Abstract
Three Malaysian ginger cultivars (Bukit Tinggi, Tanjung Sepat and Sabah) were collected and examined for genetic polymorphisms using microsatellite DNA primers. The single microsatellite oligonucleotide primers (CATA)5, (GATA)5 and (GAC)6 were used in polymerase chain reactions (PCRs). These PCR reactions produced 7 polymorphic bands with an average of 2.334 polymorphic bands per primer, leading to an average polymorphism rate of 17.9%. Cluster analysis revealed 87.50% similarity between Bukit Tinggi and Tanjung Sepat, 64.27% similarity between Bukit Tinggi and Sabah and 56.25% similarity between Tanjung Sepat and Sabah. DNA sequencing of the polymorphic PCR products of Tanjung Sepat ginger revealed the characteristic features of a putative new gene: a core promoter sequence, an enhancer and a transcription start site. Cluster analysis using the unweighted pair group method with arithmetic average (UPGMA) was used to construct a phylogenetic tree, which indicated that Bukit Tinggi ginger is genetically more closely related to Tanjung Sepat ginger than to Sabah ginger. Based on the results of this study, we concluded that there is genotypic variation among ginger cultivars, and the microsatellite DNA primers described here are useful for detecting polymorphic DNA in Malaysian ginger cultivars. Additionally, these microsatellite DNA primers may be used as molecular markers for discriminating among select Malaysian ginger cultivars.
Keywords: Ginger (Zingiber officinale Roscoe), Microsatellite DNA, PCR, Polymorphic DNA
Abstract
Tiga kultivar halia Malaysia (Bukit Tinggi, Tanjung Sepat dan Sabah) telah dikumpul dan diperiksa untuk polimorfisme genetik menggunakan primer DNA mikrosatelit. Primer oligonukleotida mikrosatelit tunggal (CATA)5, (GATA)5 dan (GAC)6 telah digunakan dalam reaksi rantai polimerase (PCR). Reaksi PCR ini telah menghasilkan 7 jalur polimorfik dengan purata 2.334 jalur per primer, dengan kadar purata polimorfisme 17.9%. Analisis kluster telah menunjukkan bahawa terdapat 87.50% persamaan antara Bukit Tinggi dan Tanjung Sepat, 64.27% persamaan antara Bukit Tinggi dan Sabah dan 56.25% persamaan antara Tanjung Sepat dan Sabah. Jujukan DNA produk polimorfik PCR menunjukkan ciri-ciri gen baru: satu jujukan promoter teras, satu penggalak dan satu lokasi mula transkripsi. Analisis kluster menggunakan unweighted pair group method with arithmetic average (UPGMA) telah digunakan untuk membina pokok filogenetik, yang telah menunjukkan bahawa halia Bukit Tinggi lebih mempunyai hubungan dengan halia Tanjung Sepat berbanding halia Sabah. Berdasarkan dapatan kajian ini, kami telah membuat kesimpulan bahawa terdapat variasi genotipik antara kultivar halia, dan primer mikrosatelit DNA yang telah dihuraikan disini berguna untuk mengesan DNA polimorfik kultivar halia Malaysia. Selain itu, primer mikrosatelit DNA ini boleh digunakan sebagai penanda molekul untuk membezakan kultivar terpilih halia Malaysia.
INTRODUCTION
Ginger (Zingiber officinale Roscoe) is an important tropical horticultural plant that is valued worldwide as a spice and for its medicinal properties. Members of the family are distributed in the tropics of southern and southeastern Asia, especially in Indo-Malaysia (Simpson 2006; Awang 1992). Chinese records show that ginger was cultivated in the Malacca region of Malaysia in 1416 (Weiss 2002). Currently, ginger is cultivated throughout tropical and sub-tropical regions worldwide, including areas of Australia, Brazil, China, India, Jamaica, West Africa and parts of the United States.
Ginger, as a species, is thought to have arisen as a sterile hybrid between two distant species that survived due to successful vegetative propagation (Peter et al. 2007). Malaysia and neighbouring countries recognise two divisions: the Z. officinale cultivar group officinale “ginger” and the Z. officinale cultivar group “rubrum” with small, pungent, reddish rhizomes (Weiss 2002).
