Abstract
Background
Antibodies against human platelet antigens (HPA) are a cause of thrombocytopenia. Detection of rare anti-HPA antibodies using platelet preparations is difficult and would be improved by an alternative method that does not require platelets. In the present study, we describe the establishment of cell lines that stably express specific HPA associated with integrin α2β1 and the application of these cell lines for detecting anti-HPA-5a and anti-HPA-5b antibodies.
Materials and methods
Complementary DNA of the integrin α2 variants HPA-5b, -13b and -18b were individually transfected into K562 cells using retroviral vectors. Expression of integrin α2 was confirmed by flow cytometric analysis, immunoprecipitation and western blotting analysis. To verify whether the cell line panel was suitable for clinical diagnosis, we analysed its properties using monoclonal antibody-specific immobilisation of platelet antigens (MAIPA) and well-characterised serum samples.
Results
Exogenous integrin α2 expression was observed in the transfected cells for over 6 months. The cell line panel specifically detected previously characterised anti-HPA-5a and anti-HPA-5b antisera. No reactivity was observed with control sera, including normal sera and HLA antisera.
Discussion
We successfully established a cell line panel to facilitate the sensitive and reliable detection of anti-HPA-5a and anti-HPA-5b antibodies.
Keywords: HPA antibody, cell line panel, integrin α2β1
Introduction
Platelets contain a variety of antigenic molecules, including ABH antigens1, human leucocyte antigens (HLA), human platelet antigents (HPA)2,3 and Naka antigens of CD36. Antibodies to these molecules are major causes of thrombocytopenia, including refractory thrombocytopenia4, post-transfusion purpura5, neonatal alloimmune thrombocytopenia (NAIT)6,7 and idiopathic thrombocytopenic purpura8, and their detection is, therefore, an important goal in the diagnosis and prevention of these disorders. Various methods are used to detect HPA antibodies, such as the monoclonal antibody-specific immobilisation of platelet antigens (MAIPA) assay9–11, the mixed passive haemagglutination test12, flow cytometry13 and the modified antigen capture enzyme-linked immunosorbent assay14. However, all these methods rely on the preparation of well-characterised platelets.
The molecular nature of several HPA has been characterized, many of which involve single amino acid substitutions (20 cases) or deletions in platelet glycoproteins2,15–22. Three types of HPA, HPA-5, HPA-13 and HPA-18, are associated with integrin α2, the α2 subunit of the VLA-2 receptor CD49b, which forms a complex with integrin β1 on the platelet surface. Figure 1 is a schematic diagram of their epitopes, adapted from Bertrand et al.19. The frequencies of HPA differ significantly among ethnic groups and are compiled in the Immuno Polymorphism Database (IPD; www.ebi.ac.uk/ipd/hpa/)20. For example, genotype analysis shows that the frequencies of HPA-5a and HPA-5b vary between 70–100% and 1–20%, respectively. Anti-HPA-5a antibodies are strongly associated with NAIT regardless of race12,23,24. Because of the variable frequencies of some HPA as predicted by ethnicity (extremely low frequencies of HPA-13b [T799M] and HPA-18b [Q716H]19,20,22), it is difficult to prepare comprehensive platelet panels. This difficulty can be circumvented by the development of a panel of cell lines, each stably expressing the specific integrin α2β1 HPA. In order to facilitate antibody screening, we aimed to establish cells that expressed specific integrin α2 HPA, including HPA-5, HPA-13 and HPA-18. The K562 cell line, a non-adherent cell line derived from human erythroleukaemia, does not express HLA, human neutrophil antigens (HNA)25, HPA26 or CD36. We previously used K562 cells to establish cell line panels expressing specific molecules, including CD36, HPA and HNA25–29. In the present study, we describe the establishment of K562 cell lines that stably express specific integrin α2β1 HPA for the detection of anti-HPA-5a and anti-HPA-5b antibodies using a modified MAIPA assay.
Figure 1.
