Skip to main content
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 2013 Aug 6;173(3):523–535. doi: 10.1111/cei.12139

S100A9 promotes human lung fibroblast cells activation through receptor for advanced glycation end-product-mediated extracellular-regulated kinase 1/2, mitogen-activated protein-kinase and nuclear factor-κB-dependent pathways

X Xu *,§,1, H Chen *,§,1, X Zhu *,§, Y Ma ‡, Q Liu ‡, Y Xue *,§, H Chu ‡, W Wu †, J Wang ‡,§, H Zou *,§,1
PMCID: PMC3949640  PMID: 23682982

Abstract

S100A9 belongs to the S100 family of calcium-binding proteins and plays a key role in many inflammatory conditions. Recent studies have found that S100A9 was elevated significantly in the bronchoalveolar lavage fluid of idiopathic pulmonary fibrosis patients, and might be a biomarker for fibrotic interstitial lung diseases. However, the exact function of S100A9 in pulmonary fibrosis needs further studies. We performed this study to investigate the effect of S100A9 on human embryo lung fibroblast (HLF) proliferation and production of cytokines and collagen, providing new insights into the possible mechanism. S100A9 promoted proliferation of fibroblasts and up-regulated expression of both proinflammatory cytokines interleukin (IL)-6, IL-8, IL-1β and collagen type III. S100A9 also induced HLF cells to produce α-smooth muscle actin (α-SMA) and receptor for advanced glycation end-product (RAGE). In addition, S100A9 caused a significant increase in extracellular-regulated kinase (ERK)1/2 mitogen-activated protein kinase (MAPK) phosphorylation, while the status of p38 and c-Jun N-terminal kinase (JNK) phosphorylation remained unchanged. Treatment of cells with S100A9 also enhanced nuclear factor kappa B (NF-κB) activation. RAGE blocking antibody pretreatment inhibited the S100A9-induced cell proliferation, cytokine production and pathway phosphorylation. S100A9-mediated cell activation was suppressed significantly by ERK1/2 MAPK inhibitor and NF-κB inhibitor. In conclusion, S100A9 promoted HLF cell growth and induced cells to secret proinflammatory cytokines and collagen through RAGE signalling and activation of ERK1/2 MAPK and NF-κB pathways.

Keywords: ERK1/2, human fetal lung fibroblasts, inflammation, lung fibrosis, NF-κB, RAGE, S100A9

Introduction

Pulmonary fibrosis is an extremely common end-stage pathological manifestation of several diseases, including systemic sclerosis, idiopathic pulmonary fibrosis (IPF), pulmonary hypertension characterized by inflammation, fibroblast proliferation and excessive collagen and other extracellular matrix (ECM) deposition. It is characterized by a chronic and progressive course leading to respiratory failure, with a poor prognosis [1]. Currently, there is no effective treatment available, as pulmonary transplantation remains the only viable option. Although the pathogenesis underlying pulmonary fibrosis has been studied widely, the exact molecular mechanisms remain obscure.

S100 calcium-binding proteins are highly conserved, low-molecular-weight proteins with important regulatory functions in calcium buffering, regulation of kinases and phosphatases, cell proliferation, differentiation, energy metabolism, cytoskeletal–membrane interactions and inflammation [2, 3]. This protein family is characterized by the presence of two Ca2+-binding sites of the EF-hand type [4]. S100A9, one member of the S100 proteins, is also named myeloid-related protein (MRP)-14 and calgranulin B. S100A9 protein is expressed constitutively in cells of the myelomonocytic lineage [5]. It is present at high concentrations in the cytoplasm of neutrophils and monocytes, but also in macrophages, epithelial cells and endothelial cells in response to inflammatory conditions. It has been confirmed that S100A9 and other members of this group are chemotactic for neutrophils, induce their adhesion to endothelium and increase transendothelial migration [6]. They also induce inflammatory cell secretion of cytokines and chemokines, and thus initiation and amplification of inflammation [7]. Recently, S100A9 was found to be notably elevated in the serum, synovial fluid, stool or other inflammatory sites of patients suffering from rheumatoid arthritis [8], chronic inflammatory lung [9], Crohn's disease [10], giant cell arteritis [11] and dermatomyositis [12], indicating that this cytokine could serve as an excellent diagnostic biomarker for inflammatory conditions.