Traditionally, ginger was used as an acrid bitter to strengthen and stimulate digestion. Modern uses include prophylaxis for nausea and vomiting, dyspepsia, lack of appetite, anorexia, colic, bronchitis and rheumatic complaints. More than 400 chemicals have been identified in ginger rhizomes (Garner-Wizard et al. 2006). Geography, age of the rhizome at harvest, extraction methods, storage and drying determine the relative proportions of each chemical.
It is very difficult to distinguish among ginger cultivars (Ibrahim 1999) without depending on chemical and/or molecular markers because the morphological or phenotypic characteristics of the aboveground biomass are not sufficiently unique to adequately discriminate among ginger cultivars. However, some morphological characteristics of the ginger rhizome can be used to discriminate among Malaysian ginger cultivars. For example, the rhizome of Bukit Tinggi ginger is bigger with a dull, whitish colour and it is less fibrous compared with Tanjung Sepat ginger, which has a yellowish, fibrous, slender rhizome [Global Information Hub on Integrated Medicine (Globinmed) 2013]. The rhizome of Sabah ginger tends to be darker in colour with few red-to-brown ribbons of colour. To differentiate among ginger cultivars, a more precise and accurate method was established based on metabolic fingerprinting, in which variations in chemical constituents were detected and some chemical markers for each ginger cultivar were established (Mahdi et al. 2010).
Despite the importance of ginger in cuisine and especially in medicine, very little information is available regarding the genome of ginger. Tools such as bacterial artificial chromosome (BAC) libraries or molecular marker-based genetic maps have not been produced, or at least, no such resources have been released or even mentioned in the literature because this plant is not amenable to the production of genetic maps (Moore et al. 2008). Ginger was reported to be diploid (somatic chromosome number: 2n = 22) with a large genome of 23.618 Mb (Wahyuni et al. 2003). The total chromosome length ranged from 64.80 μm to 98.12 μm, and the total chromosome volume ranged from 84.35 μm3 to 1126.36 μm3. The chromosome conformation capture (4C DNA) varied significantly among different cultivars of ginger (from 16.234 pg to 22.934 pg) (Ravindran & Babu 2004). Because ginger is vegetatively propagated, local cultivars often tend to be uniform and develop specific characteristics.
Microsatellite DNA, also referred to as simple sequence repeat (SSR) DNA, consists of 1 to 6 nucleotides repeated 5–50 times and can be found within coding or non-coding regions in the genome (Hartwell et al. 2008; Walker & Rapley 2005; Weising et al. 2005). Microsatellites have been predicted to play important roles in maintaining genetic stability. These elements are highly polymorphic (because of their potential for faulty replication), co-dominant (Jayabalan 2006), evenly dispersed through the eukaryotic genome (Bernot 2004; Weising et al. 1995) and require little DNA for analysis, all of which make them favourable for use in genetic mapping experiments (Soltis et al. 1998). Microsatellite DNA can be used as markers for the detection of allelic variation, genetic mapping studies, germplasm characterisation and gene tagging (Hayden & Sharp 2001). Recently, microsatellite DNA has been largely used by researchers as a molecular marker (Craft et al. 2007). The principal reason for the increasing success of microsatellites as molecular markers is that they can detect more polymorphisms than other techniques such as restriction fragment length polymorphism (RFLP) and random amplified polymorphic DNA (RAPD) (Weising et al. 2005).
In this study, three single oligonucleotide microsatellite primers were used: two 20-mers [(CATA)5 and (GATA)5] with 25% GC and one 18-mer [(GAC)6] with 75% GC. The selection of primer sequences was based on the evidence that microsatellite markers with trinucleotide and tetranucleotide repeat motifs amplify more faithfully and are, on average, more polymorphic than dinucleotides (Taylor 1997) in addition to being more abundant (Sharma 1999). Selection of the first two primer sequences [(CATA)5 and (GATA)5] was performed according to Weising et al. (1995), who used these two primers to detect DNA polymorphisms in tomato and Actinidia chinensis. Our study revealed that these primers could be successfully used in ginger. The third primer, (GAC)6, is a novel primer that has not previously been used for the detection of DNA polymorphisms in plants. To ensure that the polymorphic band(s) were consistently present and could be considered as molecular markers, the procedure was repeated four times for each of the tested ginger cultivars using the selected primers.