Schematic diagram of HPA associated with integrin α2β1. HPA-5, HPA-13 and HPA-18 are epitopes on integrin α2. This schematic diagram is adapted from Bertrand et al.19.
Materials and methods
Roswell Park Memorial Institute medium (RPMI 1640), Dulbecco’s modified Eagle’s medium (DMEM) and puromycin were purchased from Nacalai Tesque (Kyoto, Japan); phosphate-buffered saline from Sigma Aldrich (Tokyo, Japan); anti-mouse IgG-horseradish peroxidase from Promega (Medison, Wisconsin, United States of America); fluorescein isothiocyanate (FITC)-conjugated anti-human CD41a and FITC-conjugated mouse IgG from BD Biosciences (Tokyo, Japan); and pAmpho, pQCXIP and gp-293T packaging cells from TaKaRa (Shiga, Japan). DH-5α-competent cells, a site-directed mutagenesis system, Platinum Taq DNA polymerase, Lipofectamine Plus, pCR2.1-TOPO, foetal bovine serum, penicillin and streptomycin were purchased from Invitrogen (Carlsbad, California, United States of America), whereas polybrene and Gi9 antibodies were purchased from Beckman Coulter (Tokyo, Japan). JB1B and 16B4 were purchased from Acris Antibodies Gmbh (Herford, Germany) and Serotec (Oxford, United Kingdom), respectively.
Vector construction
Human codon-optimised ITGA2 cDNA were purchased from Life Technologies (Tokyo, Japan). TOPO vectors containing the amino acid sequences for HPA-5b, HPA-13b or HPA-18b in ITGA2 were prepared using the GeneTailor site-directed mutagenesis system (Invitrogen) and Platinum Taq DNA polymerase and specific oligo primer pairs (Table I), according to the manufacturer’s instructions. cDNA sequences were confirmed by dye-terminator cycle sequencing and analysed using FinchTV Ver. 1.4.0 software (Geospiza Inc. Seattle, Washington, United States of America), whereas cDNA were cloned into the retroviral vector pQCXI with the In-Fusion 2.0 PCR Cloning Kit (Takara) using EcoRI restriction endonuclease. The HPA cDNA sequences were reconfirmed prior to transfection.
Table I.
Primer sequences for site-directed mutagenesis and in-fusion cloning.
| Primer name | Sequence (5′→3′) |
|---|---|
| HPA-5b F | GTCTACCTTTTCACTATAAAAAAAGGCATTCTTGG |
| HPA-5b R | TTTTATAGTGAAAAGGTAGACTCTGCCCTCTTC |
| HPA-13b F | AGAGACTTACCTTCAGTGTAATGTTGAAGAATAA |
| HPA-13b R | TTACACTGAAGGTAAGTCTCTTATTCTGATTT |
| HPA-18b F | GAGCACATAATCTATATTCACGAACCATCTG |
| HPA-18b R | TGAATATAGATTATGTGCTCGGGACAAGAC |
| Cloning F | cgaggcctaccggtgcggccgcTTAGGAGGACAGCTCTGTTGTCT |
| Cloning R | atccgcggccgcaccATGGGCCCTGAGAGGACA |
Gene transfection
The transfection and retroviral infection experiments were performed as described previously25–29. K562 cells were incubated with the culture supernatant from cells infected with the retroviral cDNA expression vectors. The cells were then cloned by a limiting dilution method in the presence of 0.5 mg/mL puromycin and designated according to the introduced cDNA as HP-mock, HP-5b, HP-13b or HP-18b.
Flow cytometry
The cells were incubated with the following primary antibodies for 20 min at room temperature in the dark: phycoerythin (PE)-labelled anti-CD29 (BD), PE-labelled anti-CD49a (BD), PE-labelled anti-CD49b (BD), PE-labelled anti-CD49c (BD), PE-labelled anti-CD49d (BD), PE-labelled anti-CD49e (BD), PE-labelled anti-CD49f (BD), FITC-labelled anti-CD51 (Beckman Coulter) and FITC-labelled (Beckman Coulter) and PE-labelled (BD) isotype control antibodies. In order to exclude debris, gating for intact K562 cells was performed using forward and side scatter. After washing, surface expression was determined by flow cytometry (FACSCalibur, BD) and several clones were selected for the cell line panel that was to be used to detect specific antibodies on the basis of their high expression of CD49b.
