Microarray Analysis Identifies Changes in Inflammatory Gene Expression in Response to Amyloid-β Stimulation of Cultured Human Retinal Pigment Epithelial Cells

Abstract

Purpose

Age-related macular degeneration (AMD) is a common cause of irreversible vision loss in the elderly. The hypothesis was that in vitro stimulation of RPE cells with Aβ_1-40, a constituent of drusen, promotes changes in gene expression and cellular pathways associated with the pathogenesis of AMD, including oxidative stress, inflammation, and angiogenesis.

Methods

Confluent human RPE cells were stimulated with Aβ_1-40, or the reverse peptide Aβ_40-1, and genome wide changes in gene expression were studied with gene microarrays. Selected genes were verified by qRT-PCR and ELISA. Pathway analysis with gene set enrichment analysis (GSEA) and ingenuity revealed top functional pathways in RPE after Aβ_1-40 stimulation.

Results

RPE cells stimulated with Aβ_1-40 (0.3 μM) for 24 hours resulted in 63 upregulated and 22 downregulated previously known genes. The upregulated genes were predominantly in inflammatory and immune response categories, but other categories were also represented, including apoptosis, cell signaling, cell proliferation, and signal transduction. Categories of downregulated genes included immune response, transporters, metabolic functions and transcription factors. ELISA confirmed that secreted levels of IL-8 were two times higher than control levels. GSEA and ingenuity analysis confirmed that the top affected pathways in RPE cells after Aβ_1-40 stimulation were inflammation and immune response related. Surprisingly, few angiogenic pathways were activated at the doses and exposure times studied.

Conclusions

Aβ_1-40 promotes RPE gene expression changes in pathways associated with immune response, inflammation, and cytokine and interferon signaling pathways. Results may relate to in vivo mechanisms associated with the pathogenesis of AMD.

Age-related macular degeneration (AMD) is the most common cause of irreversible vision loss in the elderly. The disease is characterized by extracellular deposits known as drusen, which are found between the basal lamina of the retinal pigment epithelium (RPE) and the inner layer of Bruch’s membrane (BM). Although, the presence of drusen correlates with the development of AMD, the specific mechanisms underlying the biogenesis of drusen and its relationship to the disease remain elusive.^1–3 Extensive biochemical analysis of drusen revealed the presence of several proteins linked to inflammation. Such proteins include immunoglobulins, acute-phase molecules (vitronectin, amyloid P, and fibrinogen), complement factors (C5 and C5b-9), and complement regulatory molecules (clusterin and complement receptor 1).^4–8 These findings implicate an inflammatory process associated with drusen, but what activates or triggers the inflammation remains unknown.^4,9–12

Several lines of evidence suggest that amyloid-β_1-40 (Aβ_1-40), a known constituent of drusen, is a potential candidate trigger peptide.^3,13–15 Genetically modified mice with increased Aβ deposition display many traits consistent with human AMD, such as the accumulation of sub-RPE deposits, microglial activation, and degeneration of the retinal neurons and RPE.^16,17 In the retina, cell types including neurons, RPE, and glia may provide a local source of Aβ species; they have been shown to have the cellular machinery for the synthesis of amyloid precursor protein (APP) and cleavage enzymes.¹⁰ Sequential APP processing by β- and γ-secretase produces the major Aβ species, Aβ_1-40. Recent in vitro studies in which RPE cells are stimulated with Aβ_1-40 demonstrated several results that are consistent with a proinflammatory response. Wang et al.¹⁸ reported that Aβ_1-40 stimulation caused abnormal activity of complement factor I (CFI), an inhibitory regulator of the complement cascade. In another study, stimulation of RPE cells with Aβ_1-40 modulated the expression of vascular endothelial growth factor (VEGF), which is known to promote angiogenesis, a late-stage feature of AMD.¹⁷ These results prompted us to further elucidate the effects of Aβ_1-40 stimulation on RPE cells in vitro by differential microarrays and corresponding functional pathway analysis. We hypothesize that Aβ_1-40 stimulation of RPE cells in vitro promotes gene expression changes associated with cellular pathways implicated in the pathogenesis of AMD, including oxidative stress, inflammation, angiogenesis, and apoptosis.

Methods

Aβ_1-40 Oligomerization

We chose to focus on the effects of the oligomeric form of Aβ_1-40 because, unlike Aβ_1-42 (the more toxic form associated with Alzheimer’s plaques), Aβ_1-40 was identified in drusen sites.³ Also, a recent study¹⁹ using an RPE cell line compared oligomeric Aβ_1-40 with Aβ_1-42 and demonstrated that their effects on RPE function were comparable, confirming original reports by Kayed et al.²⁰ that Aβ_1-40 and Aβ_1-42 have similar toxic effects on several cell types tested.

Aβ_1-40 peptide and the control reverse peptide Aβ_40-1 were purchased from American Peptide (Sunnyvale, CA) as a salt-free, lyophilized powder. The protocol used to synthesize Aβ oligomers was obtained from Invitrogen Canada (Burlington, ON, Canada). Briefly, lyophilized Aβ_1-40 (or the reverse peptide Aβ_40-1) was dissolved in 200 μL hexafluoroisopropanol (HFIP) and sonicated for 30 seconds. The HFIP solution was then transferred by a 22-gauge syringe to a new 1.4-mL tube (Eppendorf, Fremont, CA) containing 700 μL of distilled water. A Teflon-coated micromagnetic stirring bar was added, and the tube was closed with a perforated cap to allow HFIP to vent after evaporation. The tube was placed in a holder inside a fume hood on top of a stirring plate, and stirred with a Teflon-coated micro stir bar at 300 rpm for 24 to 48 hours. Aliquots of the supernatant were analyzed for confirmation of Aβ oligomers using atomic force microscopy (AFM) and dot blot assay.

Atomic Force Microscopy

AFM was performed as previously described.^21,22 Briefly, Aβ_1-40 samples were prepared for AFM examination by placing 10 μL of solution onto freshly cleaved mica (Ted Pella, Inc., Redding, CA). The sample was allowed to adhere to the mica surface for 10 minutes at room temperature and was subsequently washed with double-distilled water to eliminate contamination due to buffer and salts and to help reduce background contrast. AFM images were captured with a microscope (BioScope with the Nanoscope IIIa Controller and a G-type scanner; Digital Instruments, Santa Barbara, CA). The contact mode was used for all images with DNP silicon nitride cantilevers (Digital Instruments). A minimum of four random regions of the mica surface was examined to ensure that similar structures existed throughout the sample.

Dot Blot Assay

A dot blot assay was performed to determine the oligomeric form Aβ_1-40. Approximately 3 μL of Aβ_1-40 solution was spotted onto a nitrocellulose membrane and allowed to dry. The membrane was then blocked with 10% nonfat dry milk in Tris-buffered saline (TBS) containing 0.01% Tween 20 (TBST) solution overnight at 4°C, and washed three times in full-strength TBST for 5 minutes before being incubated for 1 hour at room temperature with the A11 anti-oligomer antibody using the manufacturer’s protocol (Invitrogen Corp., Carlsbad, CA). The membrane was then washed three times in TBST for 5 minutes and incubated for 1 hour at room temperature with a standard horseradish peroxidase–conjugated secondary antibody made in goat against rabbit IgG diluted at 1:2000 (Promega, Madison, WI). The blots were finally washed three times in TBST for 5 minutes and developed for 20 minutes in a solution of tetramethylbenzidine (TMB; Promega).

