Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Dec 11.
Published in final edited form as: FEBS Lett. 2013 Nov 1;587(24):3961–3967. doi: 10.1016/j.febslet.2013.10.028

ESET histone methyltransferase regulates osteoblastic differentiation of mesenchymal stem cells during postnatal bone development

Kevin A Lawson 1, Colin J Teteak 1, Jidi Gao 1, Ning Li 2, Jacques Hacquebord 1, Andrew Ghatan 1, Anna Zielinska-Kwiatkowska 1, Guangchun Song 3, Howard A Chansky 1,2, Liu Yang 1,2,*
PMCID: PMC3947621  NIHMSID: NIHMS542559  PMID: 24188826

Abstract

To investigate the effects of histone methyltransferase ESET (also known as SETDB1) on bone metabolism, we analyzed osteoblasts and osteoclasts in ESET knockout animals, and performed osteogenesis assays using ESET-null mesenchymal stem cells. We found that ESET deletion severely impairs osteoblast differentiation but has no effect on osteoclastogenesis, that co-transfection of ESET represses Runx2-mediated luciferase reporter while siRNA knockdown of ESET activates the luciferase reporter in mesenchymal cells, and that ESET is required for postnatal expression of Indian hedgehog protein in the growth plate. As the bone phenotype in ESET-null mice is 100% penetrant, these results support ESET as a critical regulator of osteoblast differentiation during bone development.

INTRODUCTION

The evolutionarily conserved SET (suppressor of variegation, enhancer of zest and trithorax) domain is present in a group of proteins that function as histone methyltransferases [1]. Among these histone methyltransferases, the ESET (an ERG-associated protein with a SET domain, also known as SETDB1 protein) was found to methylate histone H3 specifically at lysine 9 (H3-K9) [2]. It has been reported that the ESET gene is widely expressed in a variety of cells and tissues, suggesting that the ESET protein may have multiple cellular functions [3].

The ESET protein contains two major functional domains: the N-terminal tudor domain is responsible for interaction with other chromatin modification enzymes, while the C-terminal SET domain catalyzes methylation of H3-K9. Ubiquitous deletion of the ESET gene was found to cause peri-implantation lethality during embryogenesis [4], however, it was recently shown possible to generate viable animals with tissue-specific deletion of the SET domain encoded by exons 15-22 of the ESET gene [5, 6].

To investigate the effects of histone methyltransferases on the differentiation of mesenchymal stem cells into osteoblasts and postnatal bone development, we analyzed the bone phenotype in mice harboring mesenchymal-specific deletion of the SET domain from the ESET protein (therefore inactivates its H3-K9 methyltrnaferase activity). Our results demonstrate that specific knockout of ESET in mesenchymal cells severely impairs osteoblast differentiation in mutant mice, and is associated with deregulation of Runx2 and Indian hedgehog (Ihh) that are well known for their critical roles in the differentiation of mesenchymal stem cells into both chondrocytes and osteoblasts.

MATERIALS AND METHODS

Generation of mesenchymal-specific ESET knockout, staining for osteoblasts and osteoclasts in bone sections

All experiments were reviewed and approved by the Institutional Animal Care and Use Committee at the VA Puget Sound Health Care System. Generation of the (exon 15&16)Flox/Flox; Prx1-Cre mutants was described previously [5]. To identify alkaline phosphatase (ALP)-positive osteoblasts in bone sections, we followed a previously published protocol using an ALP staining kit (Sigma cat# 86R-1KT) [7].

Osteoclasts in the bone are characterized by expression of tartrate-resistant acid phosphatase (TRAP). To visualize osteoclasts in bone sections, fixed tissue sections were stained using a TRAP staining kit (Sigma cat# 386A-1KT) following the manufacturer's instructions. Areas with the most osteoclasts were counted in multiple light fields and shown as the average number ± S.D. per light field.

Osteogenic differentiation of mesenchymal stem cells in vitro

Mesenchymal stem cells were isolated from mouse bone marrow as previously described [8]. Cells were then plated in fibronectin/collagen coated 48-well plates at a density of 40 × 103 cells/well. After reaching confluence, cells were switched to osteogenic differentiation medium (DMEM with 15% FBS, 0.1 μM dexamethasone, 10 mM β-glycerophosphate, and 0.05 mM L-ascorbic acid-2-phosphate). Differentiation medium was changed twice a week. Staining for ALP was done 2 weeks later, and Alizarin red staining for mineralized matrix was carried out after 3 weeks of culture in osteogenic medium.