Therefore, S100A9 seems to be a predominant molecule in the inflammation process. However, apart from a proinflammatory function, several recent studies have reported that S100A9 may also be associated with fibrotic response in interstitial lung diseases (ILD). Korthagen [13] demonstrated that the bronchoalveolar lavage fluid (BALF) levels of S100A9 were elevated significantly in IPF and sarcoidosis patients compared to controls. Increased expression of S100A9 levels in BALF was reported in patients with IPF compared with other fibrotic interstitial pneumonias, suggestive of S100A9 as a candidate biomarker to discriminate between IPF and other interstitial pneumonias [14]. Bargagli et al. [15] found that calgranulin B concentrations were higher in patients with IPF than controls and correlated directly with neutrophil and eosinophil percentages in BALF. In addition, calgranulin B was found to be up-regulated in BALF of systemic sclerosis (SSc) patients with lung fibrosis compared to patients without pulmonary fibrosis [16]. All these studies indicate that S100A9 might be correlated closely with the development of pulmonary fibrosis. However, there are no precise data concerning its mechanism in interstitial lung diseases, which prompted us to explore its potential involvement in these fibrotic lung disorders.

The role of fibroblasts in pulmonary fibrosis process has been studied extensively, and these cells are considered to be responsible for excessive collagen and other ECM synthesis and deposition that occur in lung fibrosis; therefore, these cells play a pivotal role in the pathogenesis of pulmonary fibrosis [17, 18]. In our present study, we focused on human embryo lung fibroblasts (HLF) and used in-vitro studies of HLF cells to evaluate the contribution of S100A9 on the proliferation and activation of fibroblasts, and exploring further the S100A9 signalling pathway in HLF cells.

Materials and methods

Cell culture

Immortalized human fetal lung fibroblast cell lines were obtained from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences (Shanghai, China). The cells were passaged in Dulbecco's modified Eagle's medium (DMEM) containing 100 U/ml penicillin and 100 μg/ml streptomycin, and 10% fetal bovine serum (FBS). The cells were incubated at 37°C in a humidified atmosphere of 5% CO2 and 95% air. HLF cells were maintained under logarithmic growth conditions.

Antibodies and reagents

Human recombinant S100A9 was obtained from Abcam (Hong Kong). This protein was purified using conventional chromatography techniques and the purity of S100A9 protein was greater than 90% by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) (Supporting information, Fig. S1). The endotoxin content was measured using an endotoxin-specific assay kit; the endotoxin levels were approximately 1 EU/μg, and 1 μg/ml solutions of recombinant S100A9 used in this study contained endotoxin at 0·1 ng/ml (according to the instructions). The cell culture medium was purchased from Gibco (Life Technologies/Gibco, Grand Island, NY, USA). The receptor for advanced glycation end-product (RAGE) blocking antibody and Toll-like receptor (TLR)-4 blocking antibody were purchased from Abcam. The extracellular-regulated kinase (ERK)1/2 inhibitor PD98059, p38 inhibitor SB203580, nuclear factor (NF)-κB inhibitor BAY11-7082 and polymyxin B were obtained from Sigma-Aldrich (St Louis, MO, USA). Rabbit polyclonal anti-human α-smooth muscle actin (SMA) from Epitomics (Burlingame, CA, USA), rabbit polyclonal anti-human RAGE from Abgent (San Diego, CA, USA), the phospho-mitogen-activated protein kinase (MAPK) family antibody kit from Cell Signaling Technology (Danvers, MA, USA) and the NF-κB family antibody kit were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Cell proliferation assay (CCK8-and bromodeoxyuridine (BrdU) assay)