This study aimed to detect genetic diversity among three selected Malaysian ginger cultivars and to verify the usefulness of microsatellite DNA as a molecular marker for differentiation between ginger cultivars.
MATERIALS AND METHODS
Genomic DNA Isolation
Isolation of ginger genomic DNA was performed according to Doyle and Doyle (1990) with some modifications. Briefly, ginger leaf tissue was ground to a fine powder under liquid nitrogen using a pre-chilled mortar and pestle. The leaf powder was then transferred into a 2 ml Eppendorf tube containing a smaller volume (750 μl) of pre-heated (60°C) cetyltrimethylammonium bromide (CTAB) extraction buffer.
Polymerase Chain Reaction (PCR) Amplification
PCR with single oligonucleotide primers was performed in a final reaction volume of 50 μl containing 75 ng of template DNA, 100 mM deoxyribonucleotide triphosphates (dNTPs), 60 ng of primer, 1.5 mM MgCl2, 1X Taq buffer + KCl [10 mM Tris-HCl (pH 8.8), 50 mM KCl, 0.08% Nonidet P40], 1 U of Taq DNA polymerase and de-ionised water to make up the volume. The PCRs were carried out using the following conditions: a preliminary denaturation at 94°C for 2 min, followed by 40 cycles of denaturation at 94°C for 20 s, annealing at 45°C for 30 s for (CATA)5 and (GATA)5 primers or 55°C for 30 s for the (GAC)6 primer, and an extension step at 72°C for 30 s. A single final extension step was performed at 72°C for 10 min.
Extraction and Amplification of Polymorphic Bands
To determine the existence of polymorphic bands, the amplified DNA was examined by gel electrophoresis using ethidium bromide and a UV spectrophotometer (SmartSpec Plus, BIO-RAD, USA). Polymorphic PCR bands were eluted from the agarose gel using a QIAquick gel extraction kit (Cat. no. 28704; Qiagen, Kuala Lumpur). These eluted DNA fragments were then amplified by PCR using the (CATA)5, (GATA)5 and (GAC)5 primers.
DNA Sequencing of Polymorphic DNA Fragments
DNA sequencing of polymorphic DNA fragments was performed by 1st Base (Seri Kembangan, Selangor, Malaysia) utilising a BigDye® Terminator V 3.1 cycle sequencing kit (Invitrogen, California, USA) (based on Sanger dideoxy sequencing).
RESULTS AND DISCUSSION
Evaluation of Isolated Genomic DNA
The isolated genomic DNA from the 3 ginger cultivars was qualitatively tested using 0.8% (w/v) agarose gels (Fig. 1). Gel electrophoresis showed no fragmentation of the isolated DNA, with only one clear band obtained for each ginger cultivar. Quantitative and qualitative evaluation of the isolated genomic DNA was performed using a UV spectrophotometer to determine its concentration and purity, and the results are presented in Table 1. The results reveal variation in the isolated ginger genomic DNA concentration among the three samples, which may be due to the use of leaves of different ages. Such leaves may contain different numbers of cells per unit weight and may exhibit variation in cell wall rigidity due to deposition of cellulose, thus causing difficultly in breaking or lysing the cell wall. The isolation of pure and non-fragmented DNA is essential to avoid false positive identification of PCR products after gel electrophoresis.
Figure 1:
Genomic DNA isolated from the ginger cultivars Bukit Tinggi (BT), Tanjung Sepat (TS) and Sabah (SB).
