Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2014 Jan 8;289(9):5664–5673. doi: 10.1074/jbc.M113.534644

Mlh1-Mlh3, a Meiotic Crossover and DNA Mismatch Repair Factor, Is a Msh2-Msh3-stimulated Endonuclease*

Maria V Rogacheva ‡,1, Carol M Manhart ‡,1, Cheng Chen ‡, Alba Guarne §, Jennifer Surtees , Eric Alani ‡,2
PMCID: PMC3937641  PMID: 24403070

Background: Meiotic crossing over requires resolution of Holliday junctions through actions of the DNA mismatch repair factor Mlh1-Mlh3.

Results: Mlh1-Mlh3 is a metal-dependent, Msh2-Msh3-stimulated endonuclease.

Conclusion: Our observations support a direct role for Mlh1-Mlh3 endonuclease activity in recombination and repair.

Significance: An enzymatic activity is identified for a key recombination and repair factor.

Keywords: DNA Enzymes, DNA Mismatch Repair, DNA Recombination, DNA Repair, Meiosis, Mlh1-Mlh3, Crossing Over, Endonuclease

Abstract

Crossing over between homologous chromosomes is initiated in meiotic prophase in most sexually reproducing organisms by the appearance of programmed double strand breaks throughout the genome. In Saccharomyces cerevisiae the double-strand breaks are resected to form three prime single-strand tails that primarily invade complementary sequences in unbroken homologs. These invasion intermediates are converted into double Holliday junctions and then resolved into crossovers that facilitate homolog segregation during Meiosis I. Work in yeast suggests that Msh4-Msh5 stabilizes invasion intermediates and double Holliday junctions, which are resolved into crossovers in steps requiring Sgs1 helicase, Exo1, and a putative endonuclease activity encoded by the DNA mismatch repair factor Mlh1-Mlh3. We purified Mlh1-Mlh3 and showed that it is a metal-dependent and Msh2-Msh3-stimulated endonuclease that makes single-strand breaks in supercoiled DNA. These observations support a direct role for an Mlh1-Mlh3 endonuclease activity in resolving recombination intermediates and in DNA mismatch repair.

Introduction

DNA mismatch repair (MMR)3 is a conserved mechanism that acts during DNA replication to remove DNA polymerase misincorporation errors such as base-base and insertion/deletion mismatches. In the well characterized Escherichia coli MMR system, MutS recognizes and binds mismatches, recruiting MutL. This interaction relays mismatch recognition by MutS to the MutH endonuclease, resulting in nicking at nearby GATC sites of the unmethylated, newly replicated strand. MutH nicking provides an entry point for UvrD helicase and single-stranded exonucleases that then excise the mismatch, resulting in a gap that is filled in by replicative DNA polymerases (1).

Multiple MutS and MutL homologs (MSH and MLH, respectively) have been identified in eukaryotes. In Saccharomyces cerevisiae, the MSH complexes Msh2-Msh6 and Msh2-Msh3 bind to DNA mismatches and interact primarily with the MLH complex Mlh1-Pms1 to activate mismatch excision and DNA re-synthesis steps (1). Msh2-Msh6 primarily acts to repair base-base and small insertion/deletion mismatches, whereas Msh2-Msh3 primarily acts to repair larger (up to 17 nucleotides) insertion/deletion loop mismatches (1). A minor MMR pathway has been identified that involves recognition of insertion/deletion mismatches by Msh2-Msh3 followed by interaction with the Mlh1-Mlh3 complex (2, 3). Interestingly, subsets of MSH and MLH proteins act in a distinct, interference-dependent, meiotic crossover pathway (see below).

MutH-type endonucleases have not been identified in eukaryotes; however, a subset of MLH complexes displays DNA nicking activity (4). For example, human Mlh1-Pms2 (hMutLα) and bakers' yeast Mlh1-Pms1 display latent endonuclease activities that are essential for mismatch repair (5, 6). Studies on human MMR by Modrich and co-workers (5, 6) have suggested that hMutLα nicking activity, which is directed to an existing nick, provides access to exonucleases (e.g. Exo1) that act in mismatch excision and may also facilitate strand discrimination. Mutations in a DQHAX2EX4E metal binding motif present in both human Pms2 and yeast Pms1 disrupt both MLH endonuclease activity and MMR (5–7). Recently, two groups reported the crystal structures of the endonuclease domain of MLH proteins (8, 9). For Bacillus subtilis MutL, the endonuclease domain consisted of dimerization and regulatory subdomains connected by a helical lever spanning the conserved endonuclease motif. Such an organization was proposed to serve as a regulatory module to prevent MutL from promiscuously nicking DNA. The authors also suggest that interactions involving MutL and other protein factors, such as MutS and processivity clamp, trigger conformational changes in this motif that modulate MutL endonuclease activity (8).

Crossing over in meiotic prophase in most sexually reproducing organisms creates physical connections between chromosome homologs that are critical for their proper segregation in Meiosis I (10). In bakers' yeast, meiotic recombination is initiated by the formation of about 140–170 double-strand breaks located throughout the genome (11–15). Approximately 40% of these double-strand breaks are converted into crossovers between homologous chromosomes, and the remainder are repaired as noncrossovers or by using a sister chromatid as a template (16). These double-strand breaks are resected to form 3′ single-strand tails that primarily invade the unbroken homolog and undergo pairing with complementary sequences. Stabilized invasion intermediates (single-end invasion intermediates) are converted into double Holliday junctions (dHJs) and ultimately resolved into crossovers (17, 18). Work in bakers' yeast has suggested that the majority of crossovers are formed in an interference-dependent pathway where dHJs, stabilized by Msh4-Msh5 (19–21), are resolved through the actions of the Sgs1 helicase, the Exo1 XPG nuclease (in steps not requiring its exonuclease activity), and a putative Mlh1-Mlh3 endonuclease activity (22–27).

Little is known at the biochemical level about how Sgs1, Exo1, and Mlh1-Mlh3 act on crossover intermediates and how Msh4-Msh5 might coordinate Mlh1-Mlh3. One model gaining increasing attention is that Msh4-Msh5 restricts a putative Mlh1-Mlh3 endonuclease activity to recombination intermediates that are resolved to crossover products, and Sgs1 acts as a pro-crossover factor creating a specific dHJ structure that can be readily cleaved by an endonuclease activity intrinsic to Mlh1-Mlh3 (25). These ideas are supported by the genetic and physical studies cited above as well as the following. 1) Msh4-Msh5 can bind to both single-end invasion and Holliday junction substrates in vitro (20). 2) Mlh3 contains a DQHAX2EX4E metal binding motif (Fig. 1A). 3) Cell biological assays show that Mlh1-Mlh3 acts downstream of Msh4-Msh5 in meiosis (28–30). 4) Crossing over in bakers' yeast meiosis is reduced by ∼2-fold in mlh3Δ mutants and to a much greater extent (7–16-fold) in mms4Δ mlh3Δ mutants defective in both interference-dependent and -independent crossover pathways (21, 27, 31–33).

FIGURE 1.

FIGURE 1.

Purification of the Mlh1-Mlh3 complex. A, organization of Mlh3 including the conserved ATP binding domain (dark blue boxes) in the highly conserved N-terminal domain (cyan), the 117-amino acid predicted linker domain (gray box), the Mlh1 interaction domain in the less well conserved C-terminal domain of Mlh3 (blue box), and residues within interaction domain that form part of the endonuclease active site (red box). The aspartic acid residue at amino acid 523 that was mutated to asparagine (D523N) is indicated with an arrow. B, left panel, schematic of the Mlh1-Mlh3 complex based on crystal structures (8, 9, 57, 69, 70), including predicted lengths of linker arms (144 amino acids for Mlh1, 117 amino acids for Mlh3) and location of His10, HA epitope, and FLAG epitope insertions. In this model Mlh1 and Mlh3 are each composed of two globular domains connected by a flexible linker, and Mlh1 and Mlh3 interact though their C-terminal domains. The N-terminal ATP binding domains of both proteins are highly conserved among the MutL homologs and undergo ATP-dependent conformational changes. Mlh1 is in green, and Mlh3 is in blue. Right panel, SDS-PAGE analysis of purified Mlh1-Mlh3 (WT) and Mlh1-mlh3-D523N (DN). Coomassie Blue R250-stained 8% Tris-glycine gel: 0.5 μg of Mlh1-mlh3-D523N; 0.5 μg of Mlh1-Mlh3; mw = molecular mass standards from top to bottom: 200, 116, 97, 66, 45, 31 kDa. C, mass spectrometry analysis of bands detected after Q-Sepharose chromatography.