HLF cells were inoculated at a density of 3000 cells per well into 96-well plates. Cells were then starved in medium without FBS for 24 h and various concentrations of S100A9 in 1% FBS medium were added for different time-intervals, as indicated. Human transforming growth factor (TGF)-β (10 ng/ml) was used as positive control for cell proliferation. Control cells were incubated in the presence of vehicle only. In the blocking studies, cells were pretreated for 1 h with specific antibodies or inhibitors before stimulation with S100A9. Cell viability was determined using a Cell Counting Kit (CCK)-8 (Dojindo, Japan), as described previously [19]. After the indicated post-treatment incubation time, 10 μl CCK-8 was added to each well for 3 h after which the optical density (OD) was measured at 450 nm with a multi-well plate reader (Bio-Rad, Richmond, CA, USA). The percentage cell viability was calculated using the equation: ratio (%) = [OD (treatment) − OD (blank)/OD (control) − OD (blank)] × 100. For confirmation, BrdU proliferation assay (BD Biosciences, San Jose, CA, USA) was performed according to the manufacturer's instructions. The stained cells were analysed in a fluorescence activated cell sorter (FACS)Canto (BD Biosciences).

Real-time quantitative polymerase chain reaction (PCR) analysis

HLF cells were adjusted at a density of 1 × 105 cells per cm2 in culture medium and incubated with S100A9 for the time indicated and then lysed with Trizol. Complementary single-stranded DNA was synthesized from total RNA by reverse transcription (TaKaRa, Shiga, Japan). Real-time PCR was performed using SYBR Green master mix (TaKaRa). Quantification of cDNA targets was performed using an ABI Prism 7500HT Sequence Detection System (Applied Biosystems, Foster City, CA, USA). Primer pairs are shown in Table 1. Optimal reaction conditions for amplification of the target genes were performed according to the manufacturer's recommendations. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control. Each experiment was performed in duplicate and repeated independently at least three times.

Table 1.

Primers used for real-time RT-PCR

Gene Forward primer Reverse primer Product (bp)
IL-6 GGATTCAATGAGGAGACTTGCC ACAGCTCTGGCTTGTTCCTCAC 116
IL-8 AAGCTGGCCGTGGCTCTCTTG AGCCCTCTTCAAAAACTTCTC 279
IL-1β CATTGCTCAAGTGTCTGAAGCA CTGGAAGGAGCACTTCATCTGTT 136
HMGB1 AATACGAAAAGGATATTGCT GCGCTAGAACCAACTTAT 169
COL1α1 CATCTGGTGGTGAGACTTGC TCCTGGTTTCTCCTTTGG 83
COL1α2 AAGGTCATGCTGGTCTTGCT GACCCTGTTCACCTTTTCCA 114
COL3α1 GTCCCAGCGGTTCTCCA CCCCGTGCTCCAGTGAT 190
Fibronectin CTGAATCTGTGACCGAAAT GGTACTGTGGCTCATCTCC 123
α-SMA GGGGTGATGGTGGGAATG GCAGGGTGGGATGCTCTT 190
RAGE GACCAAGTCCAACTACCGAGTC TGGGAACACCAGCCGTGA 92
GAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC 226

IL: interleukin; HMGB: high migration group box; COL: collagen; SMA: smooth muscle actin; RAGE: receptor for advanced glycation end-product; GAPDH: glyceraldehyde 3-phosphate dehydrogenase; bp: base pairs.

Preparation of nuclear and cytoplasmic extracts

Nuclear extracts were prepared as described previously [20]. Cells were treated with or without 100 ng/ml S100A9 for the indicated time-intervals, harvested and then suspended in hypotonic buffer A [10 mM HEPES, pH 7·6, 10 mM KCl, 1 mM dithiothreitol (DTT), 0·1 mM ethylenediamine tetraacetic acid (EDTA) and 0·5 mM phenylmethylsulphonyl fluoride] for 10 min on ice and vortexed for 10 s. Nuclei were pelleted by centrifugation at 12 000 g for 5 min. The supernatants containing cytosolic proteins were collected. A pellet containing nuclei was suspended in buffer C (20 mM HEPES, pH 7·6, 1 mM EDTA, 1 mM DTT, 0·5 mM phenylmethylsulphonyl fluoride, 25% glycerol, and 0·4 M NaCl) for 30 min on ice with intermittent vortex for 30 s. The supernatants containing nuclei proteins were collected by centrifugation at 12 000 g for 10 min and stored at −80°C.