Cell Culture of Human RPE Cells

Human fetal RPE cells were used in all the experiments. Human RPE cells were isolated from fetal donor eye tissues, as described elsewhere.^23,24 Methods for securing human tissue were humane and included proper written informed consent, which complied with the Declaration of Helsinki. Human fetal donor eyes had no known disease and were used under the guidelines and regulation of the IRB at the University of British Columbia, Vancouver, Canada. The eyes were cut circumferentially, the vitreous removed, and the neuroretina gently detached from the RPE cell layer. The choroid/RPE layer was placed in 2% Dispase (Invitrogen) in Hanks’ balanced salt solution (HBSS; Invitrogen) for 25 minutes at 37°C. The RPE layer was then removed in fragments and passed through 70- and 40-μm nylon mesh filters (Falcon Plastics, Oxnard, CA). Only the fragments that were left behind were retained. After centrifugation at 1500 rpm for 5 minutes, the fragments were gently dissociated and seeded on to laminin-coated six-well plates (Falcon Plastics). RPE cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen-Gibco, Grand Island, NY) containing 10% fetal bovine serum (FBS; Invitrogen-Gibco), 100 μg/mL penicillin (Sigma-Aldrich, St. Louis, MO), 100 μg/mL streptomycin (Sigma-Aldrich), and 2 mM L-glutamine (Invitrogen) at 37°C in a humidified atmosphere of 95% air and 5% CO₂. At confluence, the cells were detached with 0.05% trypsin/0.02% EDTA (Invitrogen), collected by centrifugation, and expanded. In the following experiments, passage 5 cells were used, and RPE cells from the same donor were used in an individual experiment.

Cell Viability Assay

RPE cells (20 × 10³ cells/well) were seeded in 200 μL medium on a 96-well culture plate and incubated with DMEM containing 10% FBS, for 24 hours. The medium was then discarded, and the cells were washed three times with phosphate-buffered saline (PBS). The MTT reduction assay was used as an index of cell viability. Briefly, the oligomeric form of Aβ_1-40 (0.01, 0.3, 1.0, 5.0, and 10.0 μM) and the control, reverse peptide, Aβ_40-1 (0.3 μM) were used to stimulate RPE cells for various lengths of time (3, 6, 12, or 24 hours). After stimulation, the media were aspirated and the RPE cells were subsequently incubated in serum-free medium containing 0.4 mg/mL MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] for 4 hours. Mitochondrial and cytosolic dehydrogenases of living cells reduced the yellow tetrazolium salt (MTT) to a purple formosan dye that was then detected by spectrophotometry. After 4 hours, the MTT solution was aspirated, and 150 μL of dimethylsulfoxide (DMSO) was added for a period of 20 minutes. Optical densities of the supernatant were read at 550 nm with a microplate spectrophotometer (Bio-Tek Instruments, Inc., Winooski, VT). Absorbances were normalized to those of the untreated control cultures, which were also incubated in serum-free medium, which represented 100% viability. Two independent experiments in quadruplicate were performed in this study. The mean ± SD of the data was analyzed.

Aβ Stimulation

RPE cells (0.3 × 10⁶/well) were seeded in 2 mL of culture medium in a six-well plate for 4 days. Before stimulation, the cells were washed three times with PBS. The RPE cells were then treated with Aβ_1-40 (the oligomeric form) or Aβ_40-1 (the reverse peptide) at a concentration of 0.3 μM for 3, 6, 12, or 24 hours in 1 mL of serum-free DMEM. Untreated RPE cells containing only serum-free DMEM were used as the negative control. As the chemical constituents of serum often vary, serum-free DMEM was used in all stimulation studies to ensure a controlled experimental design.

Microarray and Data Analysis

The total cellular RNA was isolated from cultured human RPE cells according to manufacturer’s recommendations (TRIzol; Invitrogen). RNA samples were then subsequently treated with DNase treatment and removal (TURBO DNA-free; Ambion, Streetsville, ON, Canada). Quantification of RNA was performed with spectrophotometry (ND-1000; NanoDrop Products, Thermo Fisher Scientific, Wilmington, DE). Total RNA integrity was confirmed with a bioanalyzer (model 2100; Agilent Technologies, Palo Alto, CA) according to the manufacturer’s protocol.

The labeling and hybridization of the cRNA was performed at the Prostate Cancer Microarray Centre, University of British Columbia. One microgram of total RNA from all samples and from human universal reference RNA (Stratagene, La Jolla, CA) was amplified and labeled with fluorescent dyes (Cy3 and Cy5; Low RNA Input Linear Amplification Labeling Kit; Agilent Technologies) according to the manufacturer’s protocol. The amount and specific activity of the resulting fluorescently labeled cDNA was assessed with the spectrophotometer. Equal amounts of Cy3- sample and Cy5-labeled universal human reference cDNA were cohybridized (Whole Human Genome Oligo Microarray; Agilent Technologies), comprising over 41,000 human genes and transcripts, for 18 hours before washing and scanning. Data were extracted from the resulting images (Feature Extraction Software; Agilent Technologies).

Red (Cy5 labeled cRNA) and green (Cy3 labeled cRNA) processed signals were entered into the computer software (GeneSpring 7.3.1; Agilent Technologies) and normalized via manufacturer’s protocols for two-color experiments as follows: per spot, divide by control channel; per chip, normalize to the 50th percentile; per gene, normalized to median. The results represent the mean values from three independent experiments. A list of differentially expressed genes was generated by applying a t-test with P < 0.05 between the Aβ_1-40-treated group and the untreated group and by applying a change filter with a cutoff of ±1.5-fold. Linearization of the data was undertaken by log₂ transformation.

Real-Time Quantitative (q)RT-PCR

Reverse transcription reactions were performed for each RNA sample (1 μg) using reverse transcription reagents (Superscript III; Invitrogen Canada). Real-time PCR was performed with a sequence-detection system (Prism 7300; Applied Biosystems [ABI], Foster City, CA). SYBR green PCR master mix (ABI) was used on cDNA samples in 96-well optical plates and analyzed by using qRT-PCR methods, as described elsewhere.²⁵ Oligonucleotide primers for all genes of interest and for the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were designed for real-time PCR on computer (Primer Express 2.0 software; ABI). All primers were purchased from Proligo LL (Boulder, CO). Relative quantification of gene expression was performed using the x-fold change method, as published²⁶ and as recommended by the manufacturer of the sequence detection system (ABI). The relative gene expression was represented by the difference between the normalized values of the experimental samples to that of corresponding sham controls (ΔΔCt). 2^−ΔΔCt for each product was used to calculate changes. A Pearson’s correlation coefficient was used to calculate the correlation between microarray and qRT-PCR log₂-fold changes.

ELISA

Levels of IL-1β, Il-8, and tumor necrosis factor (TNF)–related apoptosis-inducing ligand TNFSF10 (TRAIL) in the supernatant samples were measured using proteome arrays (SearchLight; Thermo Fisher Scientific, Woburn, MA). Samples were incubated for 1 hour on the array plates that were prespotted with capture antibodies specific for each protein biomarker. The plates were emptied and washed three times before the addition of a cocktail of biotinylated detection antibodies to each well and then were incubated for 30 minutes. The plates were then washed three times and incubated again for 30 minutes with streptavidin-horseradish peroxidase. All incubations were at a room temperature with agitation at 200 rpm. The plates were again washed before the addition of chemiluminescent substrate (SuperSignal Femto; Thermo Fisher Scientific) and were immediately imaged (SearchLight; Thermo Fisher Scientific) and the data analyzed (Array Analyst software; Ambion).