A DQHAX2EX4E metal binding motif found in MLH endonucleases was identified in the beginning of the C-terminal domain of Mlh3 (Fig. 1A). Nishant et al. (26) showed that a mutation in this motif, mlh3-D523N, created a dominant negative allele and conferred a null phenotype for Mlh3 functions in both MMR and meiotic crossing over. They also suggested that Mlh1-Mlh3 possesses an endonuclease activity required for its meiotic crossing over and MMR functions. We present the purification of bakers' yeast Mlh1-Mlh3 and demonstrate that it is a metal-dependent endonuclease that nicks supercoiled DNA. Mlh1-Mlh3 also facilitates binding of Msh2-Msh3 to insertion/deletion mismatches in vitro, and its endonuclease activity on supercoiled DNA is stimulated by Msh2-Msh3. In conjunction with previous genetic data, our work supports a role for the Mlh1-Mlh3 endonuclease in MMR and in resolving recombination intermediates.

EXPERIMENTAL PROCEDURES

Media

S. cerevisiae strains were grown at 30 °C in either yeast extract-peptone, 2% dextrose (YPD) media or minimal selective media (SC) containing 2% dextrose (34). When required for selection, Geneticin (Invitrogen) was used at the recommended concentrations (35, 36).

Oligonucleotides

All oligonucleotides (Table 1) were obtained from Integrated DNA Technologies. Oligonucleotides were 5′ end-labeled with [γ-32P]ATP (PerkinElmer Life Sciences) by T4 polynucleotide kinase (New England Biolabs). Unincorporated nucleotide was removed by P6 spin column (Bio-Rad). Substrates were annealed by combining end-labeled oligonucleotide with a 2-fold molar excess of unlabeled complementary sequence in buffer containing 10 mm Tris-HCl, pH 7.75, 100 mm NaCl, 10 mm MgCl2, and 0.1 mm EDTA. Reactions were incubated at 95 °C for 5 min and cooled to 25 °C by ∼1 °C/min.

TABLE 1.

Oligonucleotides (shown 5′ to 3′) used in this study

S2 TCAACGTGGGCAAAGATGTCCTAGCAAGTCAGAATTCGGT
S8 ACCGAATTCTGACTTGCTAGGTGTGTGTGACATCTTTGCCCACGTTGA
AO3144 ACAGCTACCGAATTCTGACTTGCTAGGACATCTTTGCCCACGTTGACCC
AO3142 GGGTCAACGTGGGCAAAGATGTCCTAGCAAGTCAGAATTCGGTAGCGTG
AO3143 CACGCTACCGAATTCTGACTTGCTAGGTGTGTGTGACATCTTTGCCCACGT TGACCC
AO3147 (X26-1) GCGCTACCAGTGATCACCAATGGATTGCTAGGACATCTTTGCCCA CCTGCAGGTTCACCC
AO3148 (X26-2) GGGTGAACCTGCAGGTGGGCAAAGATGTCCTAGCAATCCATTGTC TATGACGTCAAGCTC
AO3149 (X26-3) GAGCTTGACGTCATAGACAATGGATTGCTAGGACATCTTTGCCGT CTTGTCAATATCGGC
AO3150 (X26-4) GCCGATATTGACAAGACGGCAAAGATGTCCTAGCAATCCATTGGT GATCACTGGTAGCGC

49-bp homoduplex and +8 substrates were constructed from end-labeled AO3142 and either AO3144 (homoduplex) or AO3143 (+8) as described (37). Holliday junction substrate X26 (Ref. 38; 26 bp homologous core allowing branch migration) was constructed from end-labeled X26-1 (AO3147), AO3148, AO3149, and AO3150. Annealed substrates were purified by PAGE (38) or with HR S-300 spin columns (GE Healthcare) for acrylamide gel shift and filter binding studies.

FLAG Tag Insertion in MLH1

A DNA fragment containing the MLH1 open reading frame and a FLAG tag inserted after amino acid 448 in Mlh1 (39) was cloned between the XhoI and SphI sites of pFastBacDual (Invitrogen; downstream of the p10 promoter) to create pEAE348.

HIS10 Tag Insertion in MLH3(S288C)

A His10 tag was inserted at the N terminus of Mlh3. The resulting His10-MLH3 construct was inserted into the SalI and NotI sites of pFastBacDual (Invitrogen, downstream of the pPH promoter) to create pEAE352.

HA Tag Insertion in MLH3 (S288C)

Overlap-extension PCR (40) was used to insert an HA tag (underlined) flanked by alanine residues (AAAYPYDVPDYAAAA) immediately after aspartic acid 466 of Mlh3 in pEAE352 to create pEAE358. A His10-MLH3-HA fragment was then excised from pEAE358 and introduced into pEAE348 to form pEAE360, which contains the MLH1-FLAG gene downstream of the p10 promoter and His10-MLH3-HA downstream of the pPH promoter.

mlh3-D523N (S288c)

The mlh3-D523N mutation was introduced into pEAE358 by Quick Change (Stratagene, La Jolla, CA). The resulting vector, pEAE367, contained His10-MLH3-D523N-HA downstream of the pPH promoter. The His10-mlh3-D523N-HA fragment was then excised from pEAE367 and introduced into pEAE348 to form pEAE369, which contains the MLH1-FLAG gene downstream of the p10 promoter and His10-mlh3-D523N-HA downstream of the pPH promoter. All PCR-amplified fragments were verified by DNA sequencing (Cornell BioResource Center).

Integrating Vectors Containing MLH3 (SK1) Expressed through Its Native Promoter

Two integrating vectors were constructed: pEAI384 (MLH3(SK1)-466HA-KanMX) and pEAI385 (His10-MLH3(SK1)-466HA-KanMX).

ARS-CEN Vectors Containing MLH3 (SK1) Expressed through Its Native Promoter

The following ARS-CEN LEU2 vectors, which contain 400 bp of DNA sequence upstream of the MLH3 start codon and 400 bp downstream of the MLH3 stop codon, were constructed: pEAA566 (MLH3(SK1)), pEAA569 (MLH3(SK1)-466HA), and pEAA567 (His10-MLH3(SK1)-466HA).

Lys+ Reversion Assays

pRS415 (ARS-CEN LEU2; Ref. 41), pEAA566, pEAA567, and pEAA569 were transformed into EAY2037 (MATa, ho::hisG, ura3, leu2::hisG, ade2::LK, his4xB, mlh3Δ::KanMX, lys214::insE-A14) using standard methods (42). EAY2186 (MATa, ho::hisG, ura3, leu2::hisG, ade2::LK, his4xB, MLH3::KanMX, lys214::insE-A14) served as a wild-type control. Plasmids were maintained in EAY2037 in leucine dropout minimal selective media. Rates of reversion to Lys+, 95% confidence intervals, and all computer aided rate calculations were performed as previously described (43–46).

Purification of Mlh1-Mlh3 from Baculovirus-infected Sf9 Cells

pFastBacDual constructs pEAE360 (Mlh1-Mlh3) and pEAE369 (Mlh1-mlh3-D523N) were used in the Bac-to-Bac baculovirus expression system (Invitrogen) according to the manufacturer's instructions. Mlh1-FLAG and His10-Mlh3-HA or His10-mlh3-D523N-HA were co-expressed by infecting Sf9 insect cells (Invitrogen) with amplified baculovirus at a multiplicity of infection of 5 in SF-900 III SFM medium (Invitrogen). For a typical purification, 300 ml of cells were harvested 60 h post-infection by centrifugation at 4000 rpm for 10 min. Cells were washed with PBS, pelleted, and flash-frozen in liquid N2.