Western blots

RAGE expression was analysed by Western blot. The same method [21] was used to detect α-SMA, p-65, I-κB, p38 MAPK, ERK1/2 MAPK, c-Jun N-terminal kinase (JNK), phospho-p38 MAPK, phospho-ERK1/2 MAPK and phospho-JNK in HLF cells that had been treated with or without S100A9. Cell lysates were prepared at different time-points after treatment. Briefly, the harvested cells were washed twice with cold phosphate-buffered saline (PBS) and resuspended for 30 min on ice in radio immunoprecipitation assay (RIPA) buffer. After vigorous pipetting, cell lysates were centrifuged at 11 000 g for 15 min at 4°C. Supernatants were collected and stored at −80°C. The protein concentration in each sample was determined by bicinchoninic acid (BCA) protein assay reagents (Pierce, Rockford, IL, USA). Cell lysates containing equal amounts of protein (30 μg) were boiled in an SDS sample buffer and analysed by SDS-PAGE. The separated proteins in the gel were then transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were blocked in 5% non-fat dried milk and incubated overnight with the primary antibodies at 4°C. The membranes were washed three times each for 10 min with Tris-buffered saline containing 0·1% Tween-20, and then incubated at room temperature for 1 h with the relevant secondary antibodies conjugated with horseradish peroxidase (HRP)-conjugated immunoglobulin (Ig)G (Jackson-Immuno, West Grove, PA, USA). The reaction products were visualized with an enhanced chemiluminescence (ECL) Western blotting detection system (Amersham Biosciences, Little Chalfont, UK) and a luminoimage analyser (LAS-3000 plus; Fuji Photo Film, Tokyo, Japan). Blots were quantified by densitometry and normalized using β-actin or GAPDH to correct for differences in loading the proteins.

Flow cytometric analysis

HLF cells were incubated with or without S100A9 for 24 h and were then incubated for 1 h with either rabbit anti-human RAGE antibody or fluorescein isothiocyanate (FITC) isotype control antibody and stained with FITC-conjugated goat anti-rabbit IgG antibody for 30 min. The stained cells were analysed in a FACSCanto (BD Biosciences). The data were analysed using CellQuest software (BD Biosciences).

Enzyme-linked immunosorbent assay (ELISA)

HLF cells were pretreated for 60 min with specific antibodies or inhibitors prior to stimulation with 100 ng/ml S100A9 or 100 ng/ml lipopolysaccharide (LPS) alone. The cell culture supernatants were harvested after 24 h and stored at −80°C for bulk analysis. ELISA kits for IL-6, IL-8, IL-1β and high migration group box (HMGB) 1 (R&D Systems, Minneapolis, MN, USA) were used to detect the cytokine levels in supernatants. All measurements were performed according to the manufacturer's guidelines. Each sample was tested in duplicate.

Immunofluorescence microscopy

HLF cells were exposed to nature S100A9 or boiled S100A9 with or without polymyxin B or TLR-4 blocking antibody for the indicated time. The cells on culture slides were fixed with 4% paraformaldehyde and permeabilized with 0·2% Triton X-100, and then blocked with 5% bovine serum albumin (BSA) in PBS. The cells were incubated with a rabbit anti-NF-kB p65 antibody (1:100) for 1 h, washed with PBS and then stained for 1 h with rhodamine-conjugated anti-rabbit antibody (1:200; Invitrogen, Carlsbad, CA, USA). Subsequent to washing with PBS, nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (5 min, 0·1 mM; Invitrogen). The slides were mounted using 1,4-diazobizyclo(2,2,2)octane (DABCO) anti-fade mounting medium and then examined under a Nikon 80i fluorescence microscope.