Inducible siRNA knockdown of ESET expression in ATDC5 cells

Doxycycline induced siRNA knockdown of ESET was achieved using the pSLIK (single lentiviral vector for inducible knockdown) platform [9]. Oligonucleotides 5’-AGCGACCCGAGGCTTTGCTCTTAAATTAGTGAAGCCACAGATGTAATTTAAG AGCAAAGCCTCGGGC-3’ and 5’-GGCAGCCCGAGGCTTTGCTCTTAAATTACATCTGTGGCTTCACTAATTTAAGA GCAAAGCCTCGGGT-3’ were annealed for insertion into the lentiviral vector to generate a hybrid transcript that fuses green fluorescence protein (GFP) with a microRNA-like short hairpin against nucleotide 3639-3660 of mouse ESET mRNA. A control microRNA-like short hairpin that does not affect ESET expression was similarly generated through annealing of 5’-AGCGAGTTGATCGGCTGTTTGATGATTAGTGAAGCCACAGATGTAATCATCA AACAGCCGATCAACC-3’ and 5’-GGCAGGTGGATCGGCTGTTTGATGATTACATCTGTGGCTTCACTAATCATCAA ACAGCCGATCAACT-3’ and subsequent cloning. After co-transfection into 293FT cells with the ViraPower lentiviral packaging DNA mix (Invitrogen), supernatants containing the lentivirus were used to infect ATDC5 cells. Hygromycin (150 μg/mL)-resistant colonies were expanded, treated in maintenance medium plus or minus doxycycline (1 μg/ml), checked for GFP induction in live cells, and lysed at different days post-doxycycline to confirm ESET knockdown.

Transfection and luciferase assays

Using the FUGENE 6 reagent, 500 ng of pOG2-Luc [10], 1000 ng of pCMV-HA-Runx2 and 1000 ng of pSG5-FL-ESET plus 50 ng of pRL-SV40 were transfected into 5 × 105 ofC3H10T1/2 cells in one well of a 6-well plate. Similarly, 2500 ng of pOG2-Luc plus 50 ng of pRL-SV40 was transfected into 5 × 105 ATDC5 cells. After 48 hrs, the cells were washed once with PBS and lysed with 0.5 ml passive lysis buffer for measurement of luciferase activity using the Dual-Luciferase Reporter Assay System (Promega). Firefly luciferase reporter activities were normalized according to the Renilla luciferase controls. At least three independent transfections were performed to rule out experimental variations. A separate set of the transfection was collected in 0.1 ml lysis buffer per well for western blotting with a rabbit polyclonal anti-ESET (Santa Cruz Biotch, cat# SC-66884), a rabbit polyclonal anti-Runx2 (Santa Cruz Biotech, cat# SC-10758), or with HRP-conjugated mouse monoclonal anti-Flag (clone M2) and rat monoclonal anti-HA (clone 3F10).

Immunohistostaining

Paraformaldehyde fixing of tissue sections and antigen retrieval were described previously [5]. A rabbit polyclonal antibody against osteocalcin from Abcam (catlog # ab93876) was used at 1: 200 dilution, a rabbit polyclonal antibody against Ihh (Cat# SC-13088, Santa Cruz biotechnology) was used at 1:50 dilution. After overnight incubation with the primary antibody and washes in PBS, the sections were incubated with a Cy3-conjugated goat anti-rabbit IgG from Jackson ImmunoResearch Laboratories at a 1:200 dilution for 1 h at room temperature before mounting for examination under a fluorescence microscope.

Statistics analysis

Differences between two groups were compared using Student t-test. A p value < 0.05 was considered statistically significant.

