE is mediated not only by the reduction of food intake but also by its direct effects on adipocytes. The effect of OLE in reducing the expression of adipogenic genes could be derived from both the direct inhibition of adipogenesis and the reduction of total caloric intake. PPARγ and C/EBPα [38] are the chief regulators that act synergistically to induce the expression of downstream target genes of adipogenesis, including FAS, CD36, and leptin. Animal studies have reported that WNT10b [4] and galanin [5] played important roles in regulating the expression of PPARγ2 and C/EBPα. WNTs, secreted proteins that act through autocrine and paracrine mechanisms, serve as a functional “brake” during preadipocyte recruitment into the differentiation program [3]. Of the 19 possible WNTs, WNT10b has been most clearly implicated as the endogenous WNT involved in regulating adipogenesis [39]. HFD decreased the binding of WNT10b to FZD receptors and to LRP5/6 coreceptors, leading to the activation of the cytoplasmic β-catenin degradation [6]. The decreased cytosolic accumulation and nuclear translocation of β-catenin led to decreased transcriptional coactivation of the T-cell factor (TCF)/lymphoid-enhancer factor (LEF) transcription factors, and eventually, upregulated the expression of PPARγ and C/EBPα [40]. OLE significantly reversed the HFD-induced decrease in the expression of WNT10b and LRP5, which may be associated with increased cytosolic accumulation of β-catenin.

In addition, it is noteworthy that the WNT signaling pathway is regulated by endogenous WNT inhibitors [3]. SFRP5, a WNT inhibitor, directly binds to and sequesters WNT10b from FZD receptors. Epigenetic activation of SFRP5 in WAT increased susceptibility to obesity in HFD-fed mice [41]. In the present study, SFRP5 expression was significantly reduced in the epididymal adipose tissue of OLD-fed mice than in HFD-fed mice. Therefore, we presume that OLE-mediated downregulation of WNT10b inhibitor, SFRP5, and upregulation of the ligand, WNT10b, may be related to the increased cytosolic accumulation of β-catenin and thus the reduction in adipogenesis and visceral adiposity.

The galanin-mediated signaling pathway is also involved in the regulation of adipogenesis. Galanin, a 29/30-residue neuropeptide, is expressed and widely distributed in the central nervous system [42]. However, recent studies have revealed that galanin expression has also been observed in peripheral tissues such as visceral adipose tissue and stomach [5]. Our previous study demonstrated that the expression of galanin, its receptors, and other genes involved in galanin-mediated signaling pathway was significantly elevated in the epididymal adipose tissues of HFD-fed mice [5]. Upon prolonged HFD consumption, GalR1 stimulated the mitogen-activated protein kinase activity in a PKC-independent manner and activated 1/2 ERKs. Activation of GalR2 increased the expression of phospholipase C (PLC) which catalyzes the cleavage of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-triphosphate and diacyl glycerol, a PKC activator. Subsequently, PKCδ induced the activation of ERK, which upregulated the expression of PPARγ and C/EBPα. In the present study, OLE significantly reversed HFD-induced elevation of the expression of genes (GalR1, GalR2, PKCδ, and ERK) in the epididymal adipose tissue of mice. Therefore, the effect of OLE on the reduction of visceral fat-pad weights is presumed to be associated with the downregulation of genes related to galanin-mediated adipogenesis in HFD-fed mice.

In addition to the inhibition of fat accumulation in WAT, improvement of the capacity of thermogenesis can also account for the body fat-lowering effect of OLE. Adaptive thermogenesis is defined as heat production in response to environmental temperature or diet, which protects the organism from exposure to cold or regulates the energy balance after changes in the diet [1]. Mitochondria, the organelles that convert food to carbon dioxide, water, and ATP, are indispensable for energy dissipation. Activation of UCP1, a mitochondrial proton transporter, enhances uncoupled respiration and thereby results in dissipation of oxidation energy as heat [1]. Galanin receptors [5] and SIRT1 [43] are known to reverse obesity-induced downregulation of UCP1 expression in WAT. Our previous study demonstrated that the HFD-induced overexpression of GalR1 and GalR2 inhibited cAMP, which in turn reduced protein kinase A (PKA), in the epididymal and subcutaneous adipose tissues of mice. Decreased PKA downregulated the phosphorylation of CREB, leading to decreased gene expression of PGC-1α [5]. SIRT1, which is responsible for deacetylating and activating PGC-1α at multiple lysine sites, was downregulated by HFD in the adipose tissue of mice [44]. Consequently, HFD-induced downregulation of PGC-1α decreased the expression of UCP1 and eventually suppressed uncoupled respiration. In the present study, OLE simultaneously reversed the HFD-induced upregulation of GalR1 and GalR2 expression and downregulation of SIRT1, PGC-1α, and UCP1 expression in the epididymal adipose tissue of mice. Therefore, we suggest that the visceral fat-pad weight-lowering effects of OLE can be associated with the elevation of the gene expression involved in uncoupled respiration in the visceral adipose tissue of HFD-fed mice.