Statistical analysis

The results were expressed as means ± standard deviation (s.d.). The significant between-group differences were analysed using Student's t-test or one-way analysis of variance (anova); spss version 16.0 was used for statistical analysis. A P-value < 0·05 was considered significant.

Results

Induction of HLF cells proliferation by S100A9

To investigate the influence of S100A9 on cell proliferation, HLF cells were starved in DMEM medium for 24 h followed by treatment with S100A9, ranging from 0 to 1000 ng/ml for different time-points, until the cell cultures were confluent. As shown in Fig. 1, S100A9 exerted a distinct activity on HLF cells and increased the proliferation rate of HLF cells to that of control (P < 0·05) within 96 h. S100A9 from 10 ng/ml to 500 ng/ml induced significant cell growth in a concentration-and time-dependent manner (P < 0·05). Effects were noted with 100 ng/ml S100A9 (12 ± 3% of control, P < 0·05) at 12 h (Fig. 1a), and maximal effects (54 ± 12% of control, P < 0·01) were observed with 500 ng/ml S100A9 at 72 h. However, the growth-promoting activity of S100A9 reached a plateau or decreased at concentrations of 1000 ng/ml and incubation periods of 96 h. Higher S10A9 protein concentrations did not increase cell proliferation if treatment was extended to 72 h (data not shown). TGF-β was used as a positive control and the maximal proliferation rate of HLF cells induced by TGF-β was 60 ± 15% of control. The data were confirmed using the BrdU incorporation assay. S100A9 clearly increased the incorporation of BrdU in cells at 24 h in a dose-dependent manner, and a similar effect of TGF-β was observed (Fig. 1b). According to our results and a previous study [22], we chose a 100 ng/ml concentration of S100A9 as the optimal dose in the following experiments.

Figure 1.

Figure 1

Growth-stimulating effect of S100A9 on human embryo lung fibroblast (HLF) cells. (a) Cells were plated at an equal density and treated with various concentrations of S100A9 (0∼1000 ng/ml) or 10 ng/ml transforming growth factor (TGF)-β in the presence of 1% fetal bovine serum (FBS) for 12∼96 h, and proliferation was assessed by cell counting kit (CCK)-8 assay. The relative ratios of cell proliferation were expressed as a percentage of the control cells (12 h) and represent the mean ± standard deviation of triplicate independent measurements. (b) Cells were treated with S100A9 (10∼1000 ng/ml) or 10 ng/ml TGF-β for 24 h, and DNA synthesis was assessed by bromodeoxyuridine (BrdU) incorporation assays. Representative histograms showed BrdU expression and the percentage of BrdU-positive cells in all groups was obtained in three independent subjects. *P < 0·05; **P < 0·01 versus unstimulated control cells.

Proinflammatory cytokine production in HLF after S100A9 stimulation

As reported, S100A9 stimulated production of various proinflammatory cytokines in epithelial cells, chondrocytes or synoviocytes [23–;24]. Thus, we postulated that in-vitro S100A9 might also be able to induce fibroblasts to secret cytokines. To verify this assumption, HLF cells were stimulated with S100A9 and the mRNA levels of cytokines IL-6, IL-8, IL-1β and HMGB1 were determined using real-time PCR after 0, 1, 3, 6, 12 and 24 h. ELISA was employed to measure the cytokine concentrations in the culture supernatants. There was a 5–10-fold increase in the mRNA expression of IL-6, IL-8 and IL-1β exposed to 100 ng/ml S100A9 compared to controls, and the cytokine mRNA expression reached a peak at 6 h (Fig. 2a–d). Moreover, measurement of the corresponding protein levels in culture supernatants showed that S100A9 strongly up-regulated the secretion of IL-6, IL-8 and IL-1β (sevenfold, fourfold and fivefold, respectively) by HLF cells (Fig. 2e). S100A9 treatment did not induce the release of HMGB1 from HLF cells, either at the mRNA or protein levels. These results indicate that S100A9 is critical in activating lung fibroblast and enhancing secretion of proinflammatory cytokines in lung fibroblast.