Reverse transcriptase-polymerase chain reaction
mRNA from the cell lines was extracted and analysed by reverse transcriptase polymerase chain reaction and sequenced as described previously28.
Immunoprecipitation and Western Blotting
Immunoprecipitation was performed using M280 magnetic beads (Invitrogen) according to the manufacturer’s instructions. HP cells were incubated for 15 min at room temperature with anti-integrin α2 (clone: Gi9) antibody, washed with PBS and lysed in 1% Triton X-100/PBS on ice for 30 min. The lysates were incubated with sheep anti-mouse IgG-conjugated M280 Dynabeads and the beads were subsequently washed with phosphate-buffered saline containing 0.1% bovine serum albumin (BSA), with the bound proteins being released by reduction in sodium dodecylsulphate (SDS) sample buffer (Daiichikagaku, Tokyo, Japan). The samples were boiled for 10 min. Supernatants were prepared by centrifugation and analysed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) on 3–10% gradient gels. The separated proteins were transferred to a polyvinylidene fluoride membrane, and then incubated with monoclonal antibodies against α2 (JB1B) and β1 (16B4). Following washing, the membranes were incubated with HRP-conjugated goat anti-mouse IgG (H + L) (Promega Corporation) and visualised using Western Lightning Chemiluminescence Reagent Plus (Perkin Elmer, Waltham, Massachusetts, United States of America) and ChemiDoc™ (Bio-Rad Laboratories, Hercules, California, United States of America).
Monoclonal antibody-specific immobilisation of platelet antigens assay
The MAIPA assay using platelets was performed according to the method described by Crossely23 and Campbell30. MAIPA assays on the cell panel were performed using Gi9 antibody as described previously29. Briefly, HP cells (1.0×106) were suspended in 50 mL tris-buffered saline (TBS) supplemented with 0.2% BSA (TBS/BSA) and incubated with 25 mL of the serum samples. Serum was removed by washing with TBS/BSA and the cell pellet was incubated with Gi9 antibody. The cells were washed and then solubilised. The lysates were centrifuged to remove debris, and 200 mL of the supernatants were then incubated in an immune plate conjugated with sheep anti-mouse IgG. After washing, the captured human IgG in the test sample was detected by the addition of peroxidase-conjugated goat anti-human IgG (Jackson ImmunoResearch Laboratories, West Grove, Pennsylvania, United States of America). Colour was developed using a peroxidase substrate (KPL, Gaithersburg, Maryland, United States of America) and the reaction was then stopped by the addition of KPL solution. Absorbance was measured at 450 nm (MTP-120, Hitachi, Tokyo, Japan).
Serum samples
Serum samples were derived from blood donors and patients with NAIT. All the serum samples were applied to a LABScreen Class I single antigen (OneLambda, Canoga Park, California, United States of America) and mixed passive haemagglutination assay (MPHA) (anti-HPA MPHA Panel; Olympus, Tokyo, Japan) to screen for anti-HLA and anti-HPA antibodies according to the manufacturers’ instruction manuals. In this study, 14 serum samples containing anti-HLA antibodies, two containing anti-HPA-5a antibodies, nine containing anti-HPA-5b antibodies and 21 normal sera were used. The serum samples were diluted to the detection limit of MAIPA to confirm the sensitivity of the cell panel. The absorbance of the sample sera at 450 nm (signal) was divided by the absorbance of randomly selected normal-control sera without anti-HPA antibodies (noise). On the basis of the results of 14 normal sera, a signal to noise ratio >2.0 was considered positive.
