Genotyping of human neutrophil antigens by polymerase chain reaction sequence-based typing

Abstract

Background

Genotyping for human neutrophil antigen (HNA) systems is required in the investigation of disorders involving alloimmunisation to HNA. We established a polymerase chain reaction sequence-based typing method for genotyping HNA and determined the genotype and allele frequencies of HNA in the Zhejiang Han population of China.

Materials and methods

Four hundred, healthy unrelated Zhejiang Han individuals were recruited. Specific primers for HNA were designed and the polymerase chain reaction amplification conditions were optimised. Amplification amplicons were purified with enzyme digestion and then sequenced.

Results

The frequencies of the FCGR3B*01 and FCGR3B*02 alleles were 0.613 and 0.387; no FCGR3B*03 allele was found. The frequencies of the SLC44A2*1 and SLC44A2*2 alleles were 0.654 and 0.346, respectively, while the frequencies of the ITGAL*1 (HNA-5a) and ITGAL*2 (HNA-5b) alleles were 0.896 and 0.104. Only ITGAM*1 (HNA-4a) allele was found in this study. Six single nucleotide polymorphisms were confirmed on sequenced regions separate from HNA polymorphisms, including FCGR3B (IVS3+39G >A and IVS3+52G >A), CD177(172A >G), SLC44A2 (IVS5-44A >G and IVS7-15T >C) and ITGAM (IVS3+118T >C).

Discussion

The polymerase chain reaction sequence-based typing method for genotyping HNA is reliable. These data of HNA alleles frequencies could contribute to the analysis of alloimmunisation to HNA in China.

Introduction

Human neutrophil antigens (HNAs) are polymorphic structures located on several glycoproteins in the neutrophil membrane. Eight antigens have currently been defined and assigned to five antigen systems (HNA-1 through HNA-5 systems)¹. It has been proven that the antigens of the HNA-1,-2, -3,-4 and -5 systems are located on CD16, CD177, choline transporter-like protein-2 (CTL-2), CD11b and CD11a, which are encoded by FCGR3B, CD177, SLC44A2, integrin alpha M (ITGAM) and integrin alpha L (ITGAL), respectively^1–4. HNAs play an important role in provoking immune neutropenia and transfusion reactions. Neutrophil antigens and antibodies have been found to be associated with a variety of clinical conditions, including neonatal immune neutropenia, transfusion-related acute lung injury (TRALI), refractoriness to granulocyte transfusion, febrile transfusion reaction, immune neutropenia after bone marrow transplantation, autoimmune neutropenia and drug-induced immune neutropenia^5–7.

The molecular mechanisms of the HNA-1, -3, -4, and -5 systems have been elucidated and are attributed to nucleotide polymorphisms of FCGR3B, SLC44A2, ITGAM and ITGAL, respectively^2–4. Meanwhile, the HNA-2 null allele is the result of different off-frame insertions at the RNA level, resulting in CD177 deficiency on neutrophils⁸. The distribution of the genotypes and alleles of HNA systems has been characterised in a variety of populations using several genotyping approaches^9–12 and the frequencies of the HNA antigens have been shown to be significantly different in different ethnic populations^12–18. In the present study, we established a polymerase chain reaction (PCR) sequence-based typing (SBT) assay combined with high throughput DNA sequencing to identify HNA-1, -3, -4 and -5 system genotypes and the polymorphism of CD177 at position 42 which was found to be associated with atypical expression of HNA-2^19,20. Using this method, we determined genotypes and allele frequencies of HNA-1, -3, -4 and -5 systems in the Zhejiang Han population. To our knowledge, this is the first time that a study has used PCR-SBT to detect HNA-1, -3, -4 and -5 systems, which may help to assess the risk of neutropenia in China.

Materials and methods

Subjects and genomic DNA samples

Peripheral blood samples were collected from 400 unrelated individuals of the Han ethnic group in the Blood Centre of Zhejiang Province, which is located in the east of China. Informed consent was obtained from all participants. Genomic DNA was extracted from whole blood using QuickGene DNA whole blood kits (QuickGene, Kurabo, Japan) according to the manufacturer’s instructions.