Table 1:
Concentration and purity of the isolated genomic DNA.
| Ginger cultivar | DNA concentration (μg/ml) | A260/A280 ratio |
|---|---|---|
| Bukit Tinggi | 151.6637 | 1.6624 |
| Tanjung Sepat | 30.2700 | 1.8520 |
| Sabah | 150.5050 | 1.7253 |
PCR Amplification and Characterisation
Three single oligonucleotide microsatellite primers were used [(CATA)5 and (GATA)5 with 25% GC and (GAC)6 with 75% GC] to amplify specific regions of DNA. Polymorphic bands were visualised and identified in the gel using an electrophoresis imaging documentation system. Several PCR parameters, such as MgCl2 and DNA template concentrations, were examined during the experiment to obtain optimum amplification conditions that yield repeatable and consistent results. The (GAC)6 primer, which is a novel primer that has not been used for the detection of DNA polymorphisms in plants, amplified a specific polymorphic band from Tanjung Sepat ginger (Fig. 2). GAC encodes an aspartate residue in a coding region. The use of the sequence GAC in the (GAC)6 primer therefore enhances the possibility that this primer will bind to a coding region in the genome. The (CATA)5 primer produced strong polymorphic bands 1.25 kb in length (Fig. 3), and the (GATA)5 primer produced a single band in the Sabah cultivar (Fig. 4).
Figure 2:
Polymorphic bands were obtained in the Bukit Tinggi (BT) and Tanjung Sepat (TS) cultivars using the (GAC)6 primer.
Figure 3:
Polymorphic bands were obtained in the Tanjung Sepat (TS) cultivars using the (CATA)5 prime.
Figure 4:
Polymorphic bands were obtained in the Bukit Tinggi (BT) and Tanjung Sepat (TS) cultivars using the (GATA)5 primer.
A band was considered polymorphic if it was present in at least one ginger cultivar and absent in the others. The bands were scored as (1) for present or (0) for absent. A total of 39 bands were amplified, ranging in size from 185.0 bp to 1.3 kb. Band sizes were calculated with reference to a 1 kb gene ladder using a UV spectrophotometer and gel documentation system (Fluorchem 8900 imaging system, Protiensimple, California, USA). Seven polymorphic bands were scored with a polymorphism rate of 17.9%. This polymorphism rate is low compared with that observed in other studies, which may be due to the small sample size. However, the low polymorphism rate may be expected because ginger is known to exhibit extremely narrow genetic diversity compared with other plants (Keshavachandran et al. 2007). Furthermore, low genetic variation is typical in an asexually reproducing species (Hangelbroek et al. 2002).
Cluster analysis revealed 87.50% similarity between Bukit Tinggi and Tanjung Sepat, 64.27% similarity between Bukit Tinggi and Sabah and 56.25% similarity between Tanjung Sepat and Sabah. A similarity matrix was generated according to the coefficient of Jaccard (Sneath & Sokal 1973).
where Sij is the Jaccard similarity coefficient, M11 is the number of 1-1 matches, M10 is the number of 1-0 matches and M01 is the number of 0-1 matches (Table 2).
Table 2:
Similarity coefficients of the three Malaysian ginger cultivars.
| Cultivars | M11 | M01 | M10 | Sij |
|---|---|---|---|---|
| BT-TS | 14 | 2 | 0 | 0.8750 |
| BT-SB | 9 | 0 | 5 | 0.6427 |
| TS-SB | 9 | 0 | 7 | 0.5625 |
Note:
BT: Bukit Tinggi, TS: Tanjung Sepat, SB: Sabah, Sij: Jaccard similarity coefficient
The similarity coefficient value ranged from 0.5625 to 0.8750. The data in the similarity matrix were used to perform a cluster analysis using the unweighted pair group method with arithmetic average (UPGMA). Subsequently, a phylogenetic tree illustrating the calculated relatedness among ginger cultivars was constructed using MINITAB software (release 14, Minitab Inc., USA). Based on these data, the Tanjung Sepat cultivar was genetically more closely related to the Bukit Tinggi cultivar compared with the Sabah cultivar, and the Sabah cultivar was genetically more closely related to the Tanjung Sepat cultivar (Fig. 5). Palai and Rout (2007) identified eight varieties of ginger using RAPD markers. These authors mentioned that the first major cluster exhibited 43% similarity, whereas the minor cluster exhibited >70% similarity.