Gene Set Enrichment Analysis (GSEA)

To test for sets of related genes that might be systematically altered in Aβ_1-40-treated RPE cells, we performed studies of gene sets in functional pathways by analyzing our microarray dataset using GSEA.²⁷ A total of 1892 curated gene sets containing genes whose products are involved in specific metabolic and signaling pathways were obtained from pathway databases or from peer-reviewed published material. The gene sets were screened against the GSEA-ranked microarray data sets to calculate enrichment score (ES) for each gene set. An enrichment score reflects the degree to which a gene set is overrepresented at the extreme top or bottom of the ranked microarray data set list of genes. The curated gene sets were screened against the microarray data set, and enrichment plots were generated for each gene set. An enrichment plot displays a running enrichment score as a function of the rank-ordered probes in the microarray data set. To adjust for multiple hypothesis testing, the ES for each gene was normalized to account for the size of the set, yielding a normalized enrichment score (NES). The proportion of false positives was controlled for by calculating the false discovery rate (FDR) corresponding to each NES.^27,28

Pathway Analysis

Differentially expressed genes that met our criteria of selection were also analyzed for global functions, network, and canonical pathways (Ingenuity Pathway Analysis; Ingenuity Systems, Redwood City, CA). A spreadsheet (Excel; Microsoft, Redmond, WA) of our data containing a gene list with gene identifiers and corresponding changes was entered into the system, and patterns of differential gene expression were compared with those in the knowledge base (Pathways Knowledge Base; Ingenuity Systems).

Results

Characterization of Aβ_1-40 Oligomers

After incubation for 48 hours, Aβ_1-40 oligomers were examined with the use of AFM and immunodot blot assay. AFM analysis showed that the oligomeric preparations were composed of small globular structures with a distinct lack of fibrils (Fig. 1A). These results were consistent with those in previous studies.^29–31 Dot blot examination with the anti-oligomeric specific antibody (A11) further confirmed the presence of oligomeric structures as it reacted positively with our Aβ_1-40 samples (Fig. 1B). Furthermore, the A11 antibody did not react against a fibrillar standard sample of Aβ_1-40, confirming the specificity of the antibody to the oligomeric form.

Figure 1.

Confirmation of oligomeric form of Aβ_1-40. (A) AFM examination of Aβ_1-40 oligomeric solution at 48 hours. The Aβ_1-40 solution was applied to freshly cleaved mica and imaged according to Chromy et al.⁴⁸ AFM image shows predominately small globular structures (arrows) and a distinct lack of fibrils. (B) Dot blot with the use of the A11 antibody shows positive staining with the Aβ_1-40 sample (arrows) compared to no staining in both negative control and fibrillar form of Aβ samples (Invitrogen). Primary and secondary antibodies were diluted according to manufacturer’s recommendations, 1:1000 and 1:2000, respectively.

RPE Cell Viability after Stimulation with Aβ_1-40 Oligomers

We used an MTT reduction assay to examine the effects of Aβ_1-40 and the reverse peptide Aβ_40-1 on viability of confluent RPE. Figure 2A shows the dose-dependent effects of Aβ_1-40 stimulation (0.001–0.3 μM) at 3 hours. Note that the reverse peptide Aβ_40-1 had a minor effect on the viability of RPE (97% ± 0.05% SD), compared with the DMEM control (100%). We also tested the effects of several doses of Aβ_1-40 (0.01–10.0 μM) on RPE cell viability at the 24-hour exposure time. At 0.01 μM Aβ_1-40 oligomers, the lowest dose, mean (SD) cell viability was measured to be 81% (0.08%) and decreased to 25% (0.06%) at 10.0 μM (Fig. 2B). We also examined the effects of 0.3 μM Aβ_1-40 on the viability of RPE at 3, 6, 12, and 24 hours. Note that cell survival gradually dropped from 83% (0.03%) at 3 hours to 57% (0.07%) relative to the corresponding control cultures by 24 hours (Fig. 2C).

Figure 2.

MTT reduction assay for cell viability after stimulation with Aβ_1-40 or the control reverse peptide Aβ_40-1. (A) Confluent RPE cells were subjected to stimulation with 0.001 to 0.3 μM oligomeric Aβ_1-40 or the reverse peptide, 0.3 μM Aβ_40-1, for 3 hours. Cell viability was significantly reduced at 0.3 μM Aβ_1-40 compared with cells incubated in serum-free DMEM or to cells incubated in the control reverse peptide Aβ_40-1. Note that lower doses (0.001 to 0.1 μM A β_1-40) induced proliferation of the RPE. (B) A dose–response curve for RPE cells stimulated with 0.01- to 10.0-μM solutions of oligomeric Aβ_1-40 for 24 hours demonstrates 81% and 57% cell viability at 0.01 and 0.3 μM. Cell viability drops to <30% at concentrations of Aβ_1-40 greater than 0.3 μM. All doses resulted in significant differences with cells grown in serum free DMEM only. (C) Confluent RPE cells were stimulated with 0.3 μM solutions of oligomeric Aβ_1-40 at 3, 6, 12, and 24 hours. The graph depicts the mean and SD from three independent experiments. RPE cells stimulated with Aβ_1-40 at 0.3 μM displayed a time-dependent decrease in viability dropping to 58% cell viability at 24 hours as assessed with the MTT assay. A two-sample t-test was performed to compare the viability of the cells in the control group (cells incubated in serum-free DMEM and not stimulated with Aβ_1-40) to that of the cells incubated in serum-free DMEM and stimulated with 0.3 μM Aβ_1-40 at each time point. Note that at all time points, the viability of the stimulation group was lower than the control (unstimulated) group (*P < 0.05). The data are shown as the mean and SD of results in three independent experiments.

Gene Expression Analysis of RPE Cells after Aβ_1-40 Stimulation

Analysis of the gene expression response of RPE cells after 0.3 μM Aβ_1-40 treatment was undertaken by using whole-genome oligo arrays (Agilent). At 24 hours, we observed 63 upregulated and 20 downregulated previously known genes (Tables 1, 2). The upregulated genes were found predominantly in the immune response category, but several other categories were also represented, including apoptosis, transcription factors, transporters, cell proliferation, cell signaling, and signal transduction. The three upregulated genes that exhibited the greatest changes were IL-1β (4.8 ± 0.49-fold), RSAD2 (2.58± 0.57-fold), and IL-8 (2.38 ± 0.42-fold). Relatively few genes were downregulated in response to Aβ_1-40 stimulation. Categories of downregulated genes also included immune response, transporters, cell metabolism, and transcription factors.

Table 1.