The coordination of mitochondrial biogenesis with uncoupled respiration is crucial in increasing the capacity of thermogenesis [1]. PGC-1α is a potent inducer of mitochondrial biogenesis. Shadel and Clayton demonstrated that PGC-1α led to an activation of nuclear respiratory factor-1 (NRF-1), which binds to and activates the gene promoter of the mitochondrial electron transport system such as COX2. Another target of NRF-1 is TFAM, which translocates into mitochondria and initiates the transcription and replication of the mitochondrial DNA [45]. OLE significantly increased the mRNA expression of genes involved in mitochondrial biogenesis (PGC-1α, NRF-1, COX2, and TFAM) in the epididymal adipose tissue of HFD-fed mice. Accordingly, we presume that the visceral adiposity-suppressing effects of OLE may be linked to the increased mitochondrial biogenesis-related genes in the epididymal adipose tissue of mice.

In conclusion, OLE significantly decreased body weight gain, visceral fat-pad weights, and plasma lipid levels in HFD-fed mice. These beneficial effects against obesity in mice appear to be mediated, at least in part, through downregulating the expression of molecules involved in adipogenesis and upregulating the expression of molecules involved in thermogenesis in the visceral adipose tissue of HFD-fed mice. Taken together, our results suggest that supplementation with OLE might be helpful to combat or prevent obesity.

Acknowledgments

This research was supported by the MOTIE (The Ministry of Trade, Industry and Energy), Republic of Korea, under the Research and Business Development (R&BD) support program (Grant no. N0000869) supervised by the KIAT (Korea Institute for Advancement of Technology), and by the SRC program (Center for Food and Nutritional Genomics, Grant no. 2008-0062618) of the National Research Foundation of Korea funded by the Ministry of Education, Science and Technology.

Abbreviations

C/EBPα:

CCAAT/enhancer-binding protein alpha

CD:

Chow diet

CD36:

Cluster of differentiation 36

CREB:

cAMP responsive element-binding protein

Cyc-D:

Cyclin D

COX2:

Cytochrome C oxidase subunit 2

ERK:

Extracellular signal-regulated kinase 1/2

FAS:

Fatty acid synthase

FFA:

Free fatty acids

GalR1:

Galanin receptor 1

GalR2:

Galanin receptor 2

GAPDH:

Glyceraldehyde-3-phosphate dehydrogenase

HFD:

High-fat diet

NRF-1:

Nuclear respiratory factor-1

OLE:

Olive leaf extract

PGC1α:

Peroxisome proliferator-activated receptor gamma coactivator 1alpha

PPARγ:

Peroxisome proliferator-activated receptor gamma

PKCδ:

Protein kinase C delta

SFRP5:

Secreted frizzled-related protein 5

SIRT1:

Sirtuin 1

TFAM:

Mitochondrial transcription factor A

UCP1:

Uncoupling protein 1

WNT10b:

Wingless-type MMTV integration site family, member 10b.

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.