Cell pellets were thawed, resuspended in hypotonic lysis buffer (20 mm KH2PO4 pH 8.0, 5 mm KCl, 1 mm MgCl2, 0.5% Tween 20, 1 mm PMSF) with EDTA-free protease inhibitor mixture (Roche Applied Science and Thermo Scientific), and incubated on ice for 15 min. The suspension was adjusted to 100 mm KCl, 200 mm NaCl, 15 mm imidazole, 10% glycerol, 1.4 mm β-ME, and clarified by centrifugation at 17,000 × g for 15 min. Supernatant was loaded at 4 °C onto nickel-nitrilotriacetic acid-agarose (Qiagen). The column was washed with binding buffer (20 mm KH2PO4 pH 8.0, 100 mm KCl, 200 mm NaCl, 15 mm imidazole, 10% glycerol, 1.4 mm β-ME, 0.5% Tween 20, 1 mm PMSF) and with washing buffer (binding buffer containing 40 mm imidazole). Protein was eluted with 300 mm imidazole in 50 mm KH2PO4, pH 7.5, 100 mm KCl, 200 mm NaCl, 10% glycerol, 0.2% Tween 20, 1.4 mm β-ME, 1 mm PMSF.

Elution fractions containing Mlh1-Mlh3 were pooled and diluted to 33 mm KCl and 67 mm NaCl with 12 mm HEPES-KOH, pH 7.5, 10% glycerol, 0.2% Tween 20, 1.5 mm EDTA, 6.6 mm β-ME, 1 mm PMSF. Sample was loaded onto a heparin column (GE Healthcare) equilibrated in Buffer A (25 mm HEPES-KOH, pH 7.5, 33 mm KCl, 67 mm NaCl, 1 mm EDTA, 10% glycerol, 0.2% Tween 20, 5 mm β-ME). The column was washed with 5 volumes of Buffer A and eluted with a linear gradient of NaCl (67–600 mm). Mlh1-Mlh3 fractions, which eluted at ∼500 mm NaCl, were dialyzed in Buffer B (20 mm KH2PO4, pH 7.5, 100 mm KCl, 0.1 mm EDTA, 10% (v/v) glycerol, 0.05% Tween 20, 5 mm β-ME, 1 mm PMSF) and loaded onto a Q-Sepharose (Sigma) column equilibrated with Buffer B. The column was washed with 5 volumes of Buffer A and eluted with a linear gradient of NaCl (0–600 mm) in Buffer B. Mlh1-Mlh3 fractions eluting at ∼400 mm NaCl were pooled and concentrated with Amicon Ultracel-50K centrifugal filters. Aliquots were frozen in liquid N2 and stored at −80 °C. Mlh1-Mlh3 yield was ∼100 μg per 6 × 108 cells.

Purified Mlh1-Mlh3 was resolved by Coomassie-stained SDS-PAGE. Individual bands were excised and analyzed by the Cornell University Proteomics Facility using a Thermo LTQ Orbitrap Velos Mass Spectrometer (Fig. 1C). Protein concentrations were determined by the Bradford assay (47) using BSA standards.

Endonuclease Assay on Supercoiled and Linear Duplex DNA Substrates

Mlh1-Mlh3 nicking activity was assayed on supercoiled or nicked pUC19 (Thermo Scientific). Nicked substrate was prepared by digesting supercoiled pUC19 with Nt.BstNBI (New England Biolabs) and desalting by P-30 spin column (Bio-Rad). DNA (5 nm) was incubated in 20-μl reactions containing Mlh1-Mlh3 (300 nm or indicated amounts) in 20 mm HEPES-KOH, pH 7.5, 20 mm KCl, 0.2 mg/ml BSA, 1% glycerol, and 1 mm concentrations of the indicated divalent ion (MnSO4, MgCl2, ZnCl2, CdSO4, CoCl2, NiSO4, CaCl2) for 1 h at 37 °C. Reactions were quenched by incubation for 20 min at 37 °C with 0.1% SDS, 14 mm EDTA, and 0.1 mg/ml proteinase K (New England Biolabs) (final concentrations). Samples were resolved by 1% agarose gel with 0.1 μg/ml ethidium bromide run in 1× TAE (Tris-acetate-EDTA; 40 mm Tris base, 20 mm acetic acid, 1 mm EDTA) buffer for 40 min at 100 V. All quantifications were performed using GelEval (FrogDance Software, v1.37). Yeast RFC and PCNA were kindly provided by Petr Cejka. Human Mlh1-Pms2 and human Mlh1-Mlh3 were kindly provided by Joe Jiricny and Petr Cejka, respectively.

For assays on oligonucleotides, 1 nm end-labeled homoduplex, +8, or HJ substrates was combined with 2 mm MgCl2, 1 mm ATP, and 150 nm Mlh1-Mlh3 in a buffer containing 20 mm HEPES, pH 7.5, 40 μg/ml BSA, 20 mm KCl, and 1% glycerol on ice in a final volume of 15 μl. Reactions were incubated and terminated as above. Formamide and bromphenol blue were added to final concentrations of 48% and 0.5 mg/ml, respectively. Samples were boiled for 5 min and resolved by 12% PAGE containing 8 m urea and 1× Tris borate-EDTA, run at 300 V for 2 h. Gels were dried on 3MM Whatman paper and visualized by phosphorimaging.

Immunodepletion of Mlh1-Mlh3 Endonuclease Activity

Immunodepletion of Mlh1(FLAG)-Mlh3(HA) with anti-FLAG mouse IgG (Sigma) or control (anti-FliC (flagellin)) mouse IgG (BioLegend) was performed as described previously (5) with minor modifications. Briefly, protein A-agarose beads (Roche Applied Science) were washed extensively with 25 mm HEPES-KOH, pH 7.5, 0.15 m KCl, and 0.02% Nonidet P-40 (equilibration buffer). The beads were incubated with anti-FLAG or control IgG (2.5 μg/μl of packed beads) for 2 h at 4 °C and washed with 100 volumes of equilibration buffer. Mlh1(FLAG)-Mlh3(HA) (0.4 μg/μl of beads) was incubated at 4 °C for 1.5 h with immobilized antibodies in equilibration buffer containing 0.2 m KCl. Supernatants were analyzed by SDS-PAGE and for endonuclease activity on supercoiled DNA.

Electromobility Shift Assays (EMSA)

For agarose EMSA, reactions (20 μl) were performed in 20 mm Tris-HCl, pH 7.5, 40 μg/ml BSA 8% glycerol, 0.1 mm DTT, and 2 mm MgCl2 with 50 ng of 2.7 kb BamHI-digested pUC19 and 100–300 nm Mlh1-Mlh3. Reactions were incubated at 30 °C for 8 min. 0.7% agarose gel was run at 45 V in 45 mm Tris acetate-EDTA buffer for 2 h at 4 °C and visualized by staining with 0.5 μg/ml ethidium bromide.

Acrylamide gel EMSA was performed as described (48). Briefly, 50 nm 5′-32P-end-labeled 40-bp +8 substrate (S2/S8; Ref. 37; Table 1) was combined with 1 mm ATP in 20 mm HEPES, pH 7.5, 40 μg/ml BSA, 1 mm DTT, and 100 mm NaCl. Msh2-Msh3 (80 nm; purified as described in Ref. (37) was added followed by a 5-min incubation at room temperature. Mlh1-Mlh3 (100 nm) was subsequently added followed by 5 min of incubation on ice. Sucrose was then added to a final concentration of 8% (w/v) (15 μl final volume). Samples were resolved by 4% native 0.5× Tris borate-EDTA PAGE run at 15 mA for 2 h at 4 °C. Gels were dried and visualized as above.

DNA filter binding assays were performed as described (49) with the following modifications. Briefly, 40-μl reactions containing 20 mm Tris, pH 7.5, 0.01 mm EDTA, 2 mm MgCl2, 40 μg/ml BSA, 0.1 mm DTT, and the indicated amounts of 32P-end-labeled DNA and Mlh1-Mlh3 were incubated for 8 min at 30 °C. A 32-μl portion of each reaction was filtered through KOH-treated nitrocellulose filters (50) using a Hoefer FH225V filtration unit. Filters were analyzed by scintillation counting.