Upregulation of Differentially Expressed Genes in Aβ-Treated RPE Cells at 24 Hours

Name	Description	GenBank Accession No.	Change (x-Fold)	P
Immune response
IL-1β*	Homo sapiens interleukin 1, beta	NM_000576	4.80	0.0022
RSAD2*	Homo sapiens radical S-adenosyl methionine domain containing 2	NM_080657	2.58	0.0256
IL-8*	Homo sapiens interleukin 8	NM_000584	2.38	0.00177
LAIR1	Homo sapiens leukocyte-associated Ig-like receptor 1	NM_021706	2.32	0.0332
MX1*	Homo sapiens myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)	NM_002462	2.18	0.0187
OAS3	Homo sapiens 2′-5′-oligoadenylate synthetase 3, 100kDa	NM_006187	1.99	0.000495
IF144L*	Homo sapiens interferon-induced protein 44-like	NM_006820	1.98	0.00842
IFI27*	Homo sapiens interferon, alpha-inducible protein 27	NM_005532	1.81	0.00436
OAS1	Homo sapiens 2′,5′-oligoadenylate synthetase 1, 40/46kDa	NM_002534	1.80	0.0154
PRKCZ	Homo sapiens mRNA, chromosome 1 specific transcript KIAA0505.	AB007974	1.71	0.0186
CX3CL1	Homo sapiens chemokine (C-X3-C motif) ligand 1	NM_002996	1.71	0.00906
LSP1	lymphocyte specific protein 1	W725T9	1.68	0.00255
CXCL2*	Homo sapiens chemokine (C-X-C motif) ligand 2	NM_002089	1.68	0.023
TNFSF10*	Homo sapiens tumor necrosis factor (ligand) superfamily, member 10 (TRAIL)	NM_003810	1.58	0.0149
OASL	Homo sapiens 2′-5′-oligoadenylate synthetase-like	NM_003733	1.57	0.016
IL-33*	Homo sapiens chromosome 9 open reading frame 26 (NF-HEV) (C9orf26)	NM_033439	1.55	0.00679
GBP4	Homo sapiens guanylate binding protein 4	NM_052941	1.55	0.0332
MX2	Homo sapiens myxovirus (influenza virus) resistance 2 (mouse)	NM_002463	1.54	0.0191
CFI*	Homo sapiens I factor (complement)	NM_000204	1.54	0.0234
SPN	Homo sapiens sialophorin (gpLI15, leukosialin, CD43)	NM_003123	1.50	0.0138
Apoptosis
XAF1*	Homo sapiens XIAP associated factor-1	NM_017523	2.10	0.0192
C8orf4	Homo sapiens chromosome 8 open reading frame 4	NM_020130	1.70	0.0152
CECR2	Homo sapiens cDNA FLJ34435 fis, clone HLUNG2000955	AK091754	1.65	0.0156
Transcription regulation
ZNF175	Homo sapiens zinc finger protein 175	BC007778	1.92	0.00566
THC2317006	Q7IRG2(Q71RG2) FP2860, partial (26%)	THC2317006	1.89	0.0222
FOXA2	Homo sapiens forkhead box A2	NM_021784	1.76	0.0107
TEAD1	Tea domain family member 1 (SV4O transcriptional enhancement factor)	CR594735	1.75	0.0169
Transporter
NR4A3*	Homo sapiens nuclear RNA export factor 3	NM_022052	1.86	0.0198
C14orf68	Homo sapiens chromosome 14 open reading frame 68	NM_207117	1.68	0.00185
SLC30A4*	Homo sapiens solute carrier family 30 (zinc transporter), member 4	NM_013309	1.64	0.0303
NPCIL1	Homo sapiens NPC1 (Niemann-Pick disease, type CI, gene)-like 1	NM_013389	1.64	0.00187
PKD2L2	Homo sapiens polycystic kidney disease 2-like 2	NM_014386	1.55	0.0118
Cell proliferation
NPY	Homo sapiens neuropeptide Y	NM_000905	2.65	0.0252
MT3*	Homo sapiens metallothionein 3 (growth inhibitory factor (neurotrophic))	NM_005954	1.71	0.0056
Cell signaling
STC1	Homo sapiens stanniocalcin 1	A1476245	1.99	4.14E-05
TSHB	Homo sapiens thyroid stimulating hormone, beta	NM_000549	1.52	0.0498
Metabolism
CYP2D6*	Homo sapiens cytochrome P450, family 2, subfamily D, polypeptide 6	NM_000106	1.82	0.000452
SULT4A1	Homo sapiens sulfotransferase family 4A, member 1	NM_014351	2.02	0.00517
Signal transduction
PMCH	Homo sapiens promelanin-concentrating hormone	NM_002674	1.99	0.00127
SSTR2*	Homo sapiens somatostatin receptor 2	NM_001050	1.51	0.00651
Miscellaneous function
EGFL8	Brain development: EGF-like-domain, multiple 8	NM_030652	1.77	0.0248
RCAN3	Calcium-mediated signaling: RCAN family member 3	BM457392	2.00	0.00402
PACRG	Cell death: PARK2 co-regulated	NM_152410	1.55	0.0222
FLCN	Cell cycle: folliculin	AL831885	1.50	0.0199
FNDC5*	Extracellular matrix: fibronectin type III domain containing 5	NM_153756	1.52	0.0299
LOC221272	Microtubule cytoskeleton organization: FLJ21659 fis, clone COL08743.	AK025312	1.64	0.0174
FLJ21272	Microtubule cytoskeleton organization: FLJ21272 fis, clone COL01753.	AK024925	1.56	0.0147
MTMR9	Phospholipid dephosphorylation: myotubularin related protein 9	AF339813	1.55	0.0394
DPP6	Proteolysis: dipeptidyl-peptidase 6	BX094874	1.54	0.0403
PMCHL2	Synaptic transmission: promelanin-concentrating hormone-like 2	NM_153381	2.36	0.00696
HERC5*	Ubiqitin cycle: hect domain and RLD 5	NM_016323	1.73	0.000338
CLDN6	Cell-cell adhesion: claudin 6	NM_021195	1.82	0.0277
PRRG4	Calcium-ion binding: proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane)	NM_024081	2.19	0.00463
SMOC1	Calcium-ion binding: SPARC related modular calcium binding 1	NM_022137	1.51	0.0104
FRMD3	Protein binding: FERM domain containing 3	BG216229	1.59	0.0138
LXN	Enzyme inhibitor: latexin	NM_020169	1.57	0.00212
CMPK2	Kinase: cytidine monophosphate(UMP-CMP) kinase 2, mitochondrial	BG547557	2.10	0.00714
TRIM14	Metal-ion binding: tripartite motif-containing 14	NM_014788	1.53	0.0141
DSCR6	Protein binding: Down syndrome critical region gene 6	NM_018962	1.87	0.0213
CI6ORF70	Protein binding: chromosome 16 open reading frame 70	BC008476	1.56	0.0419
AK123481	Protein binding: K1AA1377	AK123481	1.56	0.0034
BRD4	Protein binding: bromodomain containing 4	NM_014299	1.64	0.0341
RNASE1*	RNA binding: ribonuclease, RNase A family, 1 (pancreatic)	NM_198232	2.00	0.0026

The data are presented as x-fold changes and log-transformed x-fold changes. The expression level of genes greater than 1.5-fold was considered upregulated (P < 0.05).

^*Genes that are selected for verification by RT-PCR.

Table 2.