References

  • 1.Lowell BB, Spiegelman BM. Towards a molecular understanding of adaptive thermogenesis. Nature. 2000;404(6778):652–660. doi: 10.1038/35007527. [DOI] [PubMed] [Google Scholar]
  • 2.Cawthorn WP, Scheller EL, MacDougald OA. Adipose tissue stem cells: the great WAT hope. Trends in Endocrinology & Metabolism. 2012;23(6):270–277. doi: 10.1016/j.tem.2012.01.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Prestwich TC, MacDougald OA. Wnt/β-catenin signaling in adipogenesis and metabolism. Current Opinion in Cell Biology. 2007;19(6):612–617. doi: 10.1016/j.ceb.2007.09.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Wright WS, Longo KA, Dolinsky VW, et al. Wnt10b inhibits obesity in ob/ob and agouti mice. Diabetes. 2007;56(2):295–303. doi: 10.2337/db06-1339. [DOI] [PubMed] [Google Scholar]
  • 5.Kim A, Park T. Diet-induced obesity regulates the galanin-mediated signaling cascade in the adipose tissue of mice. Molecular Nutrition and Food Research. 2010;54(9):1361–1370. doi: 10.1002/mnfr.200900317. [DOI] [PubMed] [Google Scholar]
  • 6.Christodoulides C, Lagathu C, Sethi JK, Vidal-Puig A. Adipogenesis and WNT signalling. Trends in Endocrinology and Metabolism. 2009;20(1):16–24. doi: 10.1016/j.tem.2008.09.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Boucher J, Mori MA, Lee KY, et al. Impaired thermogenesis and adipose tissue development in mice with fat-specific disruption of insulin and IGF-1 signalling. Nature Communications. 2012;3(article 902) doi: 10.1038/ncomms1905. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Puigserver P, Wu Z, Park CW, Graves R, Wright M, Spiegelman BM. A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell. 1998;92(6):829–839. doi: 10.1016/s0092-8674(00)81410-5. [DOI] [PubMed] [Google Scholar]
  • 9.Seale P, Conroe HM, Estall J, et al. Prdm16 determines the thermogenic program of subcutaneous white adipose tissue in mice. The Journal of Clinical Investigation. 2011;121(1):96–105. doi: 10.1172/JCI44271. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wang H, Zhang Y, Yehuda-Shnaidman E, et al. Liver X receptor α is a transcriptional repressor of the uncoupling protein 1 gene and the brown fat phenotype. Molecular and Cellular Biology. 2008;28(7):2187–2200. doi: 10.1128/MCB.01479-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Rodríguez VM, Portillo MP, Picó C, Teresa Macarulla M, Palou A. Olive oil feeding up-regulates uncoupling protein genes in rat brown adipose tissue and skeletal muscle. The American Journal of Clinical Nutrition. 2002;75(2):213–220. doi: 10.1093/ajcn/75.2.213. [DOI] [PubMed] [Google Scholar]
  • 12.Samec S, Seydoux J, Dulloo AG. Post-starvation gene expression of skeletal muscle uncoupling protein 2 and uncoupling protein 3 in response to dietary fat levels and fatty acid composition: a link with insulin resistance. Diabetes. 1999;48(2):436–441. doi: 10.2337/diabetes.48.2.436. [DOI] [PubMed] [Google Scholar]
  • 13.Alberdi G, Rodriguez VM, Miranda J, Macarulla MT, Churruca I, Portillo MP. Thermogenesis is involved in the body-fat lowering effects of resveratrol in rats. Food Chemistry. 2013;141(2):1530–1535. doi: 10.1016/j.foodchem.2013.03.085. [DOI] [PubMed] [Google Scholar]
  • 14.Dulloo AG, Duret C, Rohrer D, et al. Efficacy of a green tea extract rich in catechin polyphenols and caffeine in increasing 24-h energy expenditure and fat oxidation in humans. The American Journal of Clinical Nutrition. 1999;70(6):1040–1045. doi: 10.1093/ajcn/70.6.1040. [DOI] [PubMed] [Google Scholar]
  • 15.El SN, Karakaya S. Olive tree (Olea europaea) leaves: potential beneficial effects on human health. Nutrition Reviews. 2009;67(11):632–638. doi: 10.1111/j.1753-4887.2009.00248.x. [DOI] [PubMed] [Google Scholar]