ATPase Assays

ATPase activity was determined using the Norit A absorption method (51) in 30-μl reactions containing 0.167 μm Mlh1-Mlh3, 100 μm [γ-32P]ATP, 20 mm Tris, pH 7.5, 2.0 mm MgCl2, 0.1 mm DTT, 1 mm MnSO4, 75 mm NaCl, 1% glycerol, 40 μg/ml BSA, and the indicated types of DNA (1.67 μm 69-nucleotide single-stranded DNA, 1.67 μm 69 bp of double-stranded DNA, or 20 ng/μl supercoiled plasmid). Reactions were incubated for 60 min at 37 °C. Hydrolysis of ATP was limited to <20% to ensure constant reaction rate.

RESULTS

Purification of Yeast Mlh1-Mlh3 from Sf9 Insect Cells

Bakers' yeast Mlh1-Mlh3 was purified from Sf9 insect cells infected with pFastBacDual baculovirus constructs expressing both MLH1 and MLH3 (“Experimental Procedures”). In these constructs a FLAG tag (DYKDDDDK) was inserted after amino acid 448 in Mlh1 and His10, and HA (YPYDVPDYA) tags were inserted in Mlh3 at the N terminus and after amino acid 466, respectively (Fig. 1B). The MLH1-FLAG and HIS10-MLH3-HA constructs conferred wild-type functions for DNA mismatch repair in the lys2A14 reversion assay (39, 43; Table 2). Extracts prepared from Sf9 cells overexpressing Mlh1-FLAG and His10-Mlh3-HA were applied to a nickel-nitrilotriacetic acid-agarose column. Peak fractions containing Mlh1-Mlh3 were purified further using heparin and Q-Sepharose chromatography (“Experimental Procedures”). The identity of Mlh1-Mlh3, which purified as a heterodimer with an apparent 1:1 stoichiometry, was confirmed by mass spectrometry (Fig. 1, B and C, and “Experimental Procedures”). Mlh1-mlh3-D523N, containing a mutation in the putative endonuclease domain of Mlh3 shown previously to confer a null phenotype for both DNA MMR and meiotic functions (26), was purified using the same procedure (Fig. 1B). It is important to note that although Mlh1-Mlh3 remained as an intact heterodimer in both column chromatography (Fig. 1) and immunoprecipitation analyses, the subunits separated upon elution from a Superdex 200 HR 10/30 (GE Healthcare Life Sciences) gel-filtration column using buffer containing 50 mm NaH2PO4, pH 7.5, 150 mm NaCl, and 0.01% Tween 20 and variations thereof. We do not have a good explanation for this observation; however, one possibility is that Mlh1-Mlh3 interactions become unstable in specific buffer conditions. Consistent with this idea is a recent structural analysis of bakers' yeast Mlh1-Pms1, suggesting that yeast Mlh3 lacks 11 amino acids present in the C terminus of Pms1 that comprises part of the Mlh1-Pms1 interaction domain (9).

TABLE 2.

MLH3 constructs are functional in MMR

EAY2037 bearing ARS CEN plasmids with the indicated MLH3 genotypes were tested in the lys2::insE-A14 mutator assay for reversion to Lys+ (“Experimental Procedures”). Six independent cultures were tested for each genotype, and the mutation rate with the 95% confidence interval (CI) is presented.

Strain Mutation rate (10−6), 95% CI Relative to wild type
Relevant genotype
    MLH3(SK1)::KanMX 2.0 (1.4–3.0) 1.0
    mlh3Δ::KanMX 13.9 (10.8–20.6) 7.0

Genotype of plasmids introduced into EAY2037
    MLH3(SK1) 2.1 (1.1–5.6) 1.1
    mlh3Δ 15.5 (9.1–23.2) 7.8
    MLH3(SK1)-466HA 2.0 (1.2–3.2) 1.0
    (HIS)10-MLH3(SK1)-466HA 2.0 (1.2–2.9) 1.0
Mlh1-Mlh3 Is a DNA Endonuclease That Nicks Supercoiled DNA

Previously Hall et al. (52) showed using filter binding and electron microscopy assays that the yeast Mlh1-Pms1 complex binds long duplex DNA molecules with positive cooperativity. As shown in an agarose gel shift assay (Fig. 2A), Mlh1-Mlh3 shifted the mobility of duplex plasmid DNA and then formed protein-DNA complexes that became trapped in the well within a narrow concentration range (150–200 nm). These observations encouraged us to test if Mlh1-Mlh3 can cleave plasmid substrates. We tested Mlh1-Mlh3 for endonuclease activity using the supercoiled plasmid pUC19 in reaction conditions similar to those used for B. subtilis MutL (“Experimental Procedures”). As shown in Fig. 2B, supercoiled pUC19 incubated with Mlh1-Mlh3 showed concentration-dependent conversion to the nicked circular form. This nicking activity was not seen in reactions containing Mlh1-mlh3-D523N. The endonuclease activity observed in purified Mlh1-FLAG-Mlh3-HA preparations could be immunodepleted using anti-FLAG but not using a nonspecific control antibody (Fig. 2C). Together these studies provide strong evidence that the Mlh1-Mlh3 heterodimer contains an intrinsic endonuclease activity.

FIGURE 2.

FIGURE 2.

Mlh1-Mlh3 displays an endonuclease activity on supercoiled DNA substrates. See “Experimental Procedures” for details. A, Mlh1-Mlh3 (100, 150, 200, 250, and 300 nm) was incubated with linearized pUC19 DNA, resolved, and analyzed as described under “Experimental Procedures.” Ladder, 1 kb of DNA ladder (New England Biolabs). B, comparison of the nicking activity of Mlh1-Mlh3 (wt) and Mlh1-mlh3-D523N (D523N) in the presence of 1 mm Mn2+ on supercoiled pUC19. Mlh1-Mlh3 is at 150 nm in lanes 3 and 4. In lanes 5–9, Mlh1-Mlh3 is at 50, 150, 200, 250, and 300 nm, respectively. In lanes 10 and 11 Mlh1-Mlh3 D523N is at 150 and 300 nm, respectively. Migration of supercoiled (sc) and nicked (n) DNA is indicated. The linear product is indicated by a black triangle. C, immunodepletion analysis of Mlh1(FLAG)-Mlh3(HA). Mlh1(FLAG)-Mlh3(HA) was incubated with either Protein A-linked mouse anti-FLAG antibodies (anti-FLAG) or control mouse IgG (Control). The immunodepleted supernatants were then assayed for endonuclease activity. D, Mlh1-Mlh3 endonuclease activity is stimulated by a variety of divalent cations. Nicking activity of Mlh1-Mlh3 (150 nm) in the presence of 1 mm Mg2+, Mn2+, Zn2+, Cd2+, Co2+, Ca2+, or Ni2+ is indicated (left). Stimulation of the Mlh1-Mlh3 endonuclease activity in the presence of 1 mm Mn2+ by a second divalent metal ion (1 mm) (right) is shown.

Mlh1-Mlh3 Endonuclease Activity Is Metal-dependent but Not Stimulated by ATP or RFC and PCNA

As shown in Fig. 2B and Fig. 3A, Mlh1-Mlh3 displays a metal-dependent endonuclease activity. We tested different metals in a variety of concentrations and found that optimum stimulatory effects were typically seen at 1 mm concentrations of metal ion. Endonuclease stimulation was observed in the presence of Mn2+ and Co2+ and to lesser extents, Mg2+ and Ca2+. These data suggest a broader metal specificity for Mlh1-Mlh3 endonuclease compared with Mlh1-Pms1, which shows a strict dependence on manganese (5, 6).

FIGURE 3.

FIGURE 3.