RESULTS

ESET knockout impairs osteoblasts in the long bones

We recently generated ESET(exons 15&16)Flox/Flox; Prx1-Cre mice, referred to as (exon 15&16)CKO/CKO mutants, with deletion of the entire bifurcated SET domain from ESET protein in mesenchymal cells. When analyzed by micro-computed tomography (μCT), these mutant mice exhibited a significant decrease of trabecular bone when compared with its wild-type littermates [5]. To investigate whether osteoblasts are affected by ESET knockout, we stained proximal tibia sections of mice for alkaline phosphatase (ALP)-positive osteoblasts at day 7 and one month after birth. As shown for day 7 mice in Fig. 1a (top panel), though the staining intensity of ALP-positive osteoblasts in the knockout long bone was similar to that of wild-type long bone, the zone of ALP-positive osteoblasts has advanced significantly closer to the articular joint and is much narrower in depth than that observed in the wild-type littermate. Primary spongiosa, a landmark bone structure representing the initial trabecular network, is impaired in (exon 15&16)CKO/CKO mice at postnatal day 7.

Fig. 1. Significant decrease of osteoblast activity in ESET-deficient mice.

Fig. 1

a, proximal tibias from wild-type and (exon 15&16)CKO/CKO littermate were stained for APL-positive osteoblasts (red) at one week (top panel) and one month (bottom panel) after birth. Note that in addition to decrease in ALP-positive osteoblasts, ESET-deficient tibia also lacked the epiphyseal plate. b, paraformaldehyde-fixed and decalcified sections of femoral condyles from one month-old mice were stained by H&E to show general cell morphology, and by anti-osteocalcin (red) to show differences in mature osteoblast activity. Scale bar: 400 μm.

When long bone sections from one month-old animals were stained, a larger decrease in ALP-positive osteoblasts was observed in ESET knockout mice when compared to wild-type animals. As shown in Fig. 1a (bottom panel), the decrease of ALP staining in (exon 15&16)CKO/CKO animals was so drastic that very few regions could be considered positive for ALP activity. Furthermore, a marked absence of epiphyseal plates was evident in the knockout mice when compared to the wild-type animals.

ALP activity is normally detected at an early stage of osteoblast differentiation and continues to increase during osteoblast maturation until the mineralization phase [11]. It is osteocalcin expression, not ALP activity, that is generally recognized as a specific marker for mature osteoblasts. Since proximal tibias in the knockout mice were already found to have severe defects in ALP-positive osteoblasts, we also analyzed sections of distal femurs from one month-old wild-type and (exon 15&16)CKO/CKO animals for osteocalcin protein in the bone matrix. As shown in Fig. 1b, H&E staining revealed a much less compact architecture of trabecular bone at the mutant femoral condyle, and immunohistostaining also showed a significantly lower level of osteocalcin expression within the mutant bone matrix. It should be pointed out that similar results were obtained from more than 5 pairs of sex and age-matched wild-type and (exon 15&16)CKO/CKO mutants, indicating that the bone phenotype in ESET knockouts is 100% penetrant. Thus, ESET knockout appears to impair both ALP-positive osteoblasts and osteocalcin-positive mature osteoblasts in vivo.

ESET knockout does not affect osteoclast formation in the long bones

Defective formation of trabecular bone in (exon 15&16)CKO/CKO mutant mice may also be caused by an increase in osteoclast activity leading to acceleration of bone resorption. To investigate whether osteoclastogenesis was affected by the specific knockout of ESET in mesenchymal cells, we stained bone sections for tartrate-resistant acid phosphatase (TRAP), a specific marker of osteoclast activity. As shown in Fig. 2a, osteoclast numbers in the tibia decreased from postnatal day 7 to one month after birth. When compared to wild-type animals at the same age, there was no significant change in the number of TRAP-positive osteoclasts for ESET-null mutants. In addition, we did not observe a significant change in cell size for multi-nucleated osteoclasts in (exon 15&16)CKO/CKO animals (Fig. 2b). These findings therefore suggest that trabecular bone defects found in (exon 15&16)CKO/CKO mice are not caused by an upregulation of osteoclast activity (through an increase in osteoclast number or its cell size) following mesenchymal-specific knockout of ESET histone methyltransferase.

Fig. 2. Effects of mesenchymal-specific knockout of ESET on osteoclasts.

Fig. 2

a, TRAP-positive osteoclasts in the proximal tibias of wild-type (WT) and (exon 15&16)CKO/CKO mutants were counted and shown as the average number ± S.D. Asterisks indicate significance of the counts in knockout vs WT animals (*p=0.58 for 1 week-old and **p=0.61 for 1 month-old). b, Representative osteoblasts (purple) from one month-old proximal tibias of wild-type and (exon 15&16)CKO/CKO mutants are shown. Nuclei within the osteoclasts are detected by DAPI and merged with the TRAP-staining images. Genotypes are indicated on the side. Scale bar: 50 μm.

ESET knockout inhibits differentiation of mesenchymal stem cells into osteoblasts

To validate the above finding that ESET histone methyltransferase is critical for osteoblast activity in adult animals, we examined mesenchymal stem cells from the bone marrow of one month-old wild-type and (exon 15&16)CKO/CKO mice. To test the differentiation potential of these mesenchymal stem cells into osteoblasts, we expanded these cells in vitro to near 100% confluency, switched to osteogenic medium for two weeks, then stained for ALP-positive osteoblasts. As shown in Fig. 3a, mesenchymal stem cells from wild-type mice readily differentiated into ALP-positive osteoblasts in osteogenic medium, whereas only a few ESET-deficient mesenchymal stem cells became ALP-positive osteoblasts under identical culture conditions. To examine whether these ALP-positive osteoblasts could eventually deposit minerals, these cells were cultured in osteogenic medium for an additional week, then stained with alizarin red to detect calcium deposition in the extracellular matrix. As shown in Fig. 3b, wild-type osteoblasts indeed formed distinct foci of calcium deposits, whereas ESET-deficient osteoblasts failed to do so.

Fig. 3. Impaired osteogenic potential in ESET-deficient mesenchymal stem cells.

Fig. 3

a, mesenchymal stem cells isolated from the bone barrow of one month-old wild-type and (exon 15&16)CKO/CKO littermate were cultured in osteogenic medium for two weeks, then stained for alkaline phosphatase activity (red). b, mesenchymal stem cells from one month-old wild-type and (exon 15&16)CKO/CKO littermate were cultured in osteogenic medium for three weeks, then stained with alizarin red for detection of calcium deposit (red). Representative areas in the wells are enlarged for more details in the corresponding lower panels. Scale bar: 400 μm.

ESET represses Runx2-mediated gene transactivation

We have provided both in vivo and in vitro evidence that ESET is critical to the differentiation of osteoblasts in the long bones. As a histone methyltransferase, ESET is known to interact with transcription factors such as Runx2 [5, 12]. Even though Runx2 is required for osteoblast differentiation during embryonic development, transgenic over-expression of Runx2 in osteoblasts inhibits osteoblast maturation and causes osteopenia and spontaneous fractures [11, 13]. Since a proper level of Runx2 protein is critical to postnatal bone development, we reasoned that a subset of the ESET protein may normally bind to and inhibit Runx2 activity. Deletion of ESET therefore eliminates such an inhibition and may cause an oversupply of Runx2 and an aberrant gene expression program that disrupts postnatal bone development.

To test such a possibility, we transfected mouse mesenchymal cell line C3H10T1/2 with the pOG2-Luc reporter containing three copies of Runx2 binding site within the murine osteocalcin gene 2 (mOG2) [10]. Since C3H10T1/2 cells normally do not express Runx2, co-transfection with Runx2 plasmid activated the pOG2-Luc reporter by more than 7-fold in the luciferase assay (Fig. 4a). When Runx2 and ESET plasmids were co-transfected into these C3H10T1/2 cells, Runx2 activation of mOG2-Luc reporter was significantly repressed. To investigate whether this repression of Runx2 activity by ESET is mediated through its intrinsic histone methyltransferase activity, we cotransfected Runx2 with the ESET(C1243T) mutant that replaces the highly conserved cysteine at 1243 with threonine within the SET domain to inactivate its histone methyltransferase activity [2]. We found that the ESET(C1243T) mutant is less efficient in repressing Runx2-mediated transactivation of the reporter gene.

Fig. 4. Repression of Runx2-mediated reporter gene activation by ESET.

Fig. 4

a, Diagram of the mOG2-Luc reporter used in transfection of C3H10T1/2 cells is shown at the top. Total amount of DNA in each transfection was kept constant by the addition of empty vector DNA, and asterisks indicate significance of luciferase reporter activities between plasmid combinations (*p=0.004; **p<0.001; ***p=0.003). b, Diagram of the doxycycline (Dox)-inducible siRNA construct is shown on the top. Time-dependent siRNA knockdown of ESET was assessed by western blotting with an anti-ESET antibody. c, ATDC5 cells harboring Dox-inducible control siRNA vector (columns 1-2) or Dox-inducible specific siRNA vector (columns 3-4) were transfected with the Runx2-responsive mOG2-Luc reporter. Note that cells in columns 2 and 4 were already cultured in Dox medium for at least 7 days prior to transfection, and kept in Dox medium after transfection. Asterisks indicate significance of luciferase reporter activities between cells cultured in medium with or without Dox (*p=0.65; **p<0.01).