Figure 5:
Dendrogram of the three ginger cultivars (Bukit Tinggi, BT; Tanjung Sepat, TS; and Sabah, SB) produced using data obtained with microsatellite DNA markers.
Sequencing of Polymorphic Bands
After separation of the PCR products on a 3% agarose gel, the polymorphic bands of the Tanjung Sepat cultivar were extracted using a gel extraction kit (Qiagen), re-amplified using the same primers and PCR conditions and sequenced. The DNA sequence of the polymorphic bands of Tanjung Sepat contained the characteristic features of a putative gene. According to Toth et al. (2000), GC-rich trinucleotide repeat sequences are primarily found within exon regions. The upstream region of the PCR products obtained with the (GAC)6 primer contained a core sequence (CGGCGG), enhancer (CAAT), promoter and TATA box, and a CAAT sequence was identified downstream of the transcription start site. According to Smale and Kadonaga (2003), TATA sequences are recognised by RNA polymerase II for initial transcription. Their locations vary from species to species, although they are predicted to be located 30 to 120 bp upstream of the transcription start site in most eukaryotic genes.
The DNA sequences of the polymorphic bands of Tanjung Sepat were analysed and compared to determine their similarity with accessible published nucleotide sequences using National Centre for Biotechnology Information Basic Local Alignment Search Tool (NCBI BLAST) (retrieved at http://blast.ncbi.nlm.nih.gov/Blast.cgi). The sequences of the polymorphic bands produced with the (CATA)5 primer were most similar to Brassica napus subsp. of the family Brassicaceae (96% similarity) and to Oryza sativa japonica of the family Poaceae (85% similarity). The sequence of the polymorphic band produced with the (GAC)6 primer was most similar to Larix lyallii of the family Pinaceae (94% similarity), Morella faya of the family Myricaceae (96% similarity) and Pinus pinaster of the family Pinaceae (93% similarity), whereas the sequence of the polymorphic band produced with the (GATA)5 primer was most similar to Medicago truncatula of the family Fabaceae (93% similarity) and to Vitis vinifera of the family Vitaceae (92% similarity). The putative promoter sequences TATAAAAA, CAAT and CGGCGG, which were observed in the Tanjung Sepat genomic DNA fragment amplified with the (CATA)5 primer, are underlined in DNA sequence below:
Sequence of a polymorphic PCR product amplified from the Tanjung Sepat cultivar using the (CATA)5 primer (774 bases)
| 1 | AGTTCCTACTAGTACGGTGGGATAGAGGTGAGTGATGAATAGTACGTTGA |
| 51 | TTGGTGTTAAGTGAAAGACTGCTGCATGACCCCATGAAAAGACTAACTTG |
| 101 | CCCGCTTACTGCATCAGGGTACCACTGTGGTCGGGCCCTATAATGAGTCG |
| 151 | TGTTTGAATTCACCGAACGTCGTGTTGGGGAAAAACGAGTCCCAAGGAGT |
| 201 | AATAGGCACAACGCCAACACCAATCGGCCTTCCCATGGATTGGGGAACGT |
| 251 | GCATGGCGAATGGACGCGCCCTGGCCCGGCGCATTGAGCGCGTCGGGTGC |