Primers for human neutrophil antigen polymerase chain reaction sequence-based typing

The specific primers were designed by Primer3.0 Input Version0.4.0 software (http://frodo.wi.mit.edu/primer3/) to amplify nucleotide fragments including each HNA polymorphism. The primers were selected based on the DNA sequences with the size range of amplification products, primer size and Tm value. The nucleotide positions of these primers were more than 50 bp from the HNA polymorphisms. The amplification amplicons ranged from 330 to 526 bp, contained variant nucleotides for the HNA-1, -3, -4 and -5 systems and the polymorphism of CD177 at position 42 (Table I). All forward primers and reverse primers had added M13F and M13R sequences and are underlined in Table I.

Table I.

DNA sequences of oligonucleotide primers for HNA system genotyping.

HNA system	Forward primer sequence (5′-3′)	Reverse primer sequence (5′-3′)	Amplicon size (bp)
HNA-1	TGTAAAACGACGGCCAGTGGGCCAAGATGCTCTAAGAC	CAGGAAACAGCTATGACCCAGTGGGACCACACATCATC	526
HNA-3	TGTAAAACGACGGCCAGTCTTTTCCCCCTGTGAATGTG	CAGGAAACAGCTATGACCCATGCCCATCCTCATAGGTC	521
HNA-4	TGTAAAACGACGGCCAGTCTCCCCACATGTCGAAGTTT	CAGGAAACAGCTATGACCGGACAGATATGGGCATGGTC	455
HNA-5	TGTAAAACGACGGCCAGTTCTGATATTCCCCACCCTGA	CAGGAAACAGCTATGACCACCCTAAGACCCCTGTCCAC	330
C42G polymorphism of CD177	TGTAAAACGACGGCCAGTCTGCTGAAAAAGCAGAAAGAGAT	CAGGAAACAGCTATGACCTAGGCTGAGAGGCTGGAAAG	457

Polymerase chain reaction amplification conditions for human neutrophil antigens

The PCR amplification conditions for the HNA-1, -3, -4, and -5 systems and genotyping of the C42G polymorphism of CD177 were same. The PCR mixture contained 50–100 ng of genomic DNA, 200 μmol/L of each dNTP (TaKaRa, Dalian, China), 2.0 μL 10×PCR buffer (TaKaRa), 2.0 mmol/L MgCl₂, 0.4 μmol/L of forward and reverse primers, and 1.0 U Taq DNA polymerase (TaKaRa) in a final volume of 20 μL. The PCR amplification was performed with initial denaturing at 95 °C for 5 minutes followed by 35 cycles of 30 seconds at 95 °C, 30 seconds at 63 °C, and 45 seconds at 72 °C, plus a final extension at 72 °C for 10 minutes. The amplicons were verified in 2% agarose gel stained with ethidium bromide and visualised by ultraviolet light (GeneGenius, Syngene, Cambridge, UK).

DNA sequencing

To degrade excess primers and nucleotides from the extension PCR amplicons for the subsequent sequencing reaction, 10 units of exonuclease I (TaKaRa) and 2 units of shrimp alkaline phosphatase (Promega, Madison, WI, USA) were added to each 20 μL of PCR amplicon, then the mixture was digested at 37 °C for 30 minutes, followed by 15 minutes at 80 °C in an ABI 9700 PCR instrument (Applied Biosystems, Foster City, CA, USA). The purified PCR amplicons were sequenced with two primers (M13F 5′TGTAAAACGACGGCCAGT 3′ and M13R 5′CAGGAAACAGCTATGACC3′). Sequencing was performed using an ABI BigDye^® 3.0 Terminator Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. The sequencing reaction conditions included an initial denaturating step at 95 °C for 5 minutes, followed by 25 cycles at 95 °C for 10 seconds, 50 °C for 10 seconds, 60 °C for 4 minutes, and cooling to 4 °C in an ABI 9700 PCR instrument. The ethanol/acetate sodium method was applied to purify the sequencing reaction amplicons, and then the amplicons were electrophoresed using an ABI 3730 DNA sequencer (Applied Biosystems). The sequence data were analysed by SeqScapev2.5 software (Applied Biosystems). All nucleotides sequences obtained were compared with standard HNA sequences from the GenBank database.