Mlh1-Mlh3 endonuclease activity is unaffected by ATP. A, endonuclease activity of Mlh1-Mlh3 (120 nm) on supercoiled (sc) pUC19 DNA in the presence of various concentrations of ATP. + indicates an ATP concentration of 500 μm, and in lanes 8–10 ATP concentrations were 30, 100, 500 μm, respectively. Mg2+ and Mn2+ are present at 1 mm as indicated. The % of supercoiled substrate that was cleaved is indicated. n, nicked. B, endonuclease assays were performed in the same reactions as in A but contained 1 mm Mg2+ (Mn2+ is not present) and 0.5 mm ATP or GTP. nt, nucleotide. C, ATPase activity of Mlh1-Mlh3 in the presence of a 10-fold excess of single-stranded (ssDNA) and double-stranded (dsDNA) oligonucleotides or supercoiled plasmid. See “Experimental Procedures” for details. D, endonuclease activity of yMlh1-Mlh3 was not stimulated by yeast RFC (yRFC) or yeast PCNA (yPCNA). Lanes are from 1–17, left to right. In lanes 1–8, hMlh1-Pms2 (60 nm) was incubated with RFC (100 nm) and PCNA (100 nm) with and without 500 μm ATP. In lanes 9–16, yMlh1-Mlh3 (120 nm) was incubated with RFC (200 nm) and PCNA (200 nm) as indicated with and without 500 μm ATP. Lane 17 contains 200 nm RFC, 200 nm PCNA, and 500 μm ATP in the absence of yMlh1-Mlh3.

We observed synergistic interactions involving metal cofactors. As shown in Fig. 2D, the addition of Zn2+, Cd2+, and Ca2+ to reactions containing Mn2+ resulted in a significant stimulation of Mlh1-Mlh3 endonuclease activity. However, Mg2+ did not further stimulate the Mn2+-dependent nicking activity of Mlh1-Mlh3. These results are consistent with studies showing that the MLH proteins contain conserved motifs surrounding the nuclease motif that are rich in cysteine and histidine residues and are predicted to chelate Zn2+ but not Mg2+ ions (e.g. Refs. 9 and 53). They also appear consistent with work reported by Pillon et al. (8) for BsMutL; they showed that Zn2+ and Co2+ stimulated BsMutL endonuclease incubated with Mn2+ to a greater extent than Mg2+. Furthermore, crystal structures of the endonuclease domain of BsMutL show that Zn2+ binding induces a significant conformational change to the domain. Based on these observations Pillon et al. (8) hypothesized that BsMutL contains a regulatory Zn2+-binding site adjacent to the nuclease active site that when occupied establishes the active conformation of the C-terminal domain, thereby enhancing its nicking activity. Interestingly, the C-terminal domain of human Mlh1-Pms2 appears to bind Zn2+ tighter than the C-terminal domain of BsMutL; Zn2+ is retained during the purification of the C-terminal domain of Mlh1-Pms2, whereas it is lost for BsMutL (8, 53). Conceivably, Mlh1-Mlh3 may also have a tight affinity for Zn2+, thereby relaxing the strict requirement for Mn2+ as the metal ion required for endonuclease activity.

ATP stimulates the endonuclease activity of human and yeast MutLα and B. subtilis MutL (5, 6, 8). In contrast, ATP inhibits the endonuclease activity of full-length Neisseria gonorrhoeae MutL (54). ATP had also been shown to inhibit the endonuclease activity of Thermus thermophilus and Aquifex aeolicus MutL (55), although inhibition was later linked to a concentration effect (56). The addition of ATP (1 to 500 μm) in the presence of Mg2+ and Mn2+ (Mg2+ is included to facilitate binding of ATP to Mlh1-Mlh3 and to prevent ATP from titrating Mn2+ away from the endonuclease reaction) did not stimulate the endonuclease activity of Mlh1-Mlh3 (Fig. 3, A and B). These experiments were performed in the presence of Mn2+ or Mg2+ under conditions where endonuclease activity in the absence of ATP ranged from 10 to 50%, and ionic strength of the reaction ranged from 10 to 100 mm KCl (25 mm KCl and 15 mm NaCl are present in the experiments in Fig. 3A). These conditions were tested because for human MutLα ATP-stimulated endonuclease activity only in low ionic strength (5). Consistent with a lack of an ATP effect, Mlh1-Mlh3 displayed weak ATPase activity (∼0.06 min−1, a few -fold lower than that seen previously for E. coli MutL and yeast Mlh1-Pms1; Refs. 57 and 58) that was not stimulated by the presence of a 10-fold molar excess of 69-bp homoduplex DNA (Fig. 3c).

Kadyrov et al. (5, 6) showed that MutLα endonuclease activity on supercoiled DNA is stimulated by the replication factors RFC (clamp loader) and PCNA (clamp) in steps requiring ATP. One explanation for this observation is that PCNA loaded by RFC onto negatively supercoiled DNA stimulates MutLα endonuclease through protein-protein interactions (6, 59, 60). We were unable to detect stimulation of Mlh1-Mlh3 endonuclease activity by yeast PCNA and RFC (Fig. 3D), but RFC and PCNA stimulated human MutLα as seen previously.4

Msh2-Msh3 Stimulates Mlh1-Mlh3 Endonuclease Activity

Gel shift assays showed that Msh2-Msh3 binds with higher affinity to insertion/deletion loop mismatches (50 nm Kd) compared with homoduplex DNA (220 nm Kd; Refs. 37 and 61). Previously Habraken et al. (62) showed that the binding of Msh2-Msh3 to loop mismatches was enhanced in the presence of yeast Mlh1-Pms1. The enhancement of Msh2-Msh3 binding by Mlh1-Pms1 did not result in a supershift complex containing MSH and MLH proteins as was seen for interactions involving Msh2-Msh6 and Mlh1-Pms1 (e.g. Refs. 63 and 64). One way to explain this result is that Mlh1-Pms1 transiently interacts with loop mismatches to facilitate stable binding of Msh2-Msh3 (see below). Consistent with this idea, Mlh1-Mlh3 also stimulated the binding of Msh2-Msh3 to loop mismatches at concentrations where a stable MLH-DNA complex was not observed in the gel shift assay (Fig. 4A). Similar to studies presented by Habraken et al. (62), this stimulation did not result in the formation of a supershift complex.

FIGURE 4.

FIGURE 4.

Mlh1-Mlh3 endonuclease activity on supercoiled DNA is stimulated by Msh2-Msh3. A, electromobility shift assays were performed as described under “Experimental Procedures.” Mlh1-Mlh3 (100 nm) and Msh2-Msh3 (80 nm) were incubated with the 50 nm 5′-32P-end-labeled 40-bp +8 loop containing substrate in the presence of 1 mm ATP, 2 mm MgCl2, or 2 mm MnSO4 as indicated. A representative assay for five trials is shown. B, nicking (n) activities of yeast and human Mlh1-Mlh3 (120 nm) were measured in the presence of 1 mm Mn2+ and yeast Msh2-Msh3 (120 nm) as indicated. The % of supercoiled substrate (sc) that was cleaved is shown ± S.D. C, endonuclease assays were performed as in B but contained 0–500 μm ATP, 120 nm Mlh1-Mlh3, and 120 nm Msh2-Msh3 when indicated. Reactions were performed in triplicate, samples were resolved on agarose gels, and the percent of DNA that was nicked is plotted. D, endonuclease-deficient yeast Mlh1-Mlh3 is not stimulated by yeast Msh2-Msh3. Nicking activity of yMlh1-Mlh3 and yMlh1-mlh3-D523N (each at 120 nm) was measured in the presence of 1 mm Mn2+, 0.5 mm ATP, and yMsh2-Msh3 (120 nm) as indicated. The % of supercoiled substrate that was cleaved is shown.

The above findings, coupled with previous studies showing that MSH and MLH proteins interact (1, 62), encouraged us to test if Msh2-Msh3 could stimulate Mlh1-Mlh3 endonuclease activity on supercoiled DNA. As shown in Fig. 4, yeast Msh2-Msh3 stimulated the endonuclease activity of yeast Mlh1-Mlh3 but not yeast Mlh1-mlh3-D523N. This stimulation was specific to the yeast proteins because yeast Msh2-Msh3 was unable to stimulate the endonuclease activity of human Mlh1-Mlh3 (Fig. 4B). These data suggest that physical interactions between Msh2-Msh3 and Mlh1-Mlh3 can act to coordinate the Mlh1-Mlh3 endonuclease activity during MMR and provide a model for how Msh4-Msh5 could act as a specificity factor for Mlh1-Mlh3 to resolve HJs in meiosis.