  • 16.Khayyal MT, El-Ghazaly MA, Abdallah DM, Nassar NN, Okpanyi SN, Kreuter MH. Blood pressure lowering effect of an olive leaf extract (Olea europaea) in L-NAME induced hypertension in rats. Arzneimittel-Forschung. 2002;52(11):797–802. doi: 10.1055/s-0031-1299970. [DOI] [PubMed] [Google Scholar]
  • 17.Wang L, Geng C, Jiang L, et al. The anti-atherosclerotic effect of olive leaf extract is related to suppressed inflammatory response in rabbits with experimental atherosclerosis. European Journal of Nutrition. 2008;47(5):235–243. doi: 10.1007/s00394-008-0717-8. [DOI] [PubMed] [Google Scholar]
  • 18.Abaza L, Talorete TPN, Yamada P, Kurita Y, Zarrouk M, Isoda H. Induction of growth inhibition and differentiation of human leukemia HL-60 cells by a Tunisian gerboui olive leaf extract. Bioscience, Biotechnology and Biochemistry. 2007;71(5):1306–1312. doi: 10.1271/bbb.60716. [DOI] [PubMed] [Google Scholar]
  • 19.Eidi A, Eidi M, Darzi R. Antidiabetic effect of Olea europaea L. in normal and diabetic rats. Phytotherapy Research. 2009;23(3):347–350. doi: 10.1002/ptr.2629. [DOI] [PubMed] [Google Scholar]
  • 20.Poudyal H, Campbell F, Brown L. Olive leaf extract attenuates cardiac, hepatic, and metabolic changes in high carbohydrate-, high fat-fed rats. The Journal of Nutrition. 2010;140(5):946–953. doi: 10.3945/jn.109.117812. [DOI] [PubMed] [Google Scholar]
  • 21.Perrinjaquet-Moccetti T, Busjahn A, Schmidlin C, Schmidt A, Bradl B, Aydogan C. Food supplementation with an olive (Olea europaeaL.) leaf extract reduces blood pressure in borderline hypertensive monozygotic twins. Phytotherapy Research. 2008;22(9):1239–1242. doi: 10.1002/ptr.2455. [DOI] [PubMed] [Google Scholar]
  • 22.Japón-Luján R, Luque-Rodríguez JM, de Castro MDL. Dynamic ultrasound-assisted extraction of oleuropein and related biophenols from olive leaves. Journal of Chromatography A. 2006;1108(1):76–82. doi: 10.1016/j.chroma.2005.12.106. [DOI] [PubMed] [Google Scholar]
  • 23.Kim Y, Choi Y, Park T. Hepatoprotective effect of oleuropein in mice: mechanisms uncovered by gene expression profiling. Biotechnology Journal. 2010;5(9):950–960. doi: 10.1002/biot.201000068. [DOI] [PubMed] [Google Scholar]
  • 24.Reagan-Shaw S, Nihal M, Ahmad N. Dose translation from animal to human studies revisited. The FASEB Journal. 2008;22(3):659–661. doi: 10.1096/fj.07-9574LSF. [DOI] [PubMed] [Google Scholar]
  • 25.Gundlah C, Martin KF, Heal DJ, Auerbach SB. In vivo criteria to differentiate monoamine reuptake inhibitors from releasing agents: sibutramine is a reuptake inhibitor. The Journal of Pharmacology and Experimental Therapeutics. 1997;283(2):581–591. [PubMed] [Google Scholar]
  • 26.Drira R, Chen S, Sakamoto K. Oleuropein and hydroxytyrosol inhibit adipocyte differentiation in 3 T3-L1 cells. Life Sciences. 2011;89(19-20):708–716. doi: 10.1016/j.lfs.2011.08.012. [DOI] [PubMed] [Google Scholar]
  • 27.Hao J, Shen W, Yu G, et al. Hydroxytyrosol promotes mitochondrial biogenesis and mitochondrial function in 3T3-L1 adipocytes. The Journal of Nutritional Biochemistry. 2010;21(7):634–644. doi: 10.1016/j.jnutbio.2009.03.012. [DOI] [PubMed] [Google Scholar]
  • 28.Park HS, Kim SH, Kim YS, et al. Luteolin inhibits adipogenic differentiation by regulating PPARγ activation. BioFactors. 2009;35(4):373–379. doi: 10.1002/biof.38. [DOI] [PubMed] [Google Scholar]
  • 29.Myoung HJ, Kim G, Nam KW. Apigenin isolated from the seeds of Perilla frutescens britton var crispa (Benth.) inhibits food intake in C57BL/6J mice. Archives of Pharmacal Research. 2010;33(11):1741–1746. doi: 10.1007/s12272-010-1105-5. [DOI] [PubMed] [Google Scholar]
  • 30.Ono M, Fujimori K. Antiadipogenic effect of dietary apigenin through activation of AMPK in 3T3-L1 cells. Journal of Agricultural and Food Chemistry. 2011;59(24):13346–13352. doi: 10.1021/jf203490a. [DOI] [PubMed] [Google Scholar]