| 301 | GGCGGATACGCTCATCTTGACCCTCAACCGTATCTGGGGGTCTATTCATA |
| 351 | TGATCCGAAGGGAATTTTGCCGATTTACAGCTCTATTGGTATAAAAAATG |
| 401 | AGCTTGTTTCAACAATTTTTTTAACGCTGAATTCTTCACAAAAGTTATTC |
| 451 | GGGGTAACAATTTTCCCTGGATGCGGTATTTTCCTCCTTAACTCATCAGG |
| 501 | GCCGGTAGTTTCACACCCTCGTAAGTGCCCCTCCACAAGACAAATATGCT |
| 551 | TCAGATGCCGCCTTAATATAACTCCAACCCCCCCACTTCAGGCCAACTAT |
| 601 | CGGTTAACGCGTCCCTCACGGGCTTTTGTCTTGCACACTGTTCTATCGAG |
| 651 | CTTCCCACCACAGGGTCTTGGTGGAACGTTCCATCGGGATAGTTCTTGAT |
| 701 | GCTGCCCCCTAGAAAAGTTATTATCCCCGCATGTCAATGAAGAGAGAAAA |
| 751 | CCCGGGTGAAGAAAACCAAAGAAA (774) |
Sequence of a polymorphic PCR product amplified from the Tanjung Sepat cultivar using the (GATA)5 primer (350 bases)
| 1 | GTCGAAGTAAGTGACTCTTTGTGATGTCTTCGATCCTAACTACTCCGGAT |
| 51 | GCTTTCGGGCATGGGTTTCTATGTTACATTTAGATGTTTGATCTCTGTGG |
| 101 | CTCTCTTTCATTATACTTACTTCCGTCGTTCCTTTCTTATTGTTTGGCGG |
| 151 | AACATGGCTATCTTGCGCTTGCGCGAGGTTGAAGGTGGGGGAGCCCCCAA |
| 201 | TTTGGGAACCGCCAGCCTGGGGAACTCCCGGATTTTTTTTTTCCAACCCC |
| 251 | TTTATATGAATCCCCCGGAGCTTTGTGGGGAAACACCCGGGATGCCCCAA |
| 301 | ATTCCTATCACCAATTAGACAAATCAACCTCCTTCCAAAAAAAAAAAATG (350) |
Sequence of a polymorphic PCR product amplified from the Tanjung Sepat cultivar using the (GAC)6 primer (950 bases)
| 1 | ACGAGATAGCATTCGCCCTGGGTGGGTAGCAGTGCACTCACTGGAGGGCG |
| 51 | TTGACTACGATTCGACGGGGAGGTTTTGGCCGTCCCAACTGGAAAAACCC |
| 151 | GGGGGACGCCCCCCTTAATCCCCTTGGCGTAGTACCCCATAGGCCCTGCGG |
| 201 | GCTCTGGCGTCCCAAGGCCCACGCCGATGCCGGGCCCGGGTAGCAGTTGCG |
| 251 | GAATGGGAAAGGGAAACGCACGGT GGCGGCACCTTAGCGTTAGCGGGCGC |
| 301 | GGGGGGGGCGCGCACCCGGACCGTGACCGTTGCACTTGCCAATAGCGCCA |
| 351 | GCGCCCACTGCTTTCGTCTCTTCCCCTTAAGTTATAGTAAGGGCGCCGCT |
| 401 | TTTGCCTTCGAAACGAGGGGTGGGCACCGGGTACGGATCCGATTTTTGCG |
| 451 | TTACCGCGACTCCACAATAGTTGATTTGATTGATGGGAGGATTCACGCAC |
| 501 | TTTCCCCTCGATTGAAATACTTTATTTTTGGATTTTGGATCAAACTCTAT |
| 551 | TAAAAAAAGAACCCATTTTTGATAATTATTGGAACATTAATCAAATTTAG |
| 601 | CTCATTTTATTTTTTTTTATAAAAAAATGAATTTTAATTTTTTCAATTTA |
| 651 | AAGCAAAATTAAACCAGATTAAAAAAAAAATTTTTTTCCCAAATTTTTAA |
| 701 | AAAAAATAATTAACCTTAAATTTTTCCTTTTCAAAATTTTATTCGGTGTA |
| 751 | ATTTTTTTGTCGCGTTTTTTTCTCAACCCCAAATGGTTGAACCCTCATTA |
| 801 | AAATCCGGCCCAAAACCCCTAAATTAAAACTAACCCCCTAAAAACCCGCA |
| 851 | AAACCCTCTGTATACAAGCACCCGACTGGGGATTCTTTTTCCTCCACATC |
| 901 | ATGTTATTTTTATATAAAAATAATATTCTCTATTTATCTTCCAAAAATTTC (950) |
The specific DNA sequences of the PCR products obtained with the (GATA)5 primer were found to contain poly deoxy thymine nucleotides (dT) and poly deoxy adenine nucleotides (dA) sequences (underlined), which encode phenylalanine and lysine, respectively. The sequences of the polymorphic bands amplified from the Tanjung Sepat cultivar with the (CATA)5 primer also showed characteristic features of a putative gene; however, more detailed study is required to support this hypothesis.