Mlh1-Mlh3 Shows a Modest Preference for Binding to a Loop Mismatch Substrate

As shown in Fig. 5A, Mlh1-Mlh3 bound to duplex oligonucleotides with a moderate preference for a +8 loop mismatch (∼50% of total binding at 50 nm Mlh1-Mlh3) compared with homoduplex substrate (∼50% of total binding at 90 nm). We found this result surprising because previous studies showed that MLH proteins such as Mlh1-Pms1 do not have a preference for binding to mismatch DNA (e.g. Ref. 64). These results encouraged us to test if Mlh1-Mlh3 can cleave oligonucleotide substrates. As shown in Fig. 5B, we were unable to detect Mlh1-Mlh3 endonuclease activity on oligonucleotide substrates such as a linear duplex, a +8 loop insertion, or a model Holliday junction substrate (38; “Experimental Procedures”). One possible explanation for the lack of activity on these substrates is that Mlh1-Mlh3 endonuclease activity requires substrates that mimic characteristics of supercoiled DNA. However, as shown in Fig. 5C, Mlh1-Mlh3 made additional nicks on a nicked DNA substrate to form linear DNA molecules at levels similar to those seen when Mlh1-Mlh3 was initially incubated with supercoiled DNA. This result suggests that other factors (e.g. DNA substrate length) are likely to impact Mlh1-Mlh3 endonuclease activity.

FIGURE 5.

FIGURE 5.

Mlh1-Mlh3 binds preferentially to the +8 loop substrate. A, Mlh1-Mlh3 binding to a 32P-end-labeled 49-bp homoduplex or +8 loop substrate (15 nm, concentration in molecules) was determined in filter binding assays (“Experimental Procedures”). The left panel shows a titration, and the right panel shows binding of 15 nm 32P-end-labeled +8 loop substrate in the presence of 80 nm Mlh1-Mlh3 and 75 nm unlabeled +8 loop or homoduplex substrate. In both panels error bars represent S.D. B, Mlh1-Mlh3 endonuclease activity was not detected on linear, +8 loop, or Holliday Junction substrates. A 12% denaturing gel containing 8 m urea is shown. C, Mlh1-Mlh3 nicks a nicked (n) circular substrate. 200 nm Mlh1-Mlh3 was added as indicated. Lanes 1–4 contain supercoiled (sc) substrate. Lanes 5–8 contain nicked substrate. Linear product is indicated by a black triangle.

DISCUSSION

In this study we showed that the bakers' yeast Mlh1-Mlh3 complex displayed an endonuclease activity. We also provided the first purification protocol for Mlh1-Mlh3, which will be important in mechanistic studies in MMR and meiotic crossover control (outlined below). This activity was dependent on divalent metal but was not stimulated by ATP or RFC + PCNA. Interestingly Mlh1-Mlh3 bound to various oligonucleotide substrates but did not cleave them. Finally, we detected interactions between Mlh1-Mlh3 and Msh2-Msh3 in gel shift assays and showed that Msh2-Msh3 stimulated Mlh1-Mlh3 endonuclease activity.

Genetic studies suggested that Mlh1-Mlh3 intrinsic endonuclease domain is important for resolving dHJs into crossovers, yet the biochemical mechanism remains unknown (25, 26). To our knowledge MLH proteins have not been observed to cleave any type of model substrate constructed from oligonucleotides. However, a large number of MLH proteins that contain an endonuclease domain motif display endonuclease activity on supercoiled and nicked plasmids (4–6), suggesting a DNA binding specificity for MLH proteins that is not seen on small synthetic substrates. Our work shows that Mlh1-Mlh3 can nick both supercoiled and pre-nicked DNA; one way to explain our observations is that Mlh1-Mlh3-mediated endonuclease cleavage requires longer oligonucleotide substrates than those used in our study. MLH proteins have been shown to bind cooperatively to DNA (52); thus longer DNA substrates may be needed to stabilize MLH binding to promote DNA cleavage. Consistent with this idea, we hypothesize that Msh2-Msh3 stimulates Mlh1-Mlh3 endonuclease activity by binding non-specifically to supercoiled DNA or possibly to loops in supercoiled DNA created by the extrusion of inverted repeat sequences (65). In this model Mlh1-Mlh3 is specifically recruited to Msh2-Msh3 that is stably bound to DNA, thus promoting activation of the Mlh1-Mlh3 endonuclease.

Unlike other MLH endonucleases, the Mlh1-Mlh3 endonuclease was not stimulated by ATP or RFC + PCNA. Based on these results we suggest that Mlh1-Mlh3 endonuclease activity on Holliday junctions requires novel and complex interactions with other pro-crossover factors. In support of this idea, Zakharyevich et al. (25) suggested that Msh4-Msh5 interacts with an Exo1-Mlh1-Mlh3 nuclease ensemble to resolve dHJs and that Sgs1 acts as a pro-crossover factor to interact with Mlh1-Mlh3 and ZMM meiotic factors (ZIP, MSH, MER) to stabilize strand exchange intermediates and to coordinate the formation of dHJs (see also 24). They also proposed that the Sgs1 helicase could act in this role by promoting a specific type of dHJ conformation that can be readily cleaved by an endonuclease. Such interactions between Mlh1-Mlh3 and the above factors may be necessary to facilitate large conformational changes within the Mlh1-Mlh3 complex to allow for cleavage of HJs. In support of this idea, Gueneau et al. (9) purified and crystallized the MutLα C-terminal domain. They did not observe an endonuclease activity associated with the C-terminal domain and suggested, as did others (e.g. 8), that conformational rearrangements involving DNA, the N-terminal domain of MutLα, and the linker regions connecting the N- and C-terminal domains and metal cations are required for this activity.

We showed that Msh2-Msh3 stimulates the endonuclease activity of Mlh1-Mlh3. Interactions between MSH and MLH proteins has been characterized in several organisms and have been shown to involve the ATP binding domain of the MLH factor studied (66, 67), thereby reinforcing the idea that the crosstalk between the N- and C-terminal domains of Mlh1-Mlh3 is important to promote resolution of dHJs into crossovers. We have not explored whether post-translational modifications are required to activate Mlh1-Mlh3 during meiotic prophase. Such modifications were detected by Matos et al. (68). They found that the Mus81-Mms4 endonuclease was phosphorylated and hyper-activated by Cdc5 during meiosis. This activation was critical to generate crossing over required for proper chromosome segregation in Meiosis I.

Acknowledgments

We are grateful to Aaron Plys for initiating this project, Petr Cejka and Joe Jiricny for sharing unpublished information and reagents, John Pagano and Manju Hingorani for technical advice, and members of the Alani laboratory for helpful comments.

*

This work was supported, in whole or in part, by National Institutes of Health Grants GM53085 (to M. V. R., C. M., C. C., and E. A.), DG288295 (Natural Science and Engineering Research Council; to A. G.), and GM087549 (to J. S.).

4

J. Jiricny, personal communication.

3
The abbreviations used are:
MMR
mismatch repair
MLH
MutL homolog
(d)HJs
(double) Holliday junctions
β-ME
β-mercaptoethanol
PCNA
proliferating cell nuclear antigen
RFC
replication factor C.

REFERENCES

  • 1. Kunkel T. A., Erie D. A. (2005) DNA mismatch repair. Annu. Rev. Biochem. 74, 681–710 [DOI] [PubMed] [Google Scholar]
  • 2. Hunter N. (2007) Molecular Genetics of Recombination. Topics in Current Genetics 17, 381–442 [Google Scholar]
  • 3. Flores-Rozas H., Kolodner R. D. (1998) The Saccharomyces cerevisiae MLH3 gene functions in MSH3-dependent suppression of frameshift mutations. Proc. Natl. Acad. Sci. U.S.A. 95, 12404–12409 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Guarné A. (2012) The functions of MutL in mismatch repair. The power of multitasking. Prog. Mol. Biol. Transl. Sci. 110, 41–70 [DOI] [PubMed] [Google Scholar]
  • 5. Kadyrov F. A., Dzantiev L., Constantin N., Modrich P. (2006) Endonucleolytic function of MutLα in human mismatch repair. Cell 126, 297–308 [DOI] [PubMed] [Google Scholar]
  • 6. Kadyrov F. A., Holmes S. F., Arana M. E., Lukianova O. A., O'Donnell M., Kunkel T. A., Modrich P. (2007) Saccharomyces cerevisiae MutLα is a mismatch repair endonuclease. J. Biol. Chem. 282, 37181–37190 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Deschênes S. M., Tomer G., Nguyen M., Erdeniz N., Juba N. C., Sepúlveda N., Pisani J. E., Liskay R. M. (2007) The E705K mutation in hPMS2 exerts recessive, not dominant, effects on mismatch repair. Cancer Lett. 249, 148–156 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Pillon M. C., Lorenowicz J. J., Uckelmann M., Klocko A. D., Mitchell R. R., Chung Y. S., Modrich P., Walker G. C., Simmons L. A., Friedhoff P., Guarné A. (2010) Structure of the endonuclease domain of MutL. Unlicensed to cut. Mol. Cell 39, 145–151 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Gueneau E., Dherin C., Legrand P., Tellier-Lebegue C., Gilquin B., Bonnesoeur P., Londino F., Quemener C., Le Du M. H., Márquez J. A., Moutiez M., Gondry M., Boiteux S., Charbonnier J. B. (2013) Structure of the MutLα C-terminal domain reveals how Mlh1 contributes to Pms1 endonuclease site. Nat. Struct. Mol. Biol. 20, 461–468 [DOI] [PubMed] [Google Scholar]
  • 10. Zickler D. (2006) From early homologue recognition to synaptonemal complex formation. Chromosoma 115, 158–174 [DOI] [PubMed] [Google Scholar]
  • 11. Cao L., Alani E., Kleckner N. (1990) A pathway for generation and processing of double strand breaks during meiotic recombination in. S. cerevisiae. Cell 61, 1089–1101 [DOI] [PubMed] [Google Scholar]
  • 12. Keeney S., Giroux C. N., Kleckner N. (1997) Meiosis-specific DNA double-strand breaks are catalyzed by Spo11, a member of a widely conserved protein family. Cell 88, 357–384 [DOI] [PubMed] [Google Scholar]
  • 13. Chen S. Y., Tsubouchi T., Rockmill B., Sandler J. S., Richards D. R., Vader G., Hochwagen A., Roeder G. S., Fung J. C. (2008) Global analysis of the meiotic crossover landscape. Dev. Cell 15, 401–415 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Robine N., Uematsu N., Amiot F., Gidrol X., Barillot E., Nicolas A., Borde V. (2007) Genome-wide redistribution of meiotic double-strand breaks in Saccharomyces cerevisiae. Mol. Cell. Biol. 27, 1868–1880 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Pan J., Sasaki M., Kniewel R., Murakami H., Blitzblau H. G., Tischfield S. E., Zhu X., Neale M. J., Jasin M., Socci N. D., Hochwagen A., Keeney S. (2011) A hierarchical combination of factors shapes the genome-wide topography of yeast meiotic recombination initiation. Cell 144, 719–731 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Schwacha A., Kleckner N. (1995) Identification of double Holliday junctions as intermediates in meiotic recombination. Cell 83, 783–791 [DOI] [PubMed] [Google Scholar]
  • 17. Hunter N., Kleckner N. (2001) The single-end invasion. An asymmetric intermediate at the double-strand break to double-Holliday Junction transition of meiotic recombination. Cell 106, 59–70 [DOI] [PubMed] [Google Scholar]
  • 18. Allers T., Lichten M. (2001) Intermediates of yeast meiotic recombination contain heteroduplex DNA. Mol. Cell 8, 225–231 [DOI] [PubMed] [Google Scholar]
  • 19. Börner G. V., Kleckner N., Hunter N. (2004) Crossover/noncrossover differentiation, synaptonemal complex formation, and regulatory surveillance at the leptotene/zygotene transition of meiosis. Cell 117, 29–45 [DOI] [PubMed] [Google Scholar]
  • 20. Snowden T., Acharya S., Butz C., Berardini M., Fishel R. (2004) hMSH4-hMSH5 recognizes Holliday junctions and forms a meiosis-specific sliding clamp that embraces homologous chromosomes. Mol. Cell 15, 437–451 [DOI] [PubMed] [Google Scholar]
  • 21. Nishant K. T., Chen C., Shinohara M., Shinohara A., Alani E. (2010) Genetic analysis of bakers' yeast Msh4-Msh5 reveals a threshold crossover level for meiotic viability. PLoS Genet. 6, e1001083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Jessop L., Rockmill B., Roeder G. S., Lichten M. (2006) Meiotic chromosome synapsis-promoting proteins antagonize the anti-crossover activity of Sgs1. PLoS Genet. 2, e155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Oh S. D., Lao J. P., Hwang P. Y., Taylor A. F., Smith G. R., Hunter N. (2007) BLM ortholog, Sgs1, prevents aberrant crossing-over by suppressing formation of multichromatid joint molecules. Cell 130, 259–272 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. De Muyt A., Jessop L., Kolar E., Sourirajan A., Chen J., Dayani Y., Lichten M. (2012) BLM helicase ortholog Sgs1 is a central regulator of meiotic recombination intermediate metabolism. Mol. Cell 46, 42–53 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Zakharyevich K., Tang S., Ma Y., Hunter N. (2012) Delineation of joint molecule resolution pathways in meiosis identifies a crossover-specific resolvase. Cell 149, 334–347 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Nishant K. T., Plys A. J., Alani E. (2008) A mutation in the putative MLH3 endonuclease domain confers a defect in both mismatch repair and meiosis in Saccharomyces cerevisiae. Genetics 179, 747–755 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Argueso J. L., Wanat J., Gemici Z., Alani E. (2004) Competing crossover pathways act during meiosis in Saccharomyces cerevisiae. Genetics 168, 1805–1816 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Lipkin S. M., Moens P. B., Wang V., Lenzi M., Shanmugarajah D., Gilgeous A., Thomas J., Cheng J., Touchman J. W., Green E. D., Schwartzberg P., Collins F. S., Cohen P. E. (2002) Meiotic arrest and aneuploidy in MLH3-deficient mice. Nat. Genet. 31, 385–390 [DOI] [PubMed] [Google Scholar]
  • 29. Moens P. B., Kolas N. K., Tarsounas M., Marcon E., Cohen P. E., Spyropoulos B. (2002) The time course and chromosomal localization of recombination-related proteins at meiosis in the mouse are compatible with models that can resolve the early DNA-DNA interactions without reciprocal recombination. J. Cell Sci. 115, 1611–1622 [DOI] [PubMed] [Google Scholar]
  • 30. Kolas N. K., Svetlanov A., Lenzi M. L., Macaluso F. P., Lipkin S. M., Liskay R. M., Greally J., Edelmann W., Cohen P. E. (2005) Localization of MMR proteins on meiotic chromosomes in mice indicates distinct functions during prophase I. J. Cell Biol. 171, 447–458 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Hunter N., Borts R. H. (1997) Mlh1 is unique among mismatch repair proteins in its ability to promote crossing-over during meiosis. Genes Dev. 11, 1573–1582 [DOI] [PubMed] [Google Scholar]
  • 32. Wang T. F., Kleckner N., Hunter N. (1999) Functional specificity of MutL homologs in yeast. Evidence for three Mlh1-based heterocomplexes with distinct roles during meiosis in recombination and mismatch correction. Proc. Natl. Acad. Sci. U.S.A. 96, 13914–13919 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Sonntag Brown M., Lim E., Chen C., Nishant K. T., Alani E. (2013) Genetic analysis of mlh3 mutations reveals interactions between crossover promoting factors during meiosis in bakers' yeast. G3 3, 9–22 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Rose M. D., Winston T., Hieter P. (1990) Methods in Yeast Genetics: A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY [Google Scholar]
  • 35. Wach A., Brachat A., Pöhlmann R., Philippsen P. (1994) New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10, 1793–1808 [DOI] [PubMed] [Google Scholar]
  • 36. Goldstein A. L., McCusker J. H. (1999) Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast 15, 1541–1553 [DOI] [PubMed] [Google Scholar]
  • 37. Surtees J. A., Alani E. (2006) Mismatch repair factor MSH2-MSH3 binds and alters the conformation of branched DNA structures predicted to form during genetic recombination. J. Mol. Biol. 360, 523–536 [DOI] [PubMed] [Google Scholar]
  • 38. Rass U., West S. C. (2006) Synthetic junctions as tools to identify and characterize Holliday junction resolvases. Methods Enzymol. 408, 485–501 [DOI] [PubMed] [Google Scholar]
  • 39. Plys A. J., Rogacheva M. V., Greene E. C., Alani E. (2012) The unstructured linker arms of Mlh1-Pms1 are important for interactions with DNA during mismatch repair. J. Mol. Biol. 422, 192–203 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Ho S. N., Hunt H. D., Horton R. M., Pullen J. K., Pease L. R. (1989) Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 51–59 [DOI] [PubMed] [Google Scholar]
  • 41. Christianson T. W., Sikorski R. S., Dante M., Shero J. H., Hieter P. (1992) Multifunctional yeast high-copy-number shuttle vectors. Gene 110, 119–122 [DOI] [PubMed] [Google Scholar]
  • 42. Gietz R. D., Schiestl R. H., Willems A. R., Woods R. A. (1995) Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11, 355–360 [DOI] [PubMed] [Google Scholar]
  • 43. Tran H. T., Keen J. D., Kricker M., Resnick M. A., Gordenin D. A. (1997) Hypermutability of homonucleotide runs in mismatch repair and DNA polymerase proofreading yeast mutants. Mol. Cell. Biol. 17, 2859–2865 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Heck J. A., Argueso J. L., Gemici Z., Reeves R. G., Bernard A., Aquadro C. F., Alani E. (2006) Negative epistasis between natural variants of the Saccharomyces cerevisiae MLH1 and PMS1 genes results in a defect in mismatch repair. Proc. Natl. Acad. Sci. U.S.A. 103, 3256–3261 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Dixon F. J., Massey W. J. (1969) Introduction to Statistical Analysis, 3rd Ed., McGraw-Hill, New York [Google Scholar]
  • 46. Drake J. W. (1991) A constant rate of spontaneous mutation in DNA-based microbes. Proc. Natl. Acad. Sci. U.S.A. 88, 7160–7164 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Bradford M. M. (1976) A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254 [DOI] [PubMed] [Google Scholar]
  • 48. Kijas A. W., Studamire B., Alani E. (2003) msh2 separation-of-function mutations confer defects in the initiation steps of mismatch repair. J. Mol. Biol. 331, 123–138 [DOI] [PubMed] [Google Scholar]
  • 49. Alani E., Chi N. W., Kolodner R. (1995) The Saccharomyces cerevisiae Msh2 protein specifically binds to duplex oligonucleotides containing mismatched DNA base pairs and insertions. Genes Dev. 9, 234–247 [DOI] [PubMed] [Google Scholar]
  • 50. McEntee K., Weinstock G. M., Lehman I. R. (1980) recA protein-catalyzed strand assimilation. Stimulation by Escherichia coli single-stranded DNA-binding protein. Proc. Natl. Acad. Sci. U.S.A. 77, 857–861 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Chi N. W., Kolodner R. D. (1994) Purification and characterization of MSH1, a yeast mitochondrial protein that binds to DNA mismatches. J. Biol. Chem. 269, 29984–29992 [PubMed] [Google Scholar]
  • 52. Hall M. C., Wang H., Erie D. A., Kunkel T. A. (2001) High affinity cooperative DNA binding by the yeast Mlh1-Pms1 heterodimer. J. Mol. Biol. 312, 637–647 [DOI] [PubMed] [Google Scholar]
  • 53. Kosinski J., Plotz G., Guarné A., Bujnicki J. M., Friedhoff P. (2008) The PMS2 subunit of human MutLα contains a metal ion binding domain of the iron-dependent repressor protein family. J. Mol. Biol. 382, 610–627 [DOI] [PubMed] [Google Scholar]
  • 54. Duppatla V., Bodda C., Urbanke C., Friedhoff P., Rao D. N. (2009) The carboxyl-terminal domain is sofficient for endonuclease activity of Neisseria gonorrhoeae MutL. Biochem. J. 423, 265–277 [DOI] [PubMed] [Google Scholar]
  • 55. Fukui K., Nishida M., Nakagawa N., Masui R., Kuramitsu S. (2008) Bound nucleotide controls the endonuclease activity of mismatch repair enzyme MutL. J. Biol. Chem. 283, 12136–12145 [DOI] [PubMed] [Google Scholar]
  • 56. Mauris J., Evans T. C. (2009) Adenosine triphosphate stimulates Aquifex aeolicus MutL endonuclease activity. PLoS ONE 4, e7175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Ban C., Yang W. (1998) Crystal structure and ATPase activity of MutL. Implications for DNA repair and mutagenesis. Cell 95, 541–552 [DOI] [PubMed] [Google Scholar]
  • 58. Hall M. C., Shcherbakova P. V., Kunkel T. A. (2002) Differential ATP binding and intrinsic ATP hydrolysis by amino-terminal domains of the yeast Mlh1 and Pms1 proteins. J. Biol. Chem. 277, 3673–3679 [DOI] [PubMed] [Google Scholar]
  • 59. Dzantiev L., Constantin N., Genschel J., Iyer R. R., Burgers P. M., Modrich P. (2004) A defined human system that supports bidirectional mismatch-provoked excision. Mol. Cell 15, 31–41 [DOI] [PubMed] [Google Scholar]
  • 60. Pluciennik A., Dzantiev L., Iyer R. R., Constantin N., Kadyrov F. A., Modrich P. (2010) PCNA function in the activation and strand direction of MutLα endonuclease in mismatch repair. Proc. Natl. Acad. Sci. U.S.A. 107, 16066–16071 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Habraken Y., Sung P., Prakash L., Prakash S. (1996) Binding of insertion/deletion DNA mismatches by the heterodimer of yeast mismatch repair proteins MSH2 and MSH3. Curr. Biol. 6, 1185–1187 [DOI] [PubMed] [Google Scholar]
  • 62. Habraken Y., Sung P., Prakash L., Prakash S. (1997) Enhancement of MSH2-MSH3-mediated mismatch recognition by the yeast MLH1-PMS1 complex. Curr. Biol. 7, 790–793 [DOI] [PubMed] [Google Scholar]
  • 63. Habraken Y., Sung P., Prakash L., Prakash S. (1998) ATP-dependent assembly of a ternary complex consisting of a DNA mismatch and the yeast MSH2-MSH6 and MLH1-PMS1 protein complexes. J. Biol. Chem. 273, 9837–9841 [DOI] [PubMed] [Google Scholar]
  • 64. Drotschmann K., Hall M. C., Shcherbakova P. V., Wang H., Erie D. A., Brownewell F. R., Kool E. T., Kunkel T. A. (2002) DNA binding properties of the yeast Msh2-Msh6 and Mlh1-Pms1 heterodimers. Biol. Chem. 383, 969–975 [DOI] [PubMed] [Google Scholar]
  • 65. Giraud-Panis M. J., Lilley D. M. (1997) Near-simultaneous DNA cleavage by the subunits of the junction-resolving enzyme T4 endonuclease VII. EMBO J. 16, 2528–2534 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Mendillo M. L., Hargreaves V. V., Jamison J. W., Mo A. O., Li S., Putnam C. D., Woods V. L., Jr., Kolodner R. D. (2009) A conserved MutS homolog connector domain interface interacts with MutL homologs. Proc. Natl. Acad. Sci. U.S.A. 106, 22223–22228 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67. Lenhart J. S., Pillon M. C., Guarné A., Simmons L. A. (2013) Trapping and visualizing intermediate steps in the mismatch repair pathway in vivo. Mol. Microbiol. 90, 680–698 [DOI] [PubMed] [Google Scholar]
  • 68. Matos J., Blanco M. G., Maslen S., Skehel J. M., West S. C. (2011) Regulatory control of the resolution of DNA recombination intermediates during meiosis and mitosis. Cell 147, 158–172 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Kosinski J., Steindorf I., Bujnicki J. M., Giron-Monzon L., Friedhoff P. (2005) Analysis of the quaternary structure of the MutL C-terminal domain. J. Mol. Biol. 351, 895–909 [DOI] [PubMed] [Google Scholar]
  • 70. Sacho E. J., Kadyrov F. A., Modrich P., Kunkel T. A., Erie D. A. (2008) Direct visualization of asymmetric adenine-nucleotide-induced conformational changes in MutLα. Mol. Cell 29, 112–121 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES