Broad Therapeutic Benefit After RNAi Expression Vector Delivery to Deep Cerebellar Nuclei: Implications for Spinocerebellar Ataxia Type 1 Therapy

Abstract

Spinocerebellar ataxia type 1 (SCA1) is an autosomal dominant, late-onset neurodegenerative disease caused by a polyglutamine (polyQ) expansion in the ataxin-1 protein, which causes progressive neurodegeneration in cerebellar Purkinje cells and brainstem nuclei. Here, we tested if reducing mutant ataxin-1 expression would significantly improve phenotypes in a knock-in (KI) mouse model that recapitulates spatial and temporal aspects of SCA1. Adeno-associated viruses (AAVs), expressing inhibitory RNAs targeting ataxin-1, were injected into the deep cerebellar nuclei (DCN) of KI mice. This approach induced ataxin-1 suppression in the cerebellar cortex and in brainstem neurons. RNA interference (RNAi) of ataxin-1 preserved cerebellar lobule integrity and prevented disease-related transcriptional changes for over a year. Notably, RNAi therapy also preserved rotarod performance and neurohistology. These data suggest that delivery of AAVs encoding RNAi sequences against ataxin-1, to DCN alone, may be sufficient for SCA1 therapy.

Introduction

Spinocerebellar ataxia type 1 (SCA1) is an adult-onset, autosomal dominant neurodegenerative disease caused by a CAG repeat expansion in the ataxin-1 locus. SCA1 is one of nine polyQ expansion gain-of-function diseases, which includes Huntington's disease, spinal-bulbar muscular atrophy, dentatorubral-pallidoluysian atrophy, and other ataxias.¹ Although ubiquitously expressed, polyQ-expanded mutant ataxin-1 causes neurodegeneration selectively in cerebellar Purkinje cells (PCs) and brainstem nuclei.^2,3,4,5 Clinical symptoms of SCA1 include ataxia, dysarthria, ophthalmoparesis, muscle wasting, and extrapyramidal and bulbar dysfunction.^3,4,5 No disease-modifying therapies exist for SCA1.

Previous work using a doxycycline-inducible transgenic mouse model for SCA1 demonstrated that repressing mutant protein production 12 weeks after sustained expression significantly improved many pathologies, including behavior deficits, suggesting that a window of opportunity for gene silencing strategies initiated after disease onset may exist.^6,7 Methods to accomplish gene silencing include RNA interference (RNAi),^8,9,10,11 antisense oligonucleotides,^12,13,14 and inhibitory antibodies.^15,16 RNAi is an evolutionarily conserved process that induces posttranscriptional gene silencing¹⁷ and has been co-opted for therapeutic development to silence pathogenic gene targets, including gain-of-function central nervous system diseases.^18,19 We showed earlier that RNAi triggers released from first-generation short hairpin RNAs¹⁰ or artificial microRNA platforms²⁰ were therapeutic in SCA1 transgenic mice. The transgenic mouse model of SCA1, B05 mice, expresses an expanded human ataxin-1 transgene from a PC-specific promoter. This restricts mutant gene expression to PCs. Because it is likely that other brain regions and cell types may be important in SCA1 pathogenesis, brainstem neurons in particular, it is important to further test these therapeutic modalities in mice that more faithfully reproduce the expression pattern of mutant ataxin-1 in affected individuals.

A knock-in (KI) mouse model of SCA1 was generated earlier by introducing a 154-CAG expansion into exon 8 of the endogenous mouse Atxn1 locus.²¹ Unlike the transgenic SCA1 model, 154Q KI mice express the mutant allele from the endogenous locus.²¹ Thus, there is mutant protein in cortical neurons, CA1 hippocampal neurons, thalamic neurons, as well as neurons in the caudate, putamen, cerebellum, brainstem, and spinal cord.²¹ The KI model also has progressive neurodegeneration of PCs, transcriptional alterations, deficits in gait and coordination.^15,21,22,23 Recent reports have demonstrated the therapeutic utility of SCA1 KI mice for preclinical studies. For example, therapeutic administration of lithium reduced neurodegeneration and partially improved behavioral phenotypes.¹⁵ In other work, SCA1 KI mice were engineered to overexpress ataxin-1-like, a gene with sequence similarity to ataxin-1 but lacking the polyQ tract.²² Ataxin-1-like competed with the dominant effects of mutant ataxin-1 and improved early behavior and histological aspects of disease.