Downregulation of Differentially Expressed Genes in Aβ-Treated RPE Cells at 24 Hours

Name	Description	Gene Bank Accession No.	Change (x-Fold)	P
Immune response
PSG8	Homo sapiens pregnancy specific beta-1-glycoprotein 8	NM_182707	−1.64	0.0123
SEMA4A	Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A	NM_022367	−1.75	0.00761
IL-9R	Homo sapiens interleukin 9 receptor (IL-9R)	NM_176786	−1.85	0.0407
Transporter
MFSD7	major facilitator superfamily domain containing 7	NM_032219	−1.52	0.0141
SLC12A3	Homo sapiens solute carrier family 12 (sodium/chloride transporter), member 3	NM_000339	−1.59	0.0158
TRPV5	Home sapiens transient receptor potential cation channel, subfamily V, member 5	NM_019841	−1.61	0.0367
GLTPD1	glycolipid transfer protein domain containing 1	NM_001029885	−1.64	0.00111
ACCN1	Homo sapiens amiloride-sensitive cation channel 1, neuronal (degenerin)	NM_183377	−1.69	0.00179
Metabolism
LYZL2	Homo sapiens lysozyme-like 2	NM_183058	−1.49	0.0139
ALDH1L1	Homo sapiens aldehyde dehydrogenase 1 family, member L1	NM_012190	−2.04	0.00838
Transcription regulation
MAFA	Homo sapiens v-maf musculoaponeurotic fibrosarcoma oncogene homolog A	NM_201589	−1.56	0.00821
FOXE1	Homo sapiens HFKH4 mRNA for fork head like protein	X94553	−1.64	0.0499
Miscellaneous function
RNF36	Apoptosis: ring finger protein 36	NM_182985	−1.61	0.0192
THBS1*	Cell motility: Thrombospondin 1	N48043	−1.64	0.000305
ACTL6B	Cytoskeleton: actin-like 6B	NM_016188	−2.22	0.00128
PLCXD2	Intracellular signaling cascade: phosphatidylinositol-specific phospholipase C, X domain containing 2	NM_153268	−1.52	0.0137
MASTL	Protein phoshorylation: microtubule associated serine/ threonine kinase-like	THC2405366	−1.56	0.0208
GPR78	Signal transduction: G protein-coupled receptor 78	NM_080819	−1.69	0.000824
FIBIN	Translation initiation factor: fin bud initiation factor	NM_203371	−1.52	0.00345
RSPO3	Wnt receptor signaling: R-spondin 3 homolog (Xenopus laevis)	NM_032784	−1.96	0.00811
ACPP	Acid phosphatase activity: acid phosphatase, prostate	NM_001099	−1.64	0.0189
PLEKHA3	Phospholipid binding: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3	BC035471	−1.64	0.000975

The data are presented as x-fold changes and log-transformed x-fold changes. Decreased expression changes are expressed as −(treatment/ control)⁻¹. The expression levels of genes decreased more than −1.5-fold are considered downregulated (P < 0.05).

^*Genes that are selected for verification by RT-PCR.

Confirmation of Differentially Expressed Genes after Aβ_1-40 Stimulation

Real-time qRT-PCR was performed to validate 18 genes of interest that were shown to be differentially regulated by the microarray (black bars, Fig. 3). The gene-specific primer sequences used for qRT-PCR are shown in Table 3. The amplified product for a housekeeping gene, GAPDH, was used as a normalizer and endogenous control. The qRT-PCR-derived validation of the direction and level of expression of the 18 selected genes is displayed in Figure 3 (white bars). The direction of expression was validated by qRT-PCR in 17 of the 18 genes. The Pearson’s correlation coefficient of the PCR and microarray data for the 17 of the 18 genes was 0.65. The single gene that did not validate in the direction of expression with qRT-PCR was thrombospondin, type I, domain containing 1 (THSD1), which the microarray identified as downregulated (−1.64 fold) and RT-PCR identified as upregulated (+1.53-fold).

Figure 3.

Genes of interest from the differential gene expression of RPE cells stimulated by 0.3 μM Aβ_1-40 for 24 hours and analyzed by Agilent Oligo microarray were further verified by qRT-PCR. Primers used for each gene product are shown in Table 3. Note that the microarray data shown here and in Tables 1 and 2 all demonstrated a ≥1.5-fold change, and reached significance (P < 0.05). The largest changes were seen for cytokines, IL-1β and IL-8, and RSAD2 (viperin). Values are expressed as relative changes (log₂-fold) with respect to the corresponding controls. Data represent the mean ± SEM of three independent experiments for both microarray (P < 0.05) and for qRT-PCR. The Pearson’s correlation coefficient of the microarray data and PCR log₂ values for the 17 genes shown in the black and white bars is 0.65. These same 17 genes were also assessed after stimulation with the control reverse peptide (0.3 μM Aβ_40-1) for 24 hours by qRT PCR. Note that the changes associated with the reverse peptide were significantly lower than results obtained after 0.3 μM Aβ_1-40 stimulation.

Table 3.

RT-PCR Primers

Gene	Forward Primer	Reverse Primer	Reference
IL-8	AGGTGCAGTTTTGCCAAGGA	TTTCTGTGTTGGCGCAGTGT
IL-1β	AAGCTGAGGAAGATGCTG	ATCTACACTCTCCAGCTG
CFI	ATTGTGGAGACCAAAGTGATGAAC	TGATACTGGCTTGGAATGCAAA
CXCL2	GATAGAGGCTGAGGAATCCAAGAA	ACATTTCCCTGCCGTCACA
RSAD2	ACACAGGAATAATGACCCCAAAA	TGAGCTAAATGTCAGGTCCTGTGTA
MX1	GCCAGGACCAGGTATACAG	GCCTGCGTCAGCCGTGC	Leong et al.32
IFI44L	CCAATTACACCTGAGCATTCTACTTTT	AGACATAAGCCACACAGTGAATCCT
IFI27	TGGCTCTGCCGTAGTTTTGC	CACAGCCACAACTCCTCCAAT
HERC5	GGGATGAAAGTGCTGAGGAG	CATTTTCTGAAGCGTCCACA	Kroismayr et al.33
SLC30A4	GGCTATCATCAAAATCACCAACCA	CGGTGATGAGCATTATATCTCCATT	Overbeck et al.34
IL-33	CACCCTCAAATGAATCAGG	GGAGCTCCACAGAGTGTTCC	Carriere et al.35
THSD2	TGCACGAAGAAGGGAAAAACAT	TCTCGGACCCGTGTTTCAG
TNFSF10	ATGGCTATGATGGAGGTCCAG	TTGTCCTGCATCTGCTTCAGC	Komatsuda et al.36
XAF1	CCAGAAAATAAGTATTTCCACC	TTATACTTCTTGTCTTTGGACG	Kempkensteffen et al.37
CYP2D6	CCTACGCTTCCAAAAGGCTTT	AGAGAACAGGTCAGCCACCACT	Kojima et al.38
SSTR2	CCCCAGCCCTTAAAGGCATGT	GGTCTCCATTGAGGAGGGTCC	Kumar et al.39
NR4A3	CAACTAGTCCAACCCCTTAAAATTCA	ACCTTGAGIAACTCTTCACCCTTCA
FN	GACCACACCGCCCACAAC	TCCTACATTCGGCGGGTATG
GAPDH	CATCCATGACAACTTTGGTATCGT	CAGTCTTCTGGGTGGCAGTGA	Wang et al.25

In total, 18 genes were selected for validation by RT-PCR. Nearly, all expression patterns were comparable to the microarray data.

We also performed qRT-PCR for selected genes after stimulation of RPE cells with the reverse peptide (Aβ_40-1). qRT-PCR was performed for the 17 genes of interest obtained from the microarray analysis (Agilent) that were differentially upregulated after Aβ_1-40 stimulation. The amplified product for the same housekeeping gene, GAPDH, was used as a normalizer and endogenous control. As expected, stimulation with the control reverse peptide (Aβ_40-1) resulted in changes that were insignificant (Fig. 3, gray bars) relative to those observed after Aβ_1-40 stimulation (Fig. 3, white bars).