Results
Establishment of integrin α2 human platelet antigen cell lines
Sequencing confirmed the expression of the appropriate epitopes by all the cloned cell lines, with the exception of HP-mock (Table II). HP-mock cells were transfected with empty pQCXIP vector transgenes that were maintained using constant puromycin selection. Integrin is a cell-surface membrane heterodimer of the β1 integrin and one of several α integrin chain sub-types (α1-α9 and αv). The HP-mock control cells expressed endogenous integrin β1 (CD29) and integrin α5 (CD49e) but not integrin α2 (Figure 2), whereas the cDNA-transfected cell lines expressed exogenous integrin α2 HPA for over 6 months (Figures 2 and 3).
Table II.
Predicted HPA systems on HP cell lines.
| HP cell | Predicted HPA phenotype | ||
|---|---|---|---|
| 5 | 13 | 18 | |
| Mock | - | - | - |
| HP-5b | b | a | a |
| HP-13b | a | b | a |
| HP-18b | a | a | b |
Figure 2.
Cell-surface integrin expression by HP cell lines. Flow cytometry of HP cells labelled with specific integrin antibodies (outlined curve) and isotype controls (grey-shaded curve).
Figure 3.
Stable expression of integrin α2β1 on the surface of the HP cell line panel. CD49b (integrin α2) expression was analysed at the indicated times in HP-mock cells, HP-5, HP-13b and HP-18b cells; isotype control antibodies (grey-shaded curve), anti-CD49b antibodies (outlined curve).
Complex formation of α2 and β1 in the cell lines
Incorporation of exogenous integrin α2 cDNA into heterodimeric integrins in HP-5b, HP-13b and HP-18b cells was indicated by the co-immunoprecipitation of integrin α2 with the anti-β1 antibody Gi9 (Figure 4). These results indicated that α2 and β1 in the cell line panel were present in complexes equivalent to their endogenous forms in platelets.
Figure 4.
Heterodimerisation of α2 and β1 in HP cells. Immunoprecipitates obtained from 1.0×109 platelets (PLT) from a healthy donor and 1.0×106 HP cells using Gi9 antibodies were subjected to SDS-PAGE, and the electrophoresed proteins were subsequently transferred to a polyvinylidene fluoride membrane. JB1B and 16B4 antibodies and horseradish peroxidase-conjugated anti-mouse IgG (Promega) were used as the primary and secondary antibodies, respectively. The protein bands were visualised using Western Lightning Chemiluminescence Reagent Plus (PerkinElmer) and detected using ChemiDoc (Bio-Rad Laboratories).
Detection of anti-human platelet antigen antibodies using the HP cell line panel
HPA-5 systems are sometimes associated with NAIT. We examined whether our HP cell line panel could be used for the clinical diagnosis of NAIT. In order to characterise the expression of HPA-5a and HPA-5b epitopes in the cell lines, we used nine serum samples from NAIT patients. The specificity of these samples had been characterised previously using mixed passive haemagglutination (Olympus, Tokyo, Japan) and MAIPA assays (Figure 5).
Figure 5.
Reactivity of patients’ sera with HP cells. Binding of anti-HPA-5a and anti-HPA-5b antibodies to HP-mock, HP-5b, HP-13b and HP-18b cells was estimated by the MAIPA assay using 21 kinds of normal serum, two kinds of serum containing anti-HPA-5a and nine kinds of serum containing anti-HPA-5b antibodies. The results are expressed as optical densities at 450 nm. All of the 21 normal sera reacted at very low levels with HP-mock, HP-5b, HP-13b and HP-18b cells. The mean±SD values of their optical densities were 0.073±0.037, 0.063±0.028, 0.076±0.045, 0.061±0.025, respectively. Representative data using one normal serum are shown as 1. All of the sera containing anti-HPA-5a and anti-HPA-5b antibodies clearly reacted with the corresponding cells.