Statistical analysis

Genotype and allele frequencies were calculated by the counting method. The validity of the Hardy-Weinberg equilibrium was tested by calculating expected numbers of subjects for each genotype, as described previously¹⁶. Agreement of the observed and expected genotypes, based on the Hardy-Weinberg equilibrium, was determined using the chi-square test. The level of statistical significance was set at P <0.05. The probabilities of incompatibility of different HNA systems after random transfusions were calculated using the following formula:

$$\text{mismatch\hspace{0.17em}probability}={\text{a}}^2(1-{\text{a}}^2)+{\text{b}}^2(1-{\text{b}}^2)=2\text{ab\hspace{0.17em}}(1-\text{ab})$$

where a and b are the frequencies of the HNA alleles²¹.

Results

Human neutrophil antigen genotyping by polymerase chain reaction sequence-based typing

The amplicons of the HNA-1,-3,-4,-5 systems and the polymorphism of CD177 at position 42 of the samples had strong and specific single fragments. The sequencing chromatograms showed that each evenly spaced peak had only one colour with the number of signals from 1,000 to 2,000, and lacked baseline noise, suggesting that excellent sequences were obtained. Partial DNA sequencing chromatograms from these samples are shown in Figure 1.

Figure 1.

Partial DNA sequencing chromatograms of the HNA-1, -3, -4 and -5 systems and the polymorphism of CD177 at position 42 by PCR-SBT. The arrows indicate the variant nucleotides. S=C and G, Y=C and T, R=A and G.

The genotype and allele frequencies of human neutrophil antigens in the Chinese Han population

The data regarding the genotypes of the HNA-1, -3, -4 and -5 systems and the polymorphism of CD177 at position 42 of all random samples in the Chinese Han population were analysed and are shown in Table II. The genotype distributions of these HNA systems were consistent with the Hardy Weinberg equilibrium (P >0.05, Table II). Among the HNA-1, -3, -4 and -5 systems, HNA-1 and HNA-3 systems had the highest polymorphisms; only ITGAM*1+,2− (HNA-4aa) homozygotes were found for the HNA-4 system. The frequencies of FCGR3B*01+,*02, FCGR3B*01+,*02+, and FCGR3B*01−,*02+ genotypes were 0.350, 0.525, and 0.125 respectively and the frequencies of the FCGR3B*01 and FCGR3B*02 alleles were 0.613 and 0.387, respectively. No FCGR3B*03 allele was found. The frequencies of the SLC44A2*1+,*2−, SLC44A2*1+,*2+, and SLC44A2*1−,*2+ genotypes were 0.440, 0.428, and 0.132, respectively, while the frequencies of the SLC44A2*1 and SLC44A2*2 alleles were 0.654 and 0.346, respectively. The frequencies of the ITGAL*1+,2−, ITGAL*1+,2+, and ITGAL*1−,2+ genotypes were 0.800, 0.193 and 0.007, respectively, while the frequencies of ITGAL*1 (HNA-5a) and ITGAL*2 (HNA-5b) alleles were 0.896 and 0.104, respectively. The frequencies of 42C/C, 42C/G and 42G/G genotypes of the CD177 gene were 0.450, 0.463, and 0.087, respectively, in this study and the frequencies of CD177 42C and 42G alleles were 0.681 and 0.319. A comparison of allele frequencies of HNA-1, -3, -4, and -5 systems in different populations is presented in Table III.

Table II.

Frequencies of HNA-1, HNA-3, HNA-4, HNA-5 and C42G polymorphism of CD177 in the Chinese population.

HNA system	Genotype	Nucleotides	Observed number	Expected number	Hardy-Weinberg
					χ2	P
HNA-1	FCGR3B*01+,*02−,*03−	141G,147C,227A,266C,277G,349G	140/400	150/400
	FCGR3B*01+,*02+,*03−	141C/G,147C/T,227A/G,266C,277A/G,349A/G	210/400	190/400	4.4400	>0.05
	FCGR3B*01−,*02+,*03−	141C,147T,227G,266C,277A,349A	50/400	60/400
	FCGR3B*03+	141C,147T,227G,266A,277A,349A	0/400	0/400
HNA-3	SLC44A2*1+,*2−	461G	176/400	171/400
	SLC44A2*1+,*2+	461G/A	171/400	181/400	1.2200	>0.05
	SLC44A2*1−,*2+	461A	53/400	48/400
HNA-4	ITGAM*1+,2−	302G	400/400	/
	ITGAM*1+,2+	302G/A	0/400	/	/	/
	ITGAM*1−,2+	302A	0/400	/
HNA-5	ITGAL*1+,2−	2466G	320/400	321/400
	ITGAL*1+,2+	2466G/C	77/400	75/400	0.3030	>0.05
	ITGAL*1−,2+	2466C	3/400	4/400
C42G polymorphism of CD177	CD177 42CC	42C	180/400	186/400
	CD177 42CG	42G/C	185/400	173/400	1.5130	>0.05
	CD177 42GG	42G	35/400	41/400

Table III.