Supernatant Studies

Analysis of supernatants from the RPE cell culture was performed to identify the secreted levels of selected gene products. Among the three gene products (IL-8, IL-1β, TNFSF10 [TRAIL]) examined, only IL-8 was detected in significant amounts in the supernatant samples. After stimulation with Aβ_1-40 for 24 hours, the RPE cells secreted IL-8 at an increased level compared with the untreated RPE cells. As shown in Figure 4, the amount of secreted IL-8 was 91% higher than in the control untreated group.

Figure 4.

Cytokine levels in cell culture supernatant samples. Human fetal RPE cells challenged with 0.3 μM Ab_1-40 oligomers for 24 hours showed increased secretion of IL-8 by ELISA. Compared to control cells, IL-8 secretion was increased, by approximately a factor of 2, in cultures of Ab_1-40-treated cells (*significance by t-test, P < 0.05). Mean values from three independent experiments and the SEM are shown.

Pathway Analysis

Using the mRNA expression profiles of human RPE cells treated with Aβ_1-40, we sought to determine the functional gene sets that correlated highly with our gene expression data using two types of pathway analysis. GSEA analysis identified 50 significantly enriched gene sets that correlated with the genes induced after Aβ_1-40 treatment. Many of these gene sets are highly enriched with genes related to immune response and inflammatory processes. Table 4 lists some of the top gene sets selected by the GSEA analysis. Note that all sets include genes associated with inflammatory processes. After 24 hours, the Aβ_1-40 treatment induced strong activation of genes associated with the interferon signaling pathway, immune signaling pathways, and the NF-κB signaling pathway involved in inflammatory processes (NES ≥ 2.03). Leading-edge analysis of gene set 13 in Table 4 within GSEA uncovered a subset of genes, including IL-1β and IL-8, within this gene set that was principally responsible for the total enrichment score (Table 5). As IL-1β and -8 were both upregulated in our data set, the GSEA analysis highlights the significance of inflammatory processes in the major pathways activated after Aβ_1-40 stimulation in our study. Complementary GSEA analysis was unable to identify any pathways significantly enriched with Aβ_1-40 downregulated genes. Figure 5 lists the top genes that appear across multiple enriched gene sets from the GSEA analysis. The leading-edge analysis of our microarray data identified genes highly correlated with inflammation, immune response, interferon-regulated genes, neurodegeneration, and apoptosis.

Table 4.

Summary of GSEA Analysis

	Gene Set(Pathway)	Genes within Gene Set (Top 20 only)	NES	FDR
1	DAC_BLADDER_UP(IFN signaling)	OAS2, MX1, IF144L, OAS1, CXCL2, TNFSF10, STC1, IFIT3, STAT1, ICAM1, MMP1, IRF7, CIS, MX2, C3, IL13RA2, TNFAIP3, HBEGF, NT5E, SLP1	2.38	0.000
2	IFNA_UV-CMV_COMMON_HCMV_6HRS_UP (IFN and inflammatory signaling pathways)	OAS2, RSAD2, MX1, IFI44L, OAS1, IF127, OASL, TNFSF10, IFIT3, INDO, ISG20, CIORF38, TDRD7, STXI1, BAZIA, SAMHD1, TLR3, IRF7, GCH1, MX2	2.37	0.000
3	DAC_IFN_BLADDER_UP (IFN signaling)	OAS2, MX1, OAS1, CXCL2, TNFSF10, IFIT3, STAT1, ICAM1, IRF7, CIS, MX2, C3, ILI3RA2, TNFAIP3, SLP1, CCL5, CCL20	2.36	0.000
4	TAKEDA_NUP8_HOXA9_3D_UP (IFN signaling)	OAS2, RSAD2, MX1, IFI44L, OAS3, OAS1, CTSG, HERC5, IF127, OASL, IFIT3, IFIT1, IFIT2, IFIH1, CCL18, INDO, PLSCR1, DDX58, EPSTI1, DST	2.35	0.000
5	IFNA_HCMV_6HRS_UP (IFN and inflammatory signaling pathways)	OAS2, RSAD2, MX1, 1F144L, OAS1, IF127, OASL, TNFSF10, IFIT3, INDO, PLSCR1, ISG20, STAT1, TRIM22, IFIT5, CIORF38, TDRD7, STXI1, ZBTB20, BAZIA	2.32	0.000
6	CMV_HCMV_TIMECOURSE_12HRS_UP (IFN and inflammatory signaling_pathways)	OAS2, RSAD2, MX1, OAS1, OASL, TNFSF10, IFIT3, ISG20, CH25H, B4GALT5, IRF7, SOD2, PRPF19, MX2, GBP2, TNFAIP6, RARRES3, RHOB, CCL5, NR4A3	2.28	0.000
7	TAKEDA_NUP8_HOXA9_8D_UP (IFN signaling)	OAS2, RSAD2, MX1, IFI44L, OAS3, OAS1, CTSG, HERC5, IFI27, LXN, NR4A2, IFIT3, IFIT1, IFIT2, DHRS3, C20ORF103, IFIH1, MTSS1, INDO, DDX58	2.18	0.001
8	BENNETT_SLE_UP (IFN signaling)	OAS2, MX1, IFI44L, OAS1, OASL, TNFSF10, IFIT3, PLSCR1, CAMP, STAT1, C2, TAP1, IFI35, TDRD7, IFITM3, IRF7, APOBEC3C, MX2, SERPING1, LY6E	2.14	0.002
9	TAKEDA_NUP8_HOXA9_10D_UP (IFN signaling)	OAS2, RSAD2, MX1, IFI44L, OAS3, OAS1, HERC5, DCAL1, IFI27, OASL, NR4A2, IFIT3, IFIT1, IFIT2, DHRS3, CD38, C20ORF103, IFIH1, INDO, DDX58	2.12	0.003
10	IFNALPHA_NL_UP (IFN signaling)	RSAD2, MX1, IFI44L, IF127, TNFSF10, PLSCR1, VCAM1, STAT1, IFITM1, UBE2D3, BST2, IRF7, CALR, MX2, HLA-E, PIAS4, KIAA0409, UBE2L6, AKR7A2, PSME1	2.10	0.004
11	SANA_TNFA_ENDOTHELIAL_UP (IFN, inflammatory, and immune signaling pathways)	IL8, OAS2, MX1, IFI44L, OAS3, OAS1, CXCL2, CX3CL1, IFIT1, CXCL3, IFIH1, FIJ20035, PARP14, VCAM1, BIRC3, UBD, CCL2, GBP1, OXR1, NFKBIA	2.07	0.006
12	SANA_IFNG_ENDOTHELIAL_UP (IFN, inflammatory, and immune signaling pathways)	OAS2, MX1, IFI44L, QAS1, TNFSF10, CX3CL1, NOD27, IFIH1, INDO, ILI8BP, FLJ20035, PARP14, TNCRNA, STAT1, UBD, DTX3L, GBP1, LAP3, C17ORF27, CXCL9	2.04	0.008
13	NTHIPATHWAY (NF-κB signaling-related to inflammation)	ILIB, IL8, DUSP1, NFKBIA, NR3C1, EP300, CREBBP, TGFBR1, IKBKB, MAP2K6, TLR2, RELA, MAPK14, MAPK11, TGFBR2, CHUK, MAP3K7, NFKB1, MYD88, MAP2K3	2.04	0.008
14	GALINDO_ACT_UP (Inflammatory and apoptosis signaling)	IL1B, CXCL2, ILI8RAP, ILIRN, PTGS2, PDGFB, LILRB4, DUSP1, NFKB1A, IER3, FOSL1, CSF3, ICAM1, CCL3, RREB1, TNFSF9, BCL3, UBC, TNFAIP2, CCL4	2.04	0.008
15	CMV_UV-CMV_COMMON_HCMV_6HRS_UP (IFN and inflammatory signaling)	RSAD2, MX1, OASL, NR4A2, IFIT3, ILI1, ZC3HAV1, RIPK1, PMAIP1, POLG2, ATF3, CREM, GCH1, C12ORF22, PSCD1, NR4A3, BTRC, SLC745, NR4A1	2.03	0.007

GSEA analysis of the microarray results for Aβ treatment versus control helped in identifying gene sets correlated predominately with inflammation. Pathway 13, NTHIPATHWAY is identified as one of the inflammatory gene sets of particular interest, such as IL-β and IL-8, the top-ranked genes in this set. All gene sets can be accessed at the Molecular Signatures Database, http://www.broad.mit.edu/gsea/msigdb/index.jsp (provided in the public domain by the Broad Institute at Massachusetts Institute of Technology, Cambridge, MA).