While normal serum and serum containing HLA antibodies reacted at very low levels with HP-mock, HP-5b, HP-13b and HP-18b cells, sera from patients 2 and 3, both of which contained anti-HPA-5a antibodies, reacted strongly with HP-13b and HP-18b cells, but not with HP-5b or HP-mock cells. In contrast, sera from patients 4–12, all of which possessed anti-HPA-5b antibodies, reacted strongly only with HP-5b cells. These results demonstrated that the cell panel could successfully detect anti-HPA-5a and anti-HPA-5b antibodies in clinical samples.
To confirm the sensitivity of our method we tested dilute anti-HPA-5a (2 in Figure 5) sera and anti-HPA-5b (9 in Figure 5) sera using platelets expressing specific antigens and the HP-cell panel (Figure 6). Using the HP-13b and HP-18b cell lines, we were able to detect anti-HPA-5a at a dilution of 1:8,000. In contrast, using platelet-based assays, we were able to detect anti-HPA-5a only at a dilution of 1:2,000. Similarly, using the HP-cell lines, we detected anti-HPA-5b at a dilution of 1:64, whereas by platelet-based assays, we could detect anti-HPA-5b at a dilution of 1:32. Thus, this HPA cell line panel can detect levels of antibody lower than those detected using platelets.
Figure 6.
Sensitivity analysis of HP cells and platelets. MAIPA assays of diluted antisera containing anti-HPA-5a (A) and anti-HPA-5b (B) against the HP cell panel and platelets expressing specific HPA associated with integrin α2β1. The absorbance at 450 nm of the normal serum for HP-13b cells, HP-18b cells, platelet 1 (PLT1), platelet 2 (PLT2), platelet 3 (PLT3), HP-5b cells, platelet 4 (PLT4) and platelet 5 (PLT5) was 0.037, 0.031, 0.134, 0.160, 0.103, 0.036, 0.122 and 0.092, respectively. The absorbance at 450 nm of the normal serum (control) was defined as 1.0. The dotted lines indicate positive signal-to-noise ratios. PLT (5a+) and PLT (5a+b+) indicate available platelets that expressed HPA-5a and those that expressed HPA-5a and HPA-5b, respectively.
Discussion
Conventional methods to detect anti-platelet antibodies require well-characterised platelet preparations, although it is difficult to obtain platelet preparations with rare HPA. Although several peptide-based technologies have been reported to be alternatives to platelets, the targets of these methods were only antibodies to integrin β331,32. The aim of our study was to establish a panel of cell lines that showed stable expression of rare HPA associated with integrin α2β1 on their surface in order to overcome this limitation. We established that retrovirally infected K562 cell lines showed stable expression of exogenous integrin α2 which was incorporated into the cell surface integrin α2β1 (Figure 3).
As the parent K562 cells expressed endogenous integrin α5β1, we introduced integrin α2 cDNA to establish cell lines that also stably expressed integrin α2β1. A decrease in integrin α5 expression in the transfected K562 cells was observed, which may be due to competition with exogenous integrin α2. A corresponding corrective increase in integrin β1 levels may be required to maintain the expression levels of α5β1. Further experiments are needed to clarify this apparent homeostatic regulation of integrin levels.
We also successfully demonstrated that the HPA-5 cell panel was able to specifically detect anti-HPA-5a and anti-HPA-5b antibodies in clinical samples, and that the cell line method was significantly more sensitive than platelet-based assays (Figure 6). We plan to carry out further studies to validate and characterise our cell line panel using numerous specimens, including normal plasma and plasma containing rare antibodies such as anti-HPA-13b and anti-HPA-18b antibodies.
As summarised in Table III, we had previously established cells expressing integrin αIIb, β3, CD109 and CD36, and proposed that such HP cell panels are a useful and reliable alternative to platelet preparations for detecting HPA antibodies. Our series of cell lines now cover most of the clinically important HPA associated with GPIbα, with the exception of HPA-2. We now aim to establish cell lines that stably express GPIbα.
Table III.
Available cell lines derived from the K562 cell line to detect anti-HPA antibodies.
| Established cell | Associated glyco proteins | HPA system (phenotype) | Naka antigen | Methods to detect antibody | Reference | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 3 | 4 | 5 | 6 | 7 | 13 | 15 | 18 | 21 | (CD36) | ||||
| HP-mock (puro) | - | - | - | - | - | - | - | - | - | - | - | - | 26, 27, and this study | |
| HP-mock (puro/neo) | - | - | - | - | - | - | - | - | - | - | - | - | 28, 29 | |
| HP-2b/3a | GPIIb/GPIIIa | a | a | a | - | a | a | - | - | - | a | - | MAIPA | 28, 29 |
| HP-1b | GPIIIa | b | a | a | - | a | a | - | - | - | a | - | MAIPA | 28 |
| HP-3b | GPIIb | a | b | a | - | a | a | - | - | - | a | - | MAIPA | 28 |
| HP-4b | GPIIIa | a | a | b | - | a | a | - | - | - | a | - | MAIPA | 29 |
| HP-5b | GPIa | - | - | - | b | - | - | a | - | a | - | - | MAIPA | this study |
| HP-6b | GPIIIa | a | a | a | - | b | a | - | - | - | a | - | MAIPA | 28 |
| HP-7b | GPIIIa | a | a | a | - | a | b | - | - | - | a | - | MAIPA | 28 |
| HP-7 variant | GPIIIa | a | a | a | - | a | variant | - | - | - | a | - | MAIPA | 28 |
| HP-13b | GPIa | - | - | - | - | - | - | b | - | - | - | - | MAIPA | this study |
| HP-15a | CD109 | - | - | - | - | - | - | - | a | - | - | - | MAIPA, IFT | 27 |
| HP-15b | CD109 | - | - | - | - | - | - | - | b | - | - | - | MAIPA, IFT | 27 |
| HP-18b | GPIa | - | - | - | - | - | - | - | - | b | - | - | MAIPA | this study |
| HP-21b | GPIIIa | a | a | a | - | a | a | - | - | - | b | - | MAIPA, IFT | |
| HP-Nak | CD36 | - | - | - | - | - | - | - | - | - | - | + | IFT | 26 |
Footnotes
The Authors declare no conflicts of interest.
References
- 1.Ogasawara K, Ueki J, Takenaka M, Furihata K. Study on the expression of ABH antigens on platelets. Blood. 1993;82:993–9. [PubMed] [Google Scholar]
- 2.Metcalfe P, Watkins NA, Ouwehand WH, et al. Nomenclature of human platelet antigens. VoxSang. 2003;85:240–5. doi: 10.1046/j.1423-0410.2003.00331.x. [DOI] [PubMed] [Google Scholar]
- 3.Santoso S, Kiefel V. Human platelet alloantigens. Wien Klin Wochenschr. 2001;113:806–13. [PubMed] [Google Scholar]
- 4.Ikeda H, Mitani T, Ohnuma M, et al. A new platelet-specific antigen, Naka, involved in the refractoriness of HLA-matched platelet transfusion. VoxSang. 1989;57:213–7. doi: 10.1111/j.1423-0410.1989.tb00826.x. [DOI] [PubMed] [Google Scholar]
- 5.Pavenski K, Webert KE, Goldman M. Consequences of transfusion of platelet antibody: a case report and literature review. Transfusion. 2008;48:1981–9. doi: 10.1111/j.1537-2995.2008.01796.x. [DOI] [PubMed] [Google Scholar]
- 6.Curtis BR, Fick A, Lochowicz AJ, et al. Neonatal alloimmune thrombocytopenia associated with maternal-foetal incompatibility for blood group B. Transfusion. 2008;48:358–64. doi: 10.1111/j.1537-2995.2007.01531.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.King KE, Kao KJ, Bray PF, et al. The role of HLA antibodies in neonatal thrombocytopenia: a prospective study. Tissue Antigens. 1996;47:206–11. doi: 10.1111/j.1399-0039.1996.tb02542.x. [DOI] [PubMed] [Google Scholar]