To further investigate the ESET-Runx2 interaction, we constructed a lentiviral vector to infect the mouse mesenchymal progenitor cell line ATDC5 for doxycyclineinducible ESET knockdown by siRNA (Fig. 4b). Unlike C3H10T1/2 cells used above, these ATDC5 cells do express the Runx2 gene and therefore can be used as a platform to investigate the effects of ESET depletion on endogenous Runx2 protein. After transfection with mOG2-Luc reporter that is sensitive to Runx2 protein, luciferase activity did not change in ATDC5 cells that harbor the control siRNA construct regardless of doxycycline treatment (Fig. 4c, top panel, compare columns 1 and 2). In similarly transfected ATDC5 cells that harbor a specific siRNA construct against ESET, however, doxycycline treatment resulted in a 2.5-fold increase in luciferase activity (Fig. 4c, top panel, compare columns 3 and 4). As doxycycline-induced siRNA knockdown of ESET did not affect Runx2 protein levels in these transfected cells (Fig. 4c, bottom panels, compare lanes 3 and 4), an increase in luciferase reporter activity likely reflects a scenario in which ESET normally associates with Runx2 to repress its transactivation activity. These new findings, together with our previously published results [5], suggest that when ESET histone methyltransferase activity is absent in mesenchymal cells (either through gene knockout or through siRNA knockdown), Runx2-mediated gene activation becomes more efficient and detrimental to osteoblastic differentiation.

ESET knockout disrupts Ihh expression in postnatal growth plates

The severe impairment of osteoblast differentiation in (exon 15&16)CKO/CKO mice also suggested an effect of ESET knockout on other key regulators of osteogenesis. We noticed that mesenchymal deletion of ESET and chondrocyte-specific knockout of Ihh in postnatal mice share many similar skeletal defects [14]. These include ectopic hypertrophy of chondrocytes in the growth plate, premature fusion of epiphyseal plates in various endochondral bones, and defective trabecular bone formation. To investigate whether mesenchymal deletion of ESET influences expression of the Ihh gene in postnatal growth plates, we carried out immunohistostaining of proximal tibia from 7 day-old mice with a rabbit polyclonal anti-Ihh antibody. As shown in Fig. 5 (top panel), a high level of Ihh expression was indeed detected in hypertrophic chondrocytes within the growth plate of wild-type tibia. Within the comparable tibia region in the mutant (exon 15&16)CKO/CKO littermate, however, Ihh expression was severely repressed and Ihh protein was almost undetectable (Fig. 5, bottom panel).

Fig. 5. Disruption of Ihh expression in the growth plate by ESET knockout.

Fig. 5

Sections of proximal tibia from 7 day-old mice were stained by H&E to show cell morphology, by an anti-Ihh antibody to show the presence of Ihh protein in hypertrophic chondrocytes. Co-staining with DAPI was used to show distribution of nuclei within the growth plate. Expected regions of Ihh expression are marked by dotted lines. Genotypes are indicated on the side. Scale bar: 100 μm.

DISCUSSION

In this study we have provided both in vivo and in vitro evidence that osteoblastic differentiation and trabecular bone formation requires a functional ESET protein, a histone enzyme that methylates H3-K9. In eukaryotic cells, an evolutionarily conserved SET domain in a protein implicates its histone methyltransferase activity, and a group of SET domain-containing proteins (Suv39h, G9a, GLP and ESET) are responsible for specific methylation of H3-K9 [1]. Even though Suv39h, G9a and GLP are ubiquitously expressed and methylate the same H3-K9 residue as ESET, their knockout studies have not revealed significant changes in bone phenotype [15]. In contrast, our current study shows that ESET protein is specifically required for differentiation of mesenchymal cells into osteoblasts.

The critical role of ESET in bone formation and maintenance appears to be related to its unique protein-protein interaction profile. ESET was originally cloned as a protein that associates with the transcription factor ERG [2]. In subsequent studies, ESET has been reported to associate with other transcription factors/chromatin modification enzymes such as Runx2 and HDAC1/2 [5, 12]. As we showed here, ESET likely functions as a repressor of Runx2-mediated gene transactivation, and mutant ESET without its intrinsic methyltransferase activity is less efficient in such repression. Thus, the physical and functional interaction between ESET and Runx2 is of special significance to bone formation.

Runx2 is known as a transcription factor indispensable for osteoblast differentiation during skeletal development in embryos [16]. In postnatal development, however, transgenic over-expression of Runx2 in cells of the osteoblastic lineage leads to defective osteoblast maturation and osteopenia [11, 13]. Therefore, a proper level of Runx2 protein is critical to normal bone formation and maintenance. In light of these findings, we speculate that the transactivating ability of Runx2 is tightly regulated by ESET histone methyltransferase and by its associated histone enzymes. In ESET-deficient mesenchymal cells, Runx2 is no longer under such a precise control, which leads to over-expression of genes that impairs osteoblastic differentiation of mesenchymal cells.

Through in vitro osteogenesis assays using mesenchymal stem cells isolated from the bone marrow, we clearly demonstrated that ESET knockout impairs the ability of mesenchymal stem cells to differentiate into osteoblasts. This osteogenic defect is most likely a direct result of ESET deficiency in mesenchymal stem cells, and is in agreement with a previous report showing that siRNA knockdown of ESET inhibits osteogenic differentiation in the pluripotent mesenchymal line ST2 [17]. However, we cannot rule out the possibility that mesenchymal stem cells in (exon 15&16)CKO/CKO mice may, as a result of ectopic chondrocyte hypertrophy and altered matrix composition, fail to differentiate into osteoblasts due to permanent reprogramming in a microenvironment that is non-conducive to osteogenesis.

Highlights.

  • Knockout of ESET histone methyltransferase causes bone defects in mice

  • ESET knockout impairs osteoblast differentiation in vitro

  • ESET co-transfection inhibits Runx2-mediated reporter gene activation

  • ESET siRNA knockdown increases Runx2-mediated reporter gene expression

  • ESET knockout correlates with postnatal repression of Indian hedgehog gene

ACKNOWLEDGEMENT

We thank Dr. Y. Shinkai for frozen mouse embryos harboring (exon 15 & 16)-floxed ESET allele, Dr. J. J. Westendorf for pOG2-Luc, Dr. G. Karsenty for pCMV-HARunx2 plasmid, S. L. Carey for assistance in mouse breeding, and Dr. Roberto Nicosia's lab for assistance in image acquisition. This work is supported in part by NIH grant RO1 AR051455 (to L.Y.), and by a VA Merit Review Award from the U.S. Department of Veterans Affairs, Office of Research and Development Biomedical Laboratory Research Program (to H.A.C.).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