Comparison of the allele frequencies of the HNA-1, -3, -4, and -5 systems in different populations.

Population	HNA-1				HNA-3			HNA-4			HNA-5
	number	FCGR3B *01	FCGR3B *02	FCGR3B *03	number	SLC44A2 *1	SLC44A2 *2	number	ITGAM *1	ITGAM *2	number	ITGAL *1	ITGAL *2
Zhejiang (this study)	400	0.613	0.387	0.000	400	0.654	0.346	400	1.000	0.000	400	0.896	0.104
Guangzhou Han17	493	0.667	0.333	0.000	195	0.738	0.262	493	0.996	0.004	493	0.854	0.146
Japanese15	500	0.622	0.378	0.000	570	0.654	0.346	570	1.000	0.000	508	0.840	0.160
Thai population13	300	0.470	0.530	0.005	300	0.490	0.510	300	0.973	0.027	300	0.790	0.210
Danish population12	200	0.365	0.635	0.030	366	0.814	0.186	210	0.881	0.119	210	0.724	0.276
English Caucasoid14	140	0.318	0.668	0.014	104	0.768	0.232	104	0.882	0.118	104	0.736	0.264

Estimated probabilities of incompatibility

The estimated probabilities of incompatibility regarding HNA-1, -3 and -5 systems in the Chinese Han population after transfusion were 0.36, 0.35, and 0.17, respectively. The chance of incompatibility to HNA-4a was very low because only ITGAM*1 (HNA-4a) allele-positive individuals were found among the 400 individuals studies. These results may help to predict the risk of HNA alloimmunisation in the Chinese Han population.

Six single nucleotide polymorphisms on the human neutrophil antigen gene

After sequencing, six single nucleotide polymorphisms were identified apart from the HNA polymorphisms in the sequenced regions. Two of them, IVS3+39G >A and IVS3+52G >A (dbSNP numbers rs202089363 and rs201867931), were in the FCGR3B gene, two other mutations, IVS5-44A >G and IVS7-15T >C (dbSNP numbers rs12972963 and rs1560711), were in the SLC44A2 gene, one mutation IVS2-179T >C (rs3815801) was in the ITGAM gene and the last mutation, 172 A >G (the position was calculated from the coding ATG) in exon 2, was in CD177 gene, and resulted in an amino acid change threonine to alanine at positive 58. Table IV shows the position of these mutations and the allele frequencies, which ranged from 0.004 to 0.655.

Table IV.

The genotypes and allele frequencies of single-nucleotide polymorphisms in the genes separate from HNA polymorphisms.

Gene	Polymorphisms	Location	N		Genotypes		Allele frequencies
FCGR3B	IVS3+39G>A rs202089363	Intron3	400	G/G	G/A	A/A	G	A
				232	168	0	0.790	0.210
FCGR3B	IVS3+52G>A rs201867931	Intron3	400	G/G	G/A	A/A	G	A
				51	349	0	0.564	0.436
CD117	172A>G	Exon2	400	A/A	A/G	G/G	A	G
				397	3	0	0.996	0.004
SLC44A2	IVS5-44A>G rs12972963	Intron5	400	A/A	A/G	G/G	A	G
				54	168	178	0.345	0.655
SLC44A2	IVS8-15T>C rs1560711	Intron8	400	T/T	T/C	C/C	T	C
				178	169	53	0.656	0.344
ITGAM	IVS3+118T>C rs3815801	Intron3	400	T/T	T/C	C/C	T	C
				218	154	28	0.738	0.262

Discussion

Screening and identification of HNA and antibodies to them are important for the diagnosis and prevention of disorders associated with HNA alloimmunisation^5–7. With the development of molecular research of HNA systems, genotyping of the HNA-1, -3, -4, and -5 systems has become possible based on molecular genetic knowledge. PCR sequence-specific primers (PCR-SSP), PCR with restriction fragment length polymorphisms (PCR-RFLP), and real-time PCR techniques have been described^9–12, but there is a paucity of reports on HNA genotyping using the PCR-SBT method. The PCR-SSP method is currently widely used for HNA genotyping in laboratories^9–10, since it has the advantages of being simple, rapid and requiring limited equipment. Recently, Nielsen et al.¹² described a real-time PCR for HNA genotyping, which is a rapid, automated and high throughput assay based on quantitative PCR, but the accuracy of these methods may be affected by novel variant mutations in the HNA systems. Compared to these genotyping methods, the PCR-SBT method has the obvious advantage of discriminating genetic polymorphisms and is the only way to define new genetic variants²¹.

In this study, we developed a PCR-SBT method for the accurate determination of the alleles of the HNA-1, -3, -4, and -5 systems. The primers designed for the PCR amplifications and the sequencing reactions excluded the known polymorphism sites to avoid the possibility of missing one of the HNA alleles. Excellent sequences were obtained and the genotypes of the HNA systems were successful assigned, which suggested that the PCR-SBT method was reliable. Unfortunately, we did not use other validated techniques to confirm the results of our sequencing method. Moreover, the method was not validated for FCGR3B*03+ or ITGAM*2 (HNA-4b) allele amplification because neither FCGR3B*03+ or ITGAM*2 alleles were found in this study. Although PCR-SBT has the advantages of high accuracy, its disadvantage is the high cost of equipment and complicated operations, which might make the technique not suitable for routine use in most laboratories when compared to real-time PCR-based technique and the PCR-SSP method.

The frequency and distribution of HNA alleles have been investigated in a variety of populations. The frequencies of FCGR3B alleles in our study were similar to those of other studies in the Guangzhou Han and Japanese populations^15,17, but were significantly different from those of Caucasian populations in which the FCGR3B*02 was the high-frequency allele^12,14,22,23. The frequency of SLC44A2*1 was higher than that of SLC44A2*2, which is a previously reported finding^12,15,17, but the frequency of SLC44A2*1 in our study population was lower than that in Danish (0.814), Zambian (0.974) and English Caucasoid (0.768) populations^12,14. Furthermore, Flesch et al. reported a single nucleotide polymorphism 457C >T in the SLC442A2 gene, which was found in the Caucasian population at a frequency of 1.0%²⁴. It was reported that this variant may yield false-negative genotyping results for SLC44A2 if the specific primer encompasses the mutation. We, however, did not find this variant in our study. Only ITGAM*1 allele-positive individuals were found, indicating that the frequency of ITGAM*2 allele is very low in the Chinese Han population, which supports the data from the Chinese Han population of Guangzhou¹⁷, but contrasts with the frequency of ITGAM*2 in a Caucasoid population in which it was relatively high, with a frequency of 0.119 in the Danish population¹². The frequency of the ITGAL*2 allele was 10% in our study, which was similar to that in the Guangzhou population¹⁷, but lower than that in Caucasoid populations^12,14. Our data and other reports^12–18 confirm that the frequencies of HNA antigens differ significantly in different ethnic populations.

HNA-2 antigen was found on the CD177 glycoprotein⁸. Currently, only individual with defective CD177 expression (called NBnull) is able to form isoantibody. Moritz et al. reported that A134T, G156A and G1333A in the CD177 gene were associated with atypical expression of HNA-2 and Caruccio et al. reported that the C42G missense mutation was associated with the level of expression of HNA-2 on the neutrophil surface^19,20. The C42G polymorphism is not associated with alloimmunisation events, but individuals carrying the 42C allele have higher expression of HNA-2 compared to 42G carriers²⁰. We found that the frequency of 42C allele was twice that of the 42G allele, these frequencies being similar to those in the Caucasian population and in other studies^17,25.

The HNA-1, -3 and -5 systems showed polymorphisms and incompatibility of these HNA could potentially lead to alloimmunisation. Attention must, therefore, be paid to the involvement of the HNA-1,3 and 5 systems in HNA clinical disorders in the Chinese Han population. It should be noted that the process of alloimmunisation depends inherently on many immunological factors, not only caused by antigen incompatibility. We also described six single nucleotide polymorphisms in the sequence regions, most of which common in the population. Although most of the single nucleotide polymorphisms were located in the intron region and did not affect amino acid expression, the data acquired are a useful resource for the design of HNA allele-specific amplification primers and will also help to improve the accuracy of genotyping.