- 8.Fujisawa K, O’Toole TE, Tani P, et al. Autoantibodies to the presumptive cytoplasmic domain of platelet glycoprotein IIIa in patients with chronic immune thrombocytopenic purpura. Blood. 1991;77:2207–13. [PubMed] [Google Scholar]
- 9.Kiefel V. The MAIPA assay and its applications in immunohaematology. Transfus Med. 1992;2:181–8. doi: 10.1111/j.1365-3148.1992.tb00153.x. [DOI] [PubMed] [Google Scholar]
- 10.Crossley A, Calvert JE, Taylor PR, Dickinson AM. A comparison of monoclonal antibody immobilization of platelet antigen (MAIPA) and immunobead methods for detection of GPIIb/IIIa antiplatelet antibodies in immune thrombocytopenic purpura. Transfus Med. 1997;7:127–34. doi: 10.1046/j.1365-3148.1997.d01-15.x. [DOI] [PubMed] [Google Scholar]
- 11.Kaplan C, Freedman J, Foxcroft Z, et al. Monoclonal platelet antigen capture assays (MAIPA) and reagents: a statement. Vox Sang. 2007;93:298–9. doi: 10.1111/j.1423-0410.2007.00943.x. [DOI] [PubMed] [Google Scholar]
- 12.Ohto H, Miura S, Ariga H, et al. The natural history of maternal immunization against foetal platelet alloantigens. Transfus Med. 2004;14:399–408. doi: 10.1111/j.1365-3148.2004.00535.x. [DOI] [PubMed] [Google Scholar]
- 13.Nguyen XD, Dugrillon A, Beck C, et al. A novel method for simultaneous analysis of specific platelet antibodies: SASPA. Br J Haematol. 2004;127:552–60. doi: 10.1111/j.1365-2141.2004.05233.x. [DOI] [PubMed] [Google Scholar]
- 14.Ishida F, Saji H, Maruya E, Furihata K. Human platelet-specific antigen, Siba, is associated with the molecular weight polymorphism of glycoprotein Ib alpha. Blood. 1991;78:1722–9. [PubMed] [Google Scholar]
- 15.Santoso S, Kroll H, Andrei-Selmer CL, et al. A naturally occurring LeuVal mutation in beta3-integrin impairs the HPA-1a epitope: the third allele of HPA-1. Transfusion. 2006;46:790–9. doi: 10.1111/j.1537-2995.2006.00797.x. [DOI] [PubMed] [Google Scholar]
- 16.Koh Y, Taniue A, Ishii H, et al. Neonatal alloimmune thrombocytopenia caused by an antibody specific for a newly identified allele of human platelet antigen-7. Transfusion. 2010;50:1276–84. doi: 10.1111/j.1537-2995.2009.02557.x. [DOI] [PubMed] [Google Scholar]
- 17.Santoso S, Kiefel V, Richter IG, et al. A functional platelet fibrinogen receptor with a deletion in the cysteine-rich repeat region of the beta(3) integrin: the Oe(a) alloantigen in neonatal alloimmune thrombocytopenia. Blood. 2002;99:1205–14. doi: 10.1182/blood.v99.4.1205. [DOI] [PubMed] [Google Scholar]
- 18.Stafford P, Garner SF, Rankin A, et al. A single-nucleotide polymorphism in the human ITGB3 gene is associated with the platelet-specific alloantigen Va (HPA-17bw) involved in foetal maternal alloimmune thrombocytopenia. Transfusion. 2008;48:1432–8. doi: 10.1111/j.1537-2995.2008.01737.x. [DOI] [PubMed] [Google Scholar]
- 19.Bertrand G, Jallu V, Saillant D, et al. The new platelet alloantigen Cab(a): a single point mutation Gln(716)His on the alpha(2) integrin. Transfusion. 2009;49:2076–83. doi: 10.1111/j.1537-2995.2009.02240.x. [DOI] [PubMed] [Google Scholar]
- 20.Robinson J, Marsh SGE. IPD: the Immuno Polymorphism Database. Methods Mol Biol. 2007;409:61–74. doi: 10.1007/978-1-60327-118-9_4. [DOI] [PubMed] [Google Scholar]