REFERENCES

  • 1.Kouzarides T. SnapShot: Histone-modifying enzymes. Cell. 2007;131:822. doi: 10.1016/j.cell.2007.11.005. [DOI] [PubMed] [Google Scholar]
  • 2.Yang L, Xia L, Wu DY, Wang H, Chansky HA, Schubach WH, Hickstein DD, Zhang Y. Molecular cloning of ESET, a novel histone H3-specific methyltransferase that interacts with ERG transcription factor. Oncogene. 2002;21:148–152. doi: 10.1038/sj.onc.1204998. [DOI] [PubMed] [Google Scholar]
  • 3.Blackburn ML, Chansky HA, Zielinska-Kwiatkowska A, Matsui Y, Yang L. Genomic structure and expression of the mouse ESET gene encoding an ERG-associated histone methyltransferase with a SET domain. Biochim Biophys Acta. 2003;1629:8–14. doi: 10.1016/s0167-4781(03)00155-6. [DOI] [PubMed] [Google Scholar]
  • 4.Dodge JE, Kang YK, Beppu H, Lei H, Li E. Histone H3-K9 methyltransferase ESET is essential for early development. Mol Cell Biol. 2004;24:2478–2486. doi: 10.1128/MCB.24.6.2478-2486.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Yang L, Lawson KA, Teteak CJ, Zou J, Hacquebord J, Patterson DP, Ghatan AC, Mei Q, Zielinska-Kiatkowska A, Bain SD, Fernandes RJ, Chansky HA. ESET histone methyltransferase is essential to hypertrophic differentiation of growth plate chondrocytes and formation of epiphyseal plates. Dev Biol. 2013;380:99–110. doi: 10.1016/j.ydbio.2013.04.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Tan SL, Nishi M, Ohtsuka T, Matsui T, Takemoto K, Kamio-Miura A, Aburatani H, Shinkai Y, Kageyama R. Essential roles of the histone methyltransferase ESET in the epigenetic control of neural progenitor cells during development. Development. 2012;139:3806–3816. doi: 10.1242/dev.082198. [DOI] [PubMed] [Google Scholar]
  • 7.Miao D, Scutt A. Histochemical localization of alkaline phosphatase activity in decalcified bone and cartilage. J Histochem Cytochem. 2002;50:333–340. doi: 10.1177/002215540205000305. [DOI] [PubMed] [Google Scholar]
  • 8.Soleimani M, Nadri S. A protocol for isolation and culture of mesenchymal stem cells from mouse bone marrow. Nat Protoc. 2009;4:102–106. doi: 10.1038/nprot.2008.221. [DOI] [PubMed] [Google Scholar]
  • 9.Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Proc Natl Acad Sci U S A. 2006;103:13759–13764. doi: 10.1073/pnas.0606179103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Schroeder TM, Kahler RA, Li X, Westendorf JJ. Histone deacetylase 3 interacts with runx2 to repress the osteocalcin promoter and regulate osteoblast differentiation. J Biol Chem. 2004;279:41998–42007. doi: 10.1074/jbc.M403702200. [DOI] [PubMed] [Google Scholar]
  • 11.Liu W, Toyosawa S, Furuichi T, Kanatani N, Yoshida C, Liu Y, Himeno M, Narai S, Yamaguchi A, Komori T. Overexpression of Cbfa1 in osteoblasts inhibits osteoblast maturation and causes osteopenia with multiple fractures. J Cell Biol. 2001;155:157–166. doi: 10.1083/jcb.200105052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Yang L, Mei Q, Zielinska-Kwiatkowska A, Matsui Y, Blackburn ML, Benedetti D, Krumm AA, Taborsky GJ, Jr., Chansky HA. An ERG (ets-related gene)-associated histone methyltransferase interacts with histone deacetylases 1/2 and transcription co-repressors mSin3A/B. Biochem J. 2003;369:651–657. doi: 10.1042/BJ20020854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Geoffroy V, Kneissel M, Fournier B, Boyde A, Matthias P. High bone resorption in adult aging transgenic mice overexpressing cbfa1/runx2 in cells of the osteoblastic lineage. Mol Cell Biol. 2002;22:6222–6233. doi: 10.1128/MCB.22.17.6222-6233.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Maeda Y, Nakamura E, Nguyen MT, Suva LJ, Swain FL, Razzaque MS, Mackem S, Lanske B. Indian Hedgehog produced by postnatal chondrocytes is essential for maintaining a growth plate and trabecular bone. Proc Natl Acad Sci U S A. 2007;104:6382–6387. doi: 10.1073/pnas.0608449104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Tachibana M, Ueda J, Fukuda M, Takeda N, Ohta T, Iwanari H, Sakihama T, Kodama T, Hamakubo T, Shinkai Y. Histone methyltransferases G9a and GLP form heteromeric complexes and are both crucial for methylation of euchromatin at H3-K9. Genes Dev. 2005;19:815–826. doi: 10.1101/gad.1284005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Jensen ED, Schroeder TM, Bailey J, Gopalakrishnan R, Westendorf JJ. Histone deacetylase 7 associates with Runx2 and represses its activity during osteoblast maturation in a deacetylation-independent manner. J Bone Miner Res. 2008;23:361–372. doi: 10.1359/JBMR.071104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Takada I, Mihara M, Suzawa M, Ohtake F, Kobayashi S, Igarashi M, Youn MY, Takeyama K, Nakamura T, Mezaki Y, Takezawa S, Yogiashi Y, Kitagawa H, Yamada G, Takada S, Minami Y, Shibuya H, Matsumoto K, Kato S. A histone lysine methyltransferase activated by non- canonical Wnt signalling suppresses PPAR-gamma transactivation. Nat Cell Biol. 2007;9:1273–1285. doi: 10.1038/ncb1647. [DOI] [PubMed] [Google Scholar]

RESOURCES