Here, we used the KI model to test the efficacy of targeted delivery of RNAi vectors to deep cerebellar nuclei (DCN) for delivery of ataxin-1–targeting RNAi vectors to PCs and brainstem neurons, to test whether this can alter disease course, even though the mutant ataxin-1 is expressed in multiple locations.

Results

Expression of miSCA1 and reduction of ataxin-1 in vivo

We designed a panel of novel artificial miRNAs harboring small inhibitory RNAs corresponding to human and mouse ataxin-1 sequences^24,25,26 and screened them for gene silencing activity in vitro (data not shown). One candidate was subsequently incorporated into an adeno-associated virus (AAV) vector (serotype 2/5) coexpressing the reporter humanized Renilla reniformis-derived green fluorescent protein ((hrGFP) (AAV.miSCA1; Figure 1a)). To test the effects of ataxin-1 silencing in the SCA1 KI model, 5-week-old 154Q mice were injected with AAV.miSCA1, AAV.miC (control miRNA sequence), or saline into the DCN for retrograde delivery to PCs and brainstem neurons. Six weeks later, tissues were harvested for histology and quantification of knockdown. Extensive PC transduction was evident by robust hrGFP expression from the rostral to caudal lobules of injected cerebella as well as transduction of brainstem neurons (Figure 1b). Throughout the cerebella, PCs and their dendritic arbors were highly transduced (Figure 1c). Expression of miSCA1 was verified using a stem-loop polymerase chain reaction (PCR) approach, previously used to detect endogenous miRNAs^27,28 and showed miSCA1 expression in cerebella and brainstem extracts from mice injected with AAV.miSCA1, but not from AAV.miC-injected mice (Figure 1d). Subsequent in situ hybridization (ISH) analyses indicated that miSCA1 expression localized predominantly to PCs in the cerebellum (Figure 1e) and neurons in the brainstem (Figure 1f). Quantitative PCR (qPCR) analysis for endogenous ataxin-1 messenger RNA (mRNA) levels in RNA harvested from whole cerebellar and brainstem extracts showed ~20% knockdown compared with saline-injected 154Q littermates (Figure 1g). Note that while qPCR was performed on whole cerebellar and brainstem extracts, miSCA1 expression is primarily in PCs and brainstem neurons; background levels of endogenous ataxin-1 in other cell types (which are not targeted by this delivery approach) could obscure the extent of silencing.

Figure 1.

miR candidate and initial validation of expression. (a) Cartoon of recombinant AAV2/5 vector containing cassettes flanked by inverted terminal repeat (ITR) sequences. Murine U6 promoter drives miSCA1 followed by a poly-T termination signal. Cytomegalovirus promoter drives hrGFP ending in a poly-A termination tail. (b) A stitched representative image demonstrating the extent of transduction after deep cerebellar nuclei delivery. hrGFP fluorescence (green) is evident throughout cerebellar lobules and brainstem nuclei. Individual nuclei are labeled: 1, dentate nuclei; 2, anterior interposed nuclei; 3, posterior interposed nuclei; 4, fastigial nuclei; 5, vestibular nuclei; 6, reticular nuclei; 7, subcoeruleus nuclei; 8, periolivary region; 9, pontine nucleus; 10, motor trigeminal nucleus; and 11, pedunculopontine tegmental nucleus. (c) High-powered magnification of transduced Purkinje cells (PCs). (d) miSCA1 expression verified by semi-quantitative polymerase chain reaction (sqPCR). (e) In situ hybridization using a locked nucleic acid probe localized miSCA1 expression to PCs in cerebella injected with AAV.miSCA1. Bar = 100 µm. (f) In situ hydrization as seen in d, above; miSCA1 expression localized to medial, dorsal regions of the pons and medulla. Bar = 50 µm. (g) qPCR analysis 6 weeks postinjection of whole cerebellar or brainstem lysates shows ~20% knock down of mouse ataxin-1 messenger RNA (mRNA). Data are expressed as mean ± SEM. (n = 4; samples assayed in triplicate, *P < 0.05). AAV, adeno-associated virus.

Western blot analysis was done on hrGFP-postive tissue microdissected from cerebella and brainstem. The data show that AAV.miSCA1-injected 154Qmice had significantly lower levels of Atxn1 expression compared with 154Q littermates injected with AAV.miC (58 and 72%, respectively; P < 0.05 by t-test) (Figure 2a,b).

Figure 2.

AAV.miSCA1 reduces Atxn1 levels in 154Q mice. (a) Microdissected hrGFP-positive cerebellar lysates or (b) microdissected hrGFP-positive brainstem lysates from 154Q mice injected with AAV.miC or AAV.miSCA1 were quantified by western blot using an anti-phosphorylated Atxn1 antibody. Anti-β-actin antibodies were used as an internal control. Data are expressed as mean ± SEM. (n = 3; *P < 0.05, **P < 0.01).

Inhibitory RNAs can cause toxicity in brain,²⁹ so we next evaluated the tolerability of our sequences by staining for Iba1, a marker of glial activation. There was no overt neurotoxicity in animals injected with AAV.miSCA1 compared with saline-injected 154Q littermates in the cerebellar cortex or at the site of injection (Supplementary Figure S1).

AAV.miSCA1 delivery to DCN rescues gait and coordination of the KI model

To test long-term effects of our therapeutic construct, we injected additional cohorts of animals at 5 weeks of age, before motor phenotypes are discernible between 154Q mutant and wild-type (WT) mice. Gait analysis and accelerated rotarod assays were performed at 30 and 40 weeks of age on uninjected WT littermates and 154Q mice injected bilaterally with AAV.miSCA1, AAV.miC, or saline to the DCN. Quantification of gait abnormalities in this model had not been previously documented. WT mice exhibited longer strides and wider stances at both time points compared with all other treatment groups. Saline or control-treated 154Q littermates had gait abnormalities as evidenced by significantly shorter stride lengths and a narrower hindlimb gait relative to WT littermates at both time points tested (P < 0.0001; Figure 3a–d). 154Q mice treated with AAV.miSCA1, however, had strides 0.8 cm longer than control-treated diseased mice, and this trend continued when assayed at 40 weeks of age (P < 0.0001; Figure 3a,b). Moreover, AAV.miSCA1-treated mice had hindlimb stances significantly wider than control-treated diseased littermates (Figure 3c,d).

Figure 3.

AAV.miSCA1 improves behavioral deficits in 154Q mice. Gait analysis and rotarod were performed on mice at 30 and 40 weeks of age. Uninjected wild-type (WT) mice, n = 15; saline-injected 154Q, n = 11; AAV.miC-injected 154Q, n = 11; and AAV.miSCA1-injected 154Q, n = 15. (a,b) Box plots display average stride lengths at (a) 30 and (b) 40 weeks of age. Measurements from 16 to 20 steps per mouse were averaged for all four paws. AAV.miSCA1-treated mice have significantly longer strides than control-treated 154Q littermates (***P < 0.0001). (c,d) Box plots display average hindlimb stance width at (c) 30 and (d) 40 weeks of age. AAV.miSCA1-treated mice have significantly wider stances than control-treated 154Q littermates (***P < 0.0001). (e) Rotarod analysis was performed at 30 and 40 weeks of age. The performance of AAV.miSCA1-treated 154Q mice was equivalent to WT littermates. On day 4 at each age, AAV.miSCA1-treated 154Q mice stay on the rotarod over 1 minute longer than control-treated 154Q littermates. Results are shown as mean ± SEM (*P < 0.05).

Prior work describing the generation of the KI model showed deficits on the accelerated rotarod by 5 weeks of age.²¹ Although we did not find rotarod differences at this early time point, a disparity between diseased and normal littermates was robust by 30 weeks of age. As such, we assessed miSCA1-, miC-, and saline-injected 154Q mice at 30 and 40 weeks and compared them with WT age-matched littermates. At both the 30- and 40-week time points, 154Q mice injected with AAV.miSCA1 performed similarly to WT littermates, whereas control-treated 154Q littermates performed significantly worse (P < 0.05; Figure 3e).

AAV.miSCA1 protects against molecular layer thinning

The cerebellar molecular layer has rich PC dendritic arborization. In SCA1 KI mice, progressive reduction in molecular layer width is a notable pathology.^21,22 To evaluate how long-term ataxin-1 silencing may affect the phenotypic thinning of the molecular layer throughout disease progression, tissues were harvested 60 weeks posttreatment. Sagittal sections with evident miSCA1 expression (verified by ISH; data not shown) were compared between AAV.miSCA1- and control-treated diseased tissues and those from WT littermates. One caudal location and two rostral locations from medial sagittal sections for all groups were measured (Figure 4a). The data show that 154Q mice treated with AAV.miC or saline had significantly reduced molecular layer widths compared with WT littermates at all locations (P < 0.0001), whereas AAV.miSCA1 significantly improved this disease phenotype (Figure 4b–d). In rostral sections, AAV.miSCA1-treated mice retained molecular layer widths equivalent to their WT littermates (Figure 4c,d).

Figure 4.

AAV.miSCA1 rescues molecular width layer thinning. (a) 40-µm thick sagittal cerebellar section stained with α-calbindin (red) identifies the locations of sections that were analyzed. Bar = 500 µm. (b) Molecular layers between caudal lobules VIII and IX. 154Q mice treated with AAV.miSCA1 had significantly wider molecular layers than control-treated 154Q littermates. Wild-type (WT) littermates had significantly wider molecular layers than all other treatment groups at this position. Results are shown as mean ± SEM (n ≥ 3; *P < 0.05, ***P < 0.0001). (c) Molecular layers between rostral lobules IV/V and VI. 154Q mice treated with AAV.miSCA1 had molecular layer widths equivalent to WT littermates. Both groups had significantly wider molecular layers than control-treated 154Q littermates. Results are shown as mean ± SEM (n ≥ 3; ***P < 0.0001). (d) Molecular layers between rostral lobules III and IV/V. 154Q mice treated with AAV.miSCA1 had molecular layer widths equivalent to WT littermates. Both groups had significantly wider molecular layers than control-treated 154Q littermates. Results are shown as mean ± SEM (n ≥ 3; ***P < 0.0001).

Restoration of transcriptional abnormalities in miSCA1-treated SCA1 KI mice

Whole cerebellar and brainstem RNA extracts were used to assess ataxin-1 levels and disease-related transcriptional changes in several genes previously identified to be altered in patients and SCA1 mouse models. These encode the proteins mGluR1,⁶ mGluR4,²³ and vascular endothelial growth factor-Vegf.¹³ Sixty weeks after treatment, AAV.miSCA1-treated mice had ~30% lower levels of ataxin-1 relative to those injected with saline (P < 0.0001; Figure 5a).

Figure 5.

AAV.miSCA1 improves cerebellar health. Quantitative polymerase chain reaction (qPCR) analysis of messenger RNA (mRNA) from whole cerebellar extracts at 65 weeks of age. Results are relative to saline-injected 154Q littermates and displayed as mean ± SEM (n = 4; samples were run in triplicate; *P < 0.05, **P < 0.001, ***P < 0.0001). (a) Relative levels of ataxin-1 mRNA. AAV.miSCA1-treated 154Q mice have ~30% reduction of ataxin-1 compared with saline-treated 154Q littermates 60 weeks posttreatment. (b) Relative levels of mGluR1 mRNA. AAV.miSCA1-treated 154Q mice maintain mGluR1 mRNA levels equivalent to wild-type (WT) littermates. AAV.miSCA1-treated mice have ~2× the amount of mGluR1 mRNA than saline-treated littermates. (c) Relative levels of mGluR4 mRNA. AAV.miSCA1-treated 154Q mice have significantly higher mRNA levels of mGluR4 than control-treated 154Q littermates. WT littermates have significantly higher mRNA levels of mGluR4 than all 154Q treated littermates. (d) Relative levels of Vegfa mRNA. AAV.miSCA1-treated 154Q mice maintain Vegfa mRNA levels equivalent to WT littermates, and both are significantly higher than control-treated 154Q littermates.

The metabotropic glutamate receptors mGluR1 and mGluR4, which are in the postsynaptic PC dendrites or the presynaptic granule cell parallel fibers respectively and critical for coordinated motor function,³⁰ are reduced in KI mice. AAV.miSCA1 significantly improved mGluR1 and mGluR4 mRNA levels (P < 0.0001; Figure 5b,c). Vegfa is an angiogenic and trophic factor expressed widely in cerebellar neurons, glia, and endothelial cells. In SCA1 mice, Vegfa mRNA levels decrease prior to disease onset.^16,31 Similar to transcripts encoding mGluR1 and 4, AAV.miSCA1 treatment significantly reversed Vegfa mRNA to near WT levels (P < 0.0001; Figure 5d).

Discussion

Phenotypic improvements in the KI mouse model of SCA1 can result from increasing expression of proteins competing with ataxin-1, such as ataxin-1-like, or inducing haploinsufficiency of 14-3-3ε, which contributes to mutant ataxin-1–mediated pathology.^22,32 Exogenous administration of lithium also provides therapeutic benefit to KI mice.¹⁵ Most recently, we demonstrated the therapeutic potential of artificial miRNA platforms in the transgenic B05 mouse model.²⁰ Notably, these therapies target all cells that may be affected by disease,^21,23,32 because only the PCs express the transgene. The long-term benefits of any of these interventions, however, have not been tested. As SCA1 is a chronic neurodegenerative disease, a critical question is the durability of the improvement, as well as the extent of protection and recovery. Another important consideration is whether all ataxin-1–expressing cells should be targeted for therapeutic benefit, or alternatively, directed delivery to key affected sites may suffice. In this work, upon directed delivery of AAVs to the DCN, we observed miSCA1 expression in two locations affected by the disease: the cerebellum and brainstem, with significant behavioral and neuropathological improvements that lasted many months.

Rotarod deficits in KI mutant mice can show onset by 5–7 weeks of age and abnormal cage behavior by 20 weeks of age^15,21 This early motor phenotype is not evident in our and others' colonies, however (Orr, H, personal communication). Remarkably, ataxin-1 silencing with miSCA1 preserved rotarod performance to that of normal mice, a therapeutic effect not previously demonstrated with small molecule therapies.^15,33 We also quantified gait in this model and found significantly reduced stride length and hindlimb stance width by 30 weeks of age; these gait abnormalities were improved by miSCA1 therapy.

Ataxin-1 protein interacts with several transcriptional regulators, including capicua (CIC), silencing mediator of retinoid and thyroid hormone receptor-related ecdyson receptor-interacting factor (SMRTER), histone deacetylase 3 (HDAC3), growth factor independent 1 (Gfi1), and retinoic acid-related orphan nuclear receptor α–TAT-interacting protein 60 (RORα–Tip60).^13,14,34 Polyglutamine expansion in ataxin-1 alters the balance of these interactions inducing transcriptional changes that can appear early in SCA1 and persist throughout disease.^15,23,35 One target under RORα regulation is mGluR1,¹³ a postsynaptic receptor localized to PC dendritic spines.³⁶ mGluR1 receives excitatory synaptic input from parallel fibers and is essential for PC-parallel fiber synapses and maintenance of motor coordination.^37,38 Indeed, mGluR1 levels directly correlate with rotarod performance in a conditional SCA1 transgenic model⁶; as PC dendrites retract with disease progression, mGluR1 receptors are downregulated.

The autoreceptor mGluR4, known to play a significant role in motor performance,²³ is localized presynaptically on parallel fiber axons and is reduced in 154Q mice.²³ A downstream target of capicua, mGluR4, functions in a negative feedback loop to modulate signal transduction between PCs and parallel fibers.³⁰ Mice lacking mGluR4 exhibit reduced cerebellar plasticity and impaired rotarod performance.³⁹ The coincident restoration of mGluR1 and mGluR4 expression levels and the retention of molecular layer widths with AAV.miSCA1 treatment suggest that synaptic parallel fiber axons may recover or be protected by decreased polyQ-expanded ataxin-1 levels. This implies that while parallel fibers were not our direct target, relative improvement of PCs impacted positively other cerebellar cell types.