Figure 2.

Figure 2

Effects of S100A9 on cytokine expression in human embryo lung fibroblast (HLF) cells. HLF suspensions cells were incubated with or without 100 ng/ml S100A9 for 0∼24 h. The levels of mRNA for the cytokines interleukin (IL)-6 (a), IL-8 (b), IL-1β (c) and high migration group box (HMGB)1 (d) were determined using real-time polymerase chain reaction (PCR). (e) Culture supernatants were harvested 24 h later and cytokine total proteins in the supernatants were measured by enzyme-linked immunosorbent assay (ELISA). The mean values ± standard deviation were averages of triplicate experiments. *P < 0·05; **P < 0·01 versus non-S100A9-treated cells.

Up-regulation of α-SMA and RAGE expression by S100A9

S100A9 has been proved to have a potent proinflammatory function. However, very little is known about the ability of S100A9 to produce collagens and non-collagenous ECM components in fibroblasts. To understand this issue, HLF cells were cultured in the presence of S100A9 for 24 h. The collagen type III relative mRNA level in cells was up-regulated significantly after exposure to S100A9 (about 2·1-fold), but not collagen type I or fibronectin mRNA levels (Fig. 3a). We further examined whether or not S100A9 could influence the expression of α-SMA, which is a marker for myofibroblasts. As illustrated in Fig. 3a,b, S100A9 induced a 3·2-fold increase in mRNA amounts for α-SMA and protein levels of α-SMA were also elevated compared to the control. Thus, S100A9 stimulation of HLF cells increased gene expression of type III collagen and up-regulated α-SMA expression at both the mRNA and protein levels.

Figure 3.

Figure 3

S100A9 induced changes of extracellular matrix (ECM), α-smooth muscle actin (SMA) and receptor for advanced glycation end-product (RAGE) expression in human embryo lung fibroblast (HLF) cells. (a) Cells were incubated with or without 100 ng/ml S100A9 and fold changes compared with unstimulated cultures in gene expression of collagen type I (Col 1α1) and Col 1α2, Col 3α1, fibronectin (Fn), α-SMA and RAGE were measured by quantitative reverse transcription–polymerase chain reaction (qRT–PCR). Cells were stimulated with or without S100A9 for 24 h, and Western blot analysis of α-SMA (b) and RAGE (c) were performed. Data were expressed as percentage changes in protein levels relative to levels in control cells. RAGE and α-SMA protein expression was quantified using a densitometric program and normalized to that of the corresponding β-actin. (d) HLF cells were incubated with or without 100 ng/ml S100A9, and RAGE levels on the surface of cells were assessed by flow cytometric analysis. Representative histograms showed RAGE expression. The mean values ± standard deviation were averages of triplicate independent subjects. *P < 0·05 versus control cultures.

While it has been revealed that RAGE serves as a primary extracellular-membrane receptor of S100 proteins [26], this receptor has also been shown to be involved in lung fibrosis [27]. We studied the effect of S100A9 on the expression of RAGE in HLF cells. At the mRNA level, RAGE was up-regulated significantly (4·5-fold greater) in S100A9-treated HLF cells compared to control cells (Fig. 3a). Consistent with the mRNA expression changes, the level of RAGE protein was also evidently elevated in HLF cells incubated with S100A9 compared to control cultures (Fig. 3c). In agreement with the Western blot, the results from the flow cytometric analysis showed that S100A9 enhanced RAGE protein expression significantly (Fig. 3d). These data indicate that S100A9 was able to induce HLF cells to produce RAGE, possibly facilitating S100A9 interaction with fibroblasts.

Impact of S100A9 on MAP kinase and NF-κB signalling pathway

Three major mitogen-activated protein kinases (MAPKs), extracellular-regulated kinases (ERK) and p38 kinase and c-jun N-terminal kinase (JNK) cascade, have long been known to be central to the activation of cellular processes, such as proliferation, differentiation and oncogenic transformation [28, 29]. We wanted to determine whether or not this process was accompanied by an induction of MAP kinase phosphorylation in HLF cells triggered by S100A9. For this purpose, we performed a time–course stimulation of HLF cells with S100A9. S100A9 treatment induced phosphorylation of ERK1/2 MAPK rapidly (within 10 min), and a maximal increase over control levels (80% of control) was observed at 1 h (Fig. 4a). However, we failed to detect significant phosphorylation of p38 or JNK, although S100A9 induced a very weak increase in phosphorylation of p38.

Figure 4.

Figure 4

S100A9 activated extracellular-regulated kinase (ERK)1/2 mitogen-activated protein kinase (MAPK) and nuclear factor (NF)-κB pathways in human embryo lung fibroblast (HLF) cells. (a) HLF cells were treated with S100A9 (100 ng/ml) for the indicated time-points, and cell lysates were collected. Phosphorylation of ERK1/2, p38 and c-Jun N-terminal kinase (JNK) MAP kinases was analysed by Western blotting. (b) HLF cells were exposed to S100A9 (100 ng/ml) for 30 or 60 min, the levels of nuclear and cytosolic p65 and cytosolic levels of inhibitor of kappa B (IκB)-α were determined by Western blotting. The result shown was representative of the results obtained in three independent subjects. The intensity of experimental signals were normalized to β-actin loading control and then compared to control (time 0 h). (c) Cells were treated with S100A9 (100 ng/ml) for 30 or 60 min. Cells were stained with a rabbit antibody to p65 protein and with anti-rabbit second antibody. Nuclear translocation of NF-kB p65 was detected via an Nikon 80i fluorescence microscope (original magnification ×200). The mean values ± standard deviation were averages of triplicate experiments. *P < 0·05; **P < 0·01 versus control cultures.

NF-κB activation is a hallmark of RAGE engagement [30], and therefore we investigated whether or not extracellular S100A9 could activate this transcription factor. HLF cells were treated with or without S100A9 for 30 or 60 min, nuclear proteins and cytoplasmic extracts were collected and the levels of nucleus p65 and cytoplasm inhibitor of kappa B (IκB)-α were checked, respectively. The results showed that p65 subunit nuclear localization was increased in S100A9-treated HLF cells and the cytosol p65 subunit was decreased, verifying the activation of NF-κB by S100A9 (Fig. 4b). Furthermore, treating HLF cells with S100A9 also caused cytosol IκB-α degradation in a time-dependent manner. These changes in IκB-α level coincided with the changes of NF-κB levels described above. NF-kB activation was also confirmed via immunofluorescence. S100A9 treatment induced a significant nuclear translocation of p65 compared with basal conditions, with a peak at 60 min (Fig. 4c). Thus, the above results suggest that signalling through ERK1/2 MAPK and NF-κB pathways might participate in S100A9-induced cell activation.

HLF cell activation induced by S100A9 was not due to LPS contamination

To exclude the possibility that LPS was contaminated in the preparation of S100A9, HLF cells were incubated with 100 ng/ml LPS or 100 ng/ml S100A9 in the presence of polymyxin B or TLR-4 blocking antibody, and the solution containing 100 ng/ml S100A9 was boiled for 30 min at 95°C [31] and subsequently added to the cell cultures, after which the cells were incubated; the proliferation rate, the expression levels of cytokines and NF-κB p65 nuclear translocation were then determined. As shown in Fig. 5, the treatment of cells with boiled S100A9 did not affect the proliferation rate of HLF cells, whereas native S100A9 induced significant proliferation. Similarly, the inductive effect of cytokine secretion and NF-κB nuclear translocation by S100A9 disappeared as the result of boiling (Fig. 5b,c). Furthermore, polymyxin B and TLR-4 blockade did not influence the effects of S100A9 induction of proliferation, cytokine release and NF-κB activation in HLF cells (Fig. 5a–c). The same amount of LPS was used as positive control and triggered a stronger cytokine response compared to S100A9 (Fig. 5b). These data indicated that the endotoxin concentrations proved insufficient to activate HLF cells.

Figure 5.

Figure 5

The effect of S100A9 was not attributed to endotoxin contamination. Human embryo lung fibroblast (HLF) cells were exposed to medium, 10 μg/ml anti-Toll-like receptor (TLR)-4 control antibody [immunoglobulin (Ig)G)], 100 ng/ml S100A9, 100 ng/ml boiled S100A9 and S100A9 in the presence of polymyxin B (PMB) or Toll-like receptor (TLR)-4 blocking antibody, 25 μg/ml PMB, 10 μg/ml anti-TLR-4 antibody or 100 ng/ml lipopolysaccharide (LPS) and then proliferation (a) was assessed by cell counting kit (CCK)-8 assay, cytokine total proteins in the culture supernatants (b) were measured by enzyme-linked immunosorbent assay (ELISA), nuclear translocation of nuclear factor (NF)-kB p65 (c) was detected using fluorescence microscope (original magnification ×200). The mean values ± standard deviation were averages of triplicate experiments. *P < 0·05; **P < 0·01 versus control cultures.

Effects of RAGE blockade on S100A9 stimulation

To examine whether S100A9 used RAGE as a signal transducing receptor on HLF cells, the cells were stimulated by S100A9 with or without anti-RAGE antibody, and the proliferation rate, levels of cytokines in the culture supernatants and protein levels in the cell lysates were measured. The S100A9-stimulated proliferation response and cytokine induction were reduced significantly by blockade of RAGE (Fig. 6a–c). The expression levels of α-SMA, RAGE, phospho-ERK1/2 MAPK and phospho-p65 induced by S100A9 were also suppressed by treatment with the RAGE blockage antibody (Fig. 6d). Therefore, RAGE could be a candidate receptor for S100A9 signalling in HLF cells.

Figure 6.

Figure 6

S100A9-promoted cell activation was receptor for advanced glycation end-product (RAGE)-dependent. Cells were pretreated with 10 μg/ml anti-RAGE antibody or control antibody for 1 h prior to induction with S100A9. (a) Cell viability was assessed by cell counting kit (CCK)-8. (b) The fold changes of mRNA levels were measured by quantitative reverse transcription–polymerase chain reaction (qRT–PCR). (c) Culture supernatants were harvested 24 h later and cytokine total proteins in the supernatants were measured by enzyme-linked immunosorbent assay (ELISA). (d) Cell lysates were collected, and the protein levels of α-small muscle actin (SMA), RAGE, phosphorylation of extracellular-regulated kinase (ERK)1/2 and p65 were analysed by Western blot. Protein expression was quantified using a densitometric program and compared to control. The mean values ± standard deviation were averages of triplicate experiments. *P < 0·05; **P < 0·01.

Involvement of ERK1/2 and NF-κB pathway in S100A9 stimulation

To examine whether or not MAPK or NF-κB activation were involved in the S100A9-mediated cell activation, HLF cells were pretreated with the MAPK inhibitors (PD98059, SB203580) or NF-κB inhibitor (BAY 11–7082) and were then exposed to S100A9. As shown in Fig. 7a–c, the proliferation rate and inflammatory cytokine production by S100A9-stimulated cells was clearly decreased by the ERK1/2 MAPK inhibitor and NF-κB inhibitor, while it was not affected by the p38 MAPK inhibitor. Moreover, ERK1/2 MAPK and NF-κB inhibitors clearly suppressed the induction of α-SMA and RAGE by S100A9 (Fig. 7d). These data indicate that S100A9 promoted cell activation through the ERK1/2 MAPK and NF-κB pathways.

Figure 7.

Figure 7

Extracellular-regulated kinase (ERK)1/2 and nuclear factor (NF)-κB inhibitors suppressed S100A9