Ginger is a sterile plant that is only vegetatively propagated by rhizomes, and the phenotypic properties of such plants cannot be improved using traditional breeding methods. Thus, the only available solution is the use of “selective breeding” based on the identification of specific genes that are responsible for the desired phenotype. This process requires isolation and cloning of the gene as well as transformation of plant cells with the gene before a plant with new and improved properties can be genetically engineered. Metabolic profiling of the same three ginger cultivars used in this study, which were micropropagated under the same growth conditions, were determined using gas chromatography-mass spectrometry (GC-MS), and chemical variations were detected among the three cultivars (Mahdi et al. 2010). It is possible that these chemical variations may be due to underlying genetic variation. This study is considered to be the first step toward further studies in which transgenic ginger plants with improved yield and increased medically active components may be produced.
CONCLUSION
In the current study, microsatellite primers were successfully used to identify genetic polymorphisms among three ginger cultivars (Bukit Tinggi, Tanjung Sepat and Sabah). Microsatellite primer PCR amplification can therefore be used successfully to differentiate between different ginger cultivars. A cluster analysis of polymorphic bands using MINITAB software and the Jaccard similarity coefficient revealed that Bukit Tinggi ginger is more closely genetically related to Tanjung Sepat ginger than to Sabah ginger. Additionally, this genetic polymorphism may be responsible for the quantitative and qualitative variations in chemical constituents that were detected in previous studies. Further investigations are required to support this hypothesis.
Acknowledgments
The authors would like to thank Prof Dr Mohamad Osman, Faculty of Science and Technology, Universiti Kebangsaan Malaysia (UKM), for providing software and advice regarding data analysis. We also acknowledge the department of Molecular Biology, Faculty of Medicine, International Islamic University Malaysia (IIUM), for providing some of the laboratory facilities used for conducting the experiment.
REFERENCES
- Awang DVC. Ginger. Canadian Pharmaceutical Journal. 1992;125(7):309–311. [Google Scholar]
- Bernot A. Genome: Transcriptome and proteome analysis. Chichester, UK: John Wiley and Sons Ltd; 2004. p. 33. [Google Scholar]
- Craft KJ, Owens JD, Ashley MV. Application of plant DNA markers in forensic botany: Genetic comparison of Quercus evidence leaves to crime scene trees using microsatellites. Forensic Science International. 2007;165(1):64–70. doi: 10.1016/j.forsciint.2006.03.002. [DOI] [PubMed] [Google Scholar]
- Doyle JJ, Doyle JL. Isolation of plant DNA from fresh tissue. Focus. 1990;12(5):13–15. [Google Scholar]
- Garner-Wizard M, Milot SHB, Neustadt EJ, Oliff HS, Oppel M, Rapp C, Webb D. Ginger – an herbal medicinal product with broad anti-inflammatory actions. Journal of Medicinal Food. 2006;8(2):125–132. doi: 10.1089/jmf.2005.8.125. [DOI] [PubMed] [Google Scholar]
- Global Information Hub on Integrated Medicine (Globinmed) Halia. Kuala Lumpur: Herbal Medicine Research Centre, Institute for Medical Research; 2013. http://www.globinmed.com/index.php?option=com_content&view=article&id=79353:halia#1 (accessed on May 7 2013) [Google Scholar]
- Hangelbroek HH, Ouborg NJ, Santamaria L, Schwenk K. Clonal diversity and structure within a population of the pondweed potamogeton pectinatus foraged by Bewick’s Swans. Molecular Ecology. 2002;11(10):2137–2150. doi: 10.1046/j.1365-294x.2002.01598.x. [DOI] [PubMed] [Google Scholar]
- Hartwell LH, Hood L, Goldberg ML, Reynolds AE, Lee M, Veres SRC. Genetics from genes to genomics. 3rd ed. Boston: McGraw Hill; 2008. [Google Scholar]
- Hayden MJ, Sharp PJ. Targeted development of informative microsatellite (SSR) markers. Nucleic Acid Research. 2001;29(8):2–6. doi: 10.1093/nar/29.8.e44. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ibrahim H. Gingers of hill and montane forests of Peninsular Malaysia. Bulletin Heliconia Society International. 1999;9(4):10–13. [Google Scholar]
- Jayabalan N. Plant biotechnology. New Delhi: A. P. H. Publishing Corporation; 2006. p. 73. [Google Scholar]
- Keshavachandran R, Nazeem PA, Girija D, John PS, Peter KV. Recent trends in horticultural biotechnology. New Delhi: New India Publisher; 2007. p. 197. [Google Scholar]
- Mahdi HJ, Andyayani R, Ishak Metabolic fingerprinting of three Malaysian ginger (Zingiber officinale Roscoe) using gas chromatography-mass spectrometry. American Journal of Applied Sciences. 2010;7(1):17–23. [Google Scholar]
- Moore PH, Ming R, Delmer DP. Genomics of tropical crop plants. New York: Springer Science; 2008. [Google Scholar]
- Palai SK, Rout GR. Identification and genetic variation among eight varieties of ginger by using random amplified polymorphic DNA markers. Plant Biotechnology. 2007;24(4):417–420. [Google Scholar]
- Peter KV, Ravindran PN, Divakaran M. Horticulture: Vegetable science (vegetables, tubers and spice crops), breeding of spice crops (black pepper, cardamom, ginger and turmeric) 2007. http://nsdl.niscair.res.in/bitstream/123456789/471/1/revised+Breeding (accessed on 23 April 2008) [Google Scholar]
- Ravindran PN, Babu KN. Ginger The genus Zingiber. Boca Raton, Florida, USA: CRC Press; 2004. [Google Scholar]
- Sharma A. Plant chromosomes: Analysis, manipulation and engineering. Amsterdam: Harwood Academic Publishers; 1999. [Google Scholar]
- Simpson MG. Plants systematic. Amsterdam: Elsevier Academic Press; 2006. p. 198. [Google Scholar]
- Smale ST, Kadonaga JT. The RNA Polymerase II Core promoter. Annual Review of Biochemistry. 2003;72(1):449–479. doi: 10.1146/annurev.biochem.72.121801.161520. [DOI] [PubMed] [Google Scholar]
- Sneath PHA, Sokal RR. Numerical taxonomy: The principles and practice of numerical classification. San Francisco: Freeman; 1973. p. 573. [Google Scholar]
- Soltis DE, Soltis PS, Doyle JJ. Molecular systematic of plants II DNA sequencing. Boston: Kluwer Academic Publishers; 1998. [Google Scholar]
- Taylor GR. Laboratory methods for the detection of mutations and polymorphisms in DNA. Boca Raton, Florida, USA: CRC Press; 1997. p. 32. [Google Scholar]
- Toth G, Gaspari Z, Jurka J. Microsatellites in different eukaryotic genomes: Survey and analysis. Genome Research. 2000;10(1):967–981. doi: 10.1101/gr.10.7.967. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wahyuni S, Xu DH, Bermawie N, Tsunematsu H, Ban T. Genetic relationships among ginger accessions based on AFLP marker. Journal Biotechnology Partanian. 2003;8(2):60–68. [Google Scholar]
- Walker JM, Rapley R. Microsatellite analysis Medical bio-methods handbook. New Jersey, USA: Humana Press Inc; 2005. pp. 33pp. 463–469. [Google Scholar]
- Weising K, Atkinson RG, Gardner RC. Genomic fingerprinting by microsatellite-primed PCR: A critical evaluation. New York: Cold Spring Harbor Laboratory Press; 1995. [DOI] [PubMed] [Google Scholar]
- Weising K, Nybom H, Wolff K, Kahl G. DNA fingerprinting in plants: Principles, methods, and applications. 2nd ed. Boca Raton, Florida, USA: CRC Press Taylor & Francis Group; 2005. [Google Scholar]
- Weiss EA. Spice crop. Wallingford, UK: CABI Publishing; 2002. [Google Scholar]