Transcriptional changes in SCA1 occur prior to behavioral symptoms.^16,23,35,40 Notably, Vegfa mRNA and protein levels are reduced before behavioral symptoms present in 154Q and B05 transgenic mice.^16,31 Vegf is an angiogenic trophic factor, and its levels are reduced in several neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS), spinal muscular bulbar atrophy (SMBA) and SCA1.^40,41,42,43 Here, miSCA1 delivery before disease onset but after downregulation of Vegfa restored this transcript to WT levels. The significant increase of Vegfa mRNA levels in miSCA1-treated 154Q mice is similar to our earlier work in the transgenic model of SCA1.¹⁶ In those experiments, reduction of the mutant allele, which is expressed solely in PCs, also rescued cerebellar Vegfa levels.

When injected to the DCN, AAV.miSCA1 transduced the majority of PCs and neuronal populations in the brainstem. The extent of transduction and subsequent reduction of ataxin-1 fully rescued the rotarod deficit, improved gait abnormalities, preserved molecular layer widths, and maintained transcriptional profiles of genes known to be reduced in SCA1. The DCN receives projections from cerebellar PCs, the inferior olive, lateral reticular nuclei, and pontine nuclei.⁴⁴ Therefore, it is not unexpected that AAV.miSCA1 is transported in retrograde fashion to PCs and multiple brainstem nuclei, including the vestibular, reticular, and pontine nuclei, and the olivary region (Figure 1b). We fully rescued the rotarod deficit, improved gait abnormalities, preserved molecular layer widths, and maintained normal transcriptional levels of genes known to be reduced in SCA1. These data suggest that transduction of other cerebellar or cerebral neurons may not be required for improving disease in SCA1 patients. These observations raise the question as to the extent of cerebellum and brainstem to target for maximal benefit as we move from mice models to patients. Some guidance to this query is inferred from lesion studies, which established that the cerebellar midline and its fastigial nuclear projections are responsible for postural coordination; damage causes gait ataxia.⁴⁵ Immediately lateral to the fastigial nucleus in the DCN are the interposed nuclei, which are also important for motor execution. Motor planning, however, requires the more lateral dentate nucleus. Thus, focusing delivery to the medial and medio-lateral DCN with subsequent transport to brainstem nuclei and PCs may provide maximal therapeutic benefits for SCA1.

Materials and Methods

Plasmids and viral vectors. The plasmid expressing mouse U6-driven artificial miRNA, miSCA1 (5′- UGAUUGCUUGCUGCUGGCCGA -3′), was cloned as previously described.⁴⁶ Artificial miRNA expression cassettes were cloned into pAAVmcsCMVhrGFP plasmids, which coexpressed cytomegalovirus-driven hrGFP.⁴⁷ Recombinant AAV serotype 2/5 vectors (AAV.miC and AAV.miSCA1) were generated by the University of Iowa Vector Core facility as previously described.⁴⁸ AAV vectors were resuspended in buffer, and titers (viral genomes/ml) were determined by qPCR.

Animals. All animal protocols were approved by the University of Iowa Animal Care and Use Committee. WT C57Bl/6J mice were obtained from Jackson Laboratories (Bar Harbor, ME). Sca1^154Q/+ (154Q) mice were maintained on the C57Bl/6 background. Mice were genotyped using primers specific for the mutant mouse ataxin-1,²¹ and disease- and age-matched WT littermates were used for the indicated experiments. Treatment groups comprised approximately equal numbers of male and female mice. Mice were housed in a controlled temperature environment on a 12-hour light/dark cycle. Food and water were provided ad libitum.

AAV injections and brain tissue isolation. 154Q mice were injected with AAV vectors as previously reported,²⁹ except that for this work, mice were injected bilaterally into the DCN (coordinates −6.0 mm caudal to bregma, ±2.0 mm from midline, and −2.2-mm deep from cerebellar surface) with 4 μl of AAV5 (at 1 × 10¹² viral genomes/ml) or saline. Mice were anesthetized with a ketamine/xylazine mix and transcardially perfused with 20 ml of 0.9% cold saline. Mice were decapitated, and for histological analyses, brains were removed and postfixed overnight in 4% paraformaldehyde. Brains were stored in a 30% sucrose/0.05% azide solution at 4 °C until cut on a sliding knife microtome at 40 µm thickness and stored at −20 °C in a cryoprotectant solution. For ISH, brains were put in optimal cutting temperature compound (Sakura Finetek USA, Torrance, CA) and frozen in a slurry of dry ice and 70% ethanol, then kept at −80 °C until cut on a cryostat at 10 µm thickness and stored at −80 °C. For qPCR analyses, brains were removed and sectioned into 1-mm thick coronal slices using a brain matrix (Roboz, Gaithersburg, MD), and hrGFP expression was verified. For RNA, the whole cerebellum was triturated in 100 µl of TRIzol (Life Technologies, Grand Island, NY) and flash frozen in liquid nitrogen and stored at −80 °C until used. RNA was isolated from whole cerebellum using 1 ml of TRIzol. RNA quantity and quality was measured using a NanoDrop® ND-1000 (Nanodrop, Wilmington, DE).

Immunohistochemical analyses. Free-floating sagittal cerebellar sections (40-µm thick) were washed in phosphate-buffered saline at room temperature and blocked for 1 hour in 10% serum and 0.03% Triton-100 in phosphate-buffered saline. Sections were incubated with primary antibody in 2% serum and 0.03% Triton-X in phosphate-buffered saline overnight at 4 °C. Primary antibodies used were polyclonal anti-Iba1 (1:1,000; WAKO, Richmond, VA) and polyclonal rabbit anti-Calbindin (1:2,000; Cell Signaling Technology, Danvers, MA). For fluorescent immunohistochemistry, sections were incubated with goat anti-rabbit Alexa Fluor 568 (1:1,000; Life Technologies) in 2% serum and 0.03% Triton-100 in phosphate-buffered saline for 1 hour at room temperature. For DAB (3,3-diaminobenzidine) immunohistochemistry, sections were incubated in goat anti-rabbit biotin-labeled secondary antibody (1:200; Jackson Immunoresearch, West Grove, PA) in 2% serum and 0.03% Triton-X at room temperature for 1 hour. Tissues were developed with VECTASTAIN ABC Elite Kit (Vector Laboratories, Burlingame, CA), according to the manufacturer's instructions. All sections were mounted onto Superfrost Plus slides (Fischer Scientific, Pittsburgh, PA) and cover slipped with Fluoro-Gel (Electron Microscopy Sciences, Hatfield, PA). Images were captured on Leica Leitz Digital Modul R fluorescent microscope (Leica Microsystems, Buffalo Grove, IL) connected to a Olympus DP72 camera (Olympus, Melville, NY) using the Olympus DP2-BSW software (Olympus).

In situ hybridization. A locked nucleic acid probe (Integrative DNA Technologies, Coralville, IA) was used to visually localize miSCA1 by ISH, the probe was designed to the reverse complement of the targeted miSCA1 mRNA (5′ TC+GGC+CAG+CAG+CAA+GCA+ATCA; + denotes locked nucleic acid modification). The probe was labeled with 3′-end a digoxigenin oligonucleotide tailing kit (Roche, Indianapolis, IN) according to the manufacturer's directions. AAV.miSCA1 injected samples were verified for expression by hrGFP fluorescence before treatment. Sections were treated by ISH methods as previously described.⁴⁹

Semi-qPCR. Reverse transcription (High Capacity cDNA Reverse Transcription Kit; Applied Biosystems, Foster City, CA) was performed on total RNA collected from cerebellum using a standard stem-loop PCR primer²⁷ designed to identify miSCA1 (5′ GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCCAG). Complementary DNA was subjected to reverse transcriptase–PCR with a standard reverse primer (5′ GTGCAGGGTCCGAGGT) and a forward primer (5′ CACAGATGGGTGATTGCTTGCTGC) to identify miSCA1 expression compared with cerebella injected with miControl.

qPCR analysis. Random-primer first-strand complementary DNA synthesis was performed using 1 µg of total RNA (High Capacity cDNA Reverse Transcription Kit; Life Technologies) per manufacturer's instructions. Assays were performed on a sequence detection system using primers/probe sets specific for mouse ataxin-1, mouse Calbindin, mouse mGluR1, mouse mGluR4, mouse Vegfa, or mouse β-Actin (ABI Prism 7900 HT and TaqMan 2× Universal Master Mix; Life Technologies).

Western blot analysis. Protein was harvested using radioimmunoprecipitation assay (RIPA) buffer (Pierce, ThermoScientific, Pierce, Rockford, IL) and 1× protease inhibitor using standard techniques and quantified using D_C Protein Assay (BioRad Laboratories, Hercules, CA). Protein extracts were separated on a 4–12% Bis-Tris Gel with 2-(N-morpholino)ethanesulfonic acid (Invitrogen, Carlsbad, CA) and transferred to Immobilon 0.45-µm polyvinylidenefluoride transfer membranes (Millipore, Bedford, MA). Primary antibodies to phosphorylated-ATXN1 (1-6.3.5) (1:2,500; gift from H. Orr.) and β-Actin (1:10,000; A5441; Sigma, St Louis, MO) were used. Blots were developed using electrochemiluminescence Prime Western Blotting Detection System (GE Healthcare, Buckinghamshire, UK) and quantified by VersaDoc 5000 MP (BioRad Laboratories).

Behavioral analysis. All assays were done at 30 and 40 weeks of age and are presented as means ± SEM, unless otherwise specified. The mice categories are as follows ininjected WT mice, n = 15; saline-injected 154Q, n = 11; AAV.miC-injected 154Q, n = 11; and AAV.miSCA1-injected 154Q, n = 15.

Gait analysis. Mice were allowed to walk across a paper lined chamber (100 × 10 cm with 10-cm walls) and into an enclosed recess. Mice were given one practice run. Nontoxic red and blue paint was applied to their fore- and hindpaws, respectively. Mice were then tested three times to produce three separate footprint tracings. Stride lengths were measured from the middle of each paw print between the same paws for steps taken during their gait. Steps were discarded in instances where a mouse stopped walking or turned around. Measurements from 16 to 20 steps per mouse were averaged for all four paws and data were graphed using GraphPad Prism®5 (GraphPad, La Jolla, CA).

Rotarod performance. Mice were tested on an accelerated rotarod apparatus (model 47600; Ugo Basile, Comerio, Italy) at 4, 30, and 40 weeks of age. Baseline testing was conducted at 4 weeks of age to separate 154Q mice equally into treatment groups (data not shown). No difference between 154Q and WT mice was seen at 4 weeks of age. Mice were first habituated on the rotarod for 4 minutes. Mice were then tested for three trials per day (with at least 30 minutes of rest between trials) for 4 consecutive days. For each trial, acceleration was from 4 to 40 rpm over 5 minutes, and then the speed was maintained at 40 rpm. Latency to fall (or if mice hung on for two consecutive rotations without running) was recorded for each mouse per trial. The trials were stopped at 500 seconds.

Statistical analyses. For all studies, unless indicated otherwise, statistical values were analyzed using one-way analysis of variance and Bonferroni correction for multiple comparisons. Rotarod data were analyzed using two-way analysis of variance and Bonferroni correction for multiple comparisons. Student's t-test was used for the pair-wise comparisons done for the baseline 4-week rotarod performance assay. Results are expressed as the means ± SEM, except the gait analysis results, which are displayed as box-and-whisker plots. In all statistical analysis, P < 0.05 was considered statistically significant. All photographs were formatted with Adobe Photoshop software (Adobe Web Premium, CS4, San Jose, CA), all graphs were made wish GraphPad Prism®5 software, and all figures were constructed with Adobe Illustrator software (Adobe Web Premium).

SUPPLEMENTARY MATERIAL Figure S1. AAV.miSCA1 treatment does not cause an adverse immune response in vivo shown by immunohistological stain for glial activation marker Iba1.