Table 5.

Associated Gene Found in the NTHIPATHWAY Gene Set

	Probe	Rank in Gene List	Rank Metric Score	Running Es	Core Enrichment
1	ILIB*	0	3.264	0.3542	Yes
2	IL8*	8	2.035	0.5747	Yes
3	DUSP1	961	0.461	0.5703	Yes
4	NFKBIA	1,052	0.439	0.6128	Yes
5	NR3C1	1,116	0.428	0.6556	Yes
6	EF300	1,747	0.320	0.6543	Yes
7	CREBBP	1,812	0.311	0.6844	Yes
8	TGFBR1	2,068	0.279	0.7002	Yes
9	IKBKB	3,348	0.180	0.6466	No
10	MAP2K6	3,627	0.165	0.6486	No
11	TLR2	4,454	0.126	0.6151	No
12	RELA	4,626	0.119	9.6182	No
13	MAPK14	5,538	0.082	0.5750	No
14	MAPK11	5,719	0.075	0.5729	No
15	TGFBR2	6,135	0.058	0.5554	No
16	CHUK	6,171	0.057	0.5596	No
17	MAP3K7	6,989	0.029	0.5160	No
18	NFKB1	7,241	0.020	0.5039	No
19	MYD88	8,062	−0.006	0.4576	No
20	MAP2K3	10,744	−0.094	0.3146	No
21	MAP3K14	12,052	−0.142	0.2553	No
22	TNF	16,472	−0.524	0.0597	No

A detailed look into this gene set shows that IL-1b and IL-8 are the top-ranked genes in our experimental Aβ dataset. Genes that are found in the leading edge of this gene set are marked “Yes”in the core enrichment column. They are the genes that significantly contribute to the total enrichment score of the NTHIPATHWAY gene set.

Figure 5.

GSEA leading edge gene sets analysis. The analysis selects the genes that appear across multiple enriched gene sets from the public databases. These genes are expected to have higher biological significance. The leading edge analysis of our microarray data identified gene highly correlated with inflammation, immune response, interferon-regulated genes, apoptosis, and neurodegeneration.

Pathway analysis of differentially expressed genes that reached criteria in our Aβ_1-40 stimulation studies revealed the top six gene networks that reach threshold (P < 0.05) are leukocyte extravasation signaling, natural killer cell signaling, hepatic cholestasis, FXR/RXR activation, IL-10 signaling, and the complement activation (Fig. 6).

Figure 6.

Pathway analysis by Ingenuity Pathway Analysis (IPA) software program. Note that the six top-ranked pathways, leukocyte extravasation signaling, natural killer cell signaling, hepatic cholestasis, FXR-RXR activation, IL-10 signaling and the complement system, reached the criteria set at P < 0.05. All six are associated with inflammation.

Discussion

Proinflammatory Cytokines and Chemokines

Inflammation has been strongly implicated in the pathogenesis of AMD, but the initiation of the inflammatory processes in AMD is not well understood.^4,10–12 In this study, we hypothesized that Aβ_1-40, a component of drusen, is a candidate trigger of inflammatory processes in the retina. Aβ is known to activate the classic and alternative complement pathways in neuronal systems.^{10,14,15,40–43} The results of our study demonstrated that treatment of human RPE cells with the oligomeric form of Aβ_1-40 (0.3 μM) for 24 hours resulted in the upregulation of a number of inflammation-associated genes, as shown by microarray and later verified by RT PCR. The top three genes with the greatest increase after Aβ_1-40 challenge were IL-1β, RSAD2, and IL-8. Gene set pathway analysis also concurred that the bulk of the gene responses in our study overlap with genes associated with inflammatory processes in the public databases. These results provide further support to the hypothesis that Aβ may trigger inflammatory responses in the RPE/choroidal layers of the eye.

IL-1β is an important proinflammatory cytokine that stimulates the activation of macrophages, and the production of cytokines such as IFN-γ,^44–49 which promotes the upregulation of interferon α-inducible protein 27 (IFI27) in several types of cell lines.⁵⁰ In our studies, IFI27 was upregulated after Aβ_1-40 treatment and suggests that activation of pathways associated with IFN-γ are downstream of Aβ_1-40 stimulation. Recently, Wu et al.⁵¹ showed that IFN-γ, along with oxidative stress, downregulates the complement inhibitor CFH, which could lead to increased complement activation, a known risk factor in AMD. Our studies revealed that Aβ_1-40 stimulation of PE cells lead to IL-1β upregulation. In the context of the diseased eye, it is conceivable that interactions between IL-1β and reactive oxygen species (ROS) in the retina induce down-regulation of CFH and thus promote chronic inflammation. More studies are needed to further evaluate the downstream pathways associated with Aβ_1-40 stimulation.

IL-1β was also shown to induce ROS in RPE cells.⁵² It is believed that ROS production may promote secretion of IL-8 in RPE cells.^53,54 Thus, it is also possible that IL-1β can regulate the expression of IL-8 in RPE by direct and indirect (via ROS) mechanisms in RPE.^52,53,55,56 Because of its chemotaxic abilities, IL-8 release may account for the observed accumulation of inflammatory cells in the regions of drusen formation in patients with AMD. The recruitment of macrophages and neutrophils and other proinflammatory cells that produce and release proteinases and angiogenic factors into drusen could also promote neovascular events associated with the wet form of AMD.^57–59

Although, the mRNA of both IL-1β and -8 were significantly expressed, ELISA only detected IL-8 protein in the supernatant, perhaps because the IL-1β precursor protein has been shown to possess a short half-life.⁶⁰

RSAD2, or viperin, was upregulated 2.58-fold in our studies. RSAD2 is a virus inducible antiviral protein associated with the innate immune response.⁶¹ It is upregulated in atherosclerotic plaques and inducible in endothelial cells by stimulation with LPS, IFN-γ, or cytomegalovirus. This is the first report that RPE cells can differentially express RSAD2. Its specific role in AMD pathogenesis is not yet known.