- 21.Peterson JA, Gitter ML, Kanack A, et al. New low-frequency platelet glycoprotein polymorphisms associated with neonatal alloimmune thrombocytopenia. Transfusion. 2010;50:324–33. doi: 10.1111/j.1537-2995.2009.02438.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Santoso S, Amrhein J, Hofmann HA, et al. A point mutation Thr(799)Met on the alpha(2) integrin leads to the formation of new human platelet alloantigen Sit(a) and affects collagen-induced aggregation. Blood. 1999;94:4103–11. [PubMed] [Google Scholar]
- 23.Skouri H, Gandouz R, Kraiem I, et al. Platelet-specific alloantigens and antibodies in Tunisian women after three or more pregnancies. Transfus Med. 2009;19:269–73. doi: 10.1111/j.1365-3148.2009.00940.x. [DOI] [PubMed] [Google Scholar]
- 24.Kekomäki S, Koskela S, Laes M, et al. Neonatal thrombocytopenia in two of six human platelet alloantigen (HPA) 5a-positive children of an HPA-5a-immunized mother. Transfus Med. 2000;10:81–5. doi: 10.1046/j.1365-3148.2000.00235.x. [DOI] [PubMed] [Google Scholar]
- 25.Yasui K, Miyazaki T, Matsuyama N, et al. Establishment of cell lines stably expressing HNA-1a, -1b, and -2a antigen with low background reactivity in flow cytometric analysis. Transfusion. 2007;47:478–85. doi: 10.1111/j.1537-2995.2006.01139.x. [DOI] [PubMed] [Google Scholar]
- 26.Hayashi T, Yasui K, Matsuyama N, et al. Establishment of a novel method for detecting Naka antibodies by using a panel cell line. Transfusion. 2009;49:390–2. doi: 10.1111/j.1537-2995.2008.02000.x. [DOI] [PubMed] [Google Scholar]
- 27.Hayashi T, Amakishi E, Matsuyama N, et al. Detection of antibodies against human platelet antigens 15a and 15b by using a cell line panel. Br J Haematol. 2010;151:402–4. doi: 10.1111/j.1365-2141.2010.08369.x. [DOI] [PubMed] [Google Scholar]
- 28.Hayashi T, Amakishi E, Matsuyama N, et al. Establishment of a cell line panel as an alternative source of platelet antigens for a screening assay of anti-human platelet antibodies. Transfus Med. 2011;21:199–204. doi: 10.1111/j.1365-3148.2010.01064.x. [DOI] [PubMed] [Google Scholar]
- 29.Hayashi T, Amakishi E, Inoue M, Hirayama F. Establishment of a cell line panel for the detection of antibodies against human platelet antigen 4b. Int J Hematol. 2011;93:170–5. doi: 10.1007/s12185-011-0772-4. [DOI] [PubMed] [Google Scholar]
- 30.Campbell K, Rishi K, Howkins G, et al. A modified rapid monoclonal antibody-specific immobilization of platelet antigen assay for the detection of human platelet antigen (HPA) antibodies: a multicentre evaluation. Vox Sang. 2007;93:289–97. doi: 10.1111/j.1423-0410.2007.00989.x. [DOI] [PubMed] [Google Scholar]
- 31.Thibaut J, Mérieux Y, Rigal D, Gillet G. A novel assay for the detection of anti-human platelet antigen antibodies (HPA-1a) based on peptide aptamer technology. Haematologica. 2012;97:696–704. doi: 10.3324/haematol.2011.051276. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Stafford P, Garner SF, Huiskes E, et al. Three novel beta3 domain-deletion peptides for the sensitive and specific detection of HPA-4 and six low frequency beta3-HPA antibodies. J Thromb Haemost. 2008;6:376–383. doi: 10.1111/j.1538-7836.2008.02843.x. [DOI] [PubMed] [Google Scholar]