  • 31.Hsu CL, Wu CH, Huang SL, Yen GC. Phenolic compounds rutin and o-coumaric acid ameliorate obesity induced by high-fat diet in rats. Journal of Agricultural and Food Chemistry. 2009;57(2):425–431. doi: 10.1021/jf802715t. [DOI] [PubMed] [Google Scholar]
  • 32.Cho AS, Jeon SM, Kim MJ, et al. Chlorogenic acid exhibits anti-obesity property and improves lipid metabolism in high-fat diet-induced-obese mice. Food and Chemical Toxicology. 2010;48(3):937–943. doi: 10.1016/j.fct.2010.01.003. [DOI] [PubMed] [Google Scholar]
  • 33.Rafferty EP, Wylie AR, Elliott CT, Chevallier OP, Grieve DJ, Green BD. In vitro and in vivo effects of natural putative secretagogues of glucagon-like peptide-1 (GLP-1) Scientia Pharmaceutica. 2011;79(3):615–621. doi: 10.3797/scipharm.1104-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Sumiyoshi M, Kimura Y. Effects of olive leaf extract and its main component oleuroepin on acute ultraviolet B irradiation-induced skin changes in C57BL/6J mice. Phytotherapy Research. 2010;24(7):995–1003. doi: 10.1002/ptr.3048. [DOI] [PubMed] [Google Scholar]
  • 35.Koca U, Süntar I, Akkol EK, Yilmazer D, Alper M. Wound repair potential of Olea europaea L. leaf extracts revealed by in vivo experimental models and comparative evaluation of the extracts’ antioxidant activity. Journal of Medicinal Food. 2011;14(1-2):140–146. doi: 10.1089/jmf.2010.0039. [DOI] [PubMed] [Google Scholar]
  • 36.Valassi E, Scacchi M, Cavagnini F. Neuroendocrine control of food intake. Nutrition, Metabolism and Cardiovascular Diseases. 2008;18(2):158–168. doi: 10.1016/j.numecd.2007.06.004. [DOI] [PubMed] [Google Scholar]
  • 37.Benavente-García O, Castillo J, Lorente J, Ortuño A, Del Rio JA. Antioxidant activity of phenolics extracted from Olea europaea L. leaves. Food Chemistry. 2000;68(4):457–462. [Google Scholar]
  • 38.Wu Z, Rosen ED, Brun R, et al. Cross-regulation of C/EBPα and PPARγ controls the transcriptional pathway of adipogenesis and insulin sensitivity. Molecular Cell. 1999;3(2):151–158. doi: 10.1016/s1097-2765(00)80306-8. [DOI] [PubMed] [Google Scholar]
  • 39.Lagathu C, Christodoulides C, Virtue S, et al. Dact1, a nutritionally regulated preadipocyte gene, controls adipogenesis by coordinating the wnt/β-catenin signaling network. Diabetes. 2009;58(3):609–619. doi: 10.2337/db08-1180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Moon RT, Kohn AD, de Ferrari GV, Kaykas A. WNT and β-catenin signalling: diseases and therapies. Nature Reviews Genetics. 2004;5(9):691–701. doi: 10.1038/nrg1427. [DOI] [PubMed] [Google Scholar]
  • 41.Koza RA, Nikonova L, Hogan J, et al. Changes in gene expression foreshadow diet-induced obesity in genetically identical mice. PLoS Genetics. 2006;2(5, article e81) doi: 10.1371/journal.pgen.0020081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Seta Y, Kataoka S, Toyono T, Toyoshima K. Expression of galanin and the galanin receptor in rat taste buds. Archives of Histology and Cytology. 2006;69(4):273–280. doi: 10.1679/aohc.69.273. [DOI] [PubMed] [Google Scholar]
  • 43.Rodgers JT, Lerin C, Haas W, Gygi SP, Spiegelman BM, Puigserver P. Nutrient control of glucose homeostasis through a complex of PGC-1α and SIRT1. Nature. 2005;434(7029):113–118. doi: 10.1038/nature03354. [DOI] [PubMed] [Google Scholar]
  • 44.Lagouge M, Argmann C, Gerhart-Hines Z, et al. Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC-1α . Cell. 2006;127(6):1109–1122. doi: 10.1016/j.cell.2006.11.013. [DOI] [PubMed] [Google Scholar]
  • 45.Shadel GS, Clayton DA. Mitochondrial transcription initiation. Variation and conservation. The Journal of Biological Chemistry. 1993;268(22):16083–16086. [PubMed] [Google Scholar]

Articles from Evidence-based Complementary and Alternative Medicine : eCAM are provided here courtesy of Wiley

RESOURCES