CFI and CFH

In this study, we also observed increased gene expression of complement factor I (CFI), which is a known inhibitor of the complement system. CFI inhibits complement activation by inactivating complement component 3b (C3b); dysregulation of CFI promotes uncontrolled complement activation.^18,62,63 Recently, Fagerness et al.⁶⁴ identified a variant in the CFI gene that is associated with an increased risk of developing AMD. Wang et al.¹⁸ discovered that Aβ stimulation of RPE cells resulted in the inability of CFI to cleave active C3b into its inactive form (iC3b). Although the mechanism remains unknown, Aβ is thought to bind to CFI and consequently inhibits its regulatory function and causes unregulated complement activation.¹⁸ Future studies are needed to determine the interactions between Aβ and CFI that cause its dysregulation of the complement pathways and the subsequent effects on RPE function. In addition to CFI, there is evidence in the literature supporting involvement of CFH, another inhibitor of the complement cascade, based its known polymorphism in AMD.^65–68 However, there was no evidence in our study or in Wang et al.¹⁸ of Aβ_1-40-induced changes in the expression of CFH in human RPE cells. This finding may relate to the interactions discussed by Wu et al.⁵¹ in which IFN-γ, along with oxidative stress, downregulated the complement inhibitor CFH.

Angiogenic Factors

Aβ_1-40-treated RPE cells were also observed to express several angiogenesis-related genes. We observed an increased gene expression of somatostatin receptor 2 (SSTR2) and fibronectin (FN) in RPE cells after treatment with Aβ. Somatostatin is a neuropeptide with antiproliferative effects in a variety of normal and cancerous cells.^69–73 Along with its receptor SSTR2, somatostatin has been identified in the RPE cells and has been demonstrated to inhibit VEGF mRNA expression,⁷⁴ a finding that is consistent with our results. On the other hand, Yoshida et al.¹⁷ showed that stimulation of human RPE cells with Aβ_1-40 resulted in the altered expression of angiogenic genes, specifically vascular endothelial growth factor (VEGF). Although we did not observe changes in the levels of VEGF expression in our study, possibly due to the inhibitory effects of somatostatin on VEGF mRNA expression, the differences may also be due to the specific time courses and doses of Aβ_1-40 used in each study.

Another upregulated gene, FN, which codes for an extracellular matrix (ECM) glycoprotein, may also play a role in angiogenesis. It is possible that altered levels of ECM genes, including FN, can lead to abnormal RPE-choriocapillaris behavior.⁸

Apoptotic Mechanisms

The effect of the oligomeric form of Aβ_1-40 on RPE cell viability was assessed by MTT. Several apoptotic genes were upregulated in the microarray study and support the reduction in cell viability observed in the MTT study. qRT-PCR studies showed increased gene expression of two important caspase-independent apoptotic genes, tumor necrosis factor related apoptosis-inducing ligand (TNFSF10 or TRAIL) and X-linked inhibitor of apoptosis associated factor 1 (XAF1). TRAIL, a member of the TNF superfamily, is expressed in several cell types and is activated by Aβ stimulation in neurons. It is believed that TRAIL expression promotes apoptotic cell death, as neutralization of TRAIL protects against Aβ toxicity in a human neuronal cell line.⁷⁵

XAF1, another gene upregulated in our stimulation studies, interacts with XIAP to block its anticaspase activity.⁷⁵ In earlier studies XAF1 was identified in several screens as a key mediator of apoptosis and was recently shown to dramatically sensitize cancer cells to apoptotic triggers such as TN-FSF10.^76,77 Accordingly, it has been shown that interferon-induced apoptosis is mediated by the overexpression of XAF1, which is believed to increase susceptibility to TRAIL-induced cytotoxicity.⁷⁷ Thus, in our studies, Aβ_1-40 stimulation of RPE cells may have activated cell death in the RPE via XAF1 and TNFSF10 activity, as both genes were significantly upregulated in our study and have been shown to increase apoptosis in cancer cells.⁷⁸

Our results also showed an increased expression of CYP2D6, a member of the cytochrome P450 family that is involved in the first line of defense against oxidative stress and has been shown to detoxify reactive oxygen species (ROS).⁷⁹ Aβ_1-40 stimulation of RPE cells in our study may also initiate ROS-induced signaling pathways, including stress-activated protein kinases and nuclear transcription factor NF-κB.^52,80–82 NF-κB is upregulated by IL-8 and has been implicated in retinal neovascularization.^47,83

Proposed Interaction of Gene Products Differentially Expressed in RPE after Aβ_1-40 Stimulation

In conclusion, our in vitro studies lend support to the hypothesis that Aβ_1-40 promotes local inflammation near drusen sites and within the surrounding RPE layer that may promote the pathogenesis of AMD.^3,10,17 Our finding that RPE cells upregulate several genes associated with proinflammatory cytokines (IL-1β, IL-8), interferon-inducible proteins (IFI27, IFI44L), an inhibitor of the complement cascade (CFI), and an inhibitor of oxidative stress (CYP2D6) in response to Aβ_1-40 challenge, may present a novel mechanism and partial explanation for the onset of inflammation in the eye near drusen sites. A summary schematic that illustrates the proposed circuitry by which Aβ_1-40 may affect RPE gene expression leading to inflammatory events in the eye is shown in Figure 7. We hypothesize that Aβ_1-40, known already to be present in drusen of AMD eyes, may induce RPE cells to secrete proinflammatory cytokines in which IL-1β may subsequently further promote overexpression of IL-8 via several known mechanisms, including ROS production.^53,54 IL-8, an important chemokine, may promote migration and activation of immune cells (neutrophils, macrophages) toward the RPE.^82,85,86 The accumulation of neutrophils, macrophages, and microglial cells may cause further pathologic changes in the RPE and Bruch’s membrane complex.^4,8,9,81,87 Our results also suggest that, Aβ_1-40 may promote RPE cells to overexpress CFI. Other in vitro studies showed that the interactions between Aβ_1-40 and CFI cause CFI to lose its complement regulatory function.^18,62 In the absence of CFI, unregulated complement activation would take place resulting in increased inflammation.¹⁸ Furthermore, Aβ_1-40 may also cause RPE cells to secrete IFN-γ. According to Wu et al.⁵¹ IFN-γ (along with oxidative stress) may reduce CFH activity, thus increasing complement activation that may further promote AMD disease progression.

Figure 7.

Summary schematic of results obtained from Aβ_1-40 stimulation of RPE cells. After 24 hours, genes for IL-1β, IL-8, CFI, CYP2DK, IFI44L and IFI27 were upregulated in response to Aβ_1-40 stimulation (represented by black boxes, white text and solid lines). IL-1β is known to also promote generation of ROS, which may further promote IL-8 expression (dashed line). In the context of the eye, IL-8 overexpression by RPE may promote macrophage and microglial migration toward RPE and in drusen containing Aβ. A prolonged macrophage and microglial response in the RPE/choroid layers may further support oxidative injury and inflammatory events through respiratory burst mechanisms. Genes for interferon-induced proteins (IFI44L and IFI27) were also upregulated in response to Aβ_1-40 stimulation in our studies. Interferon-γ, in the setting of oxidative stress, was shown to reduce CFH activity, and thus promote inflammation (dashed line). In our study, two of the genes upregulated in response to Aβ_1-40 stimulation, CFI and CYP2D6, have protective value. The protective value of CYP2D6 is in its ability to act as a first line of defense against oxidative stress by detoxifying reactive oxygen species (ROS).¹² CFI, an inhibitor of the complement cascade, may work to inhibit the complement cascade; however, Aβ was shown to deleteriously interact with CFI causing its regulatory functions to be abolished.^18,62 In the absence of CFI, unregulated complement activation would take place resulting in increased inflammation.⁸⁴ Studies that support the pathways shown: 1, Poleganov et al.⁴⁹; 2, Yang et al.⁵²; 3, Elner et al.⁵³ and Bian et al.⁵⁴; 4, Wu et al.⁵¹; 5, Chen et al.⁶⁸; and 6, Wang et al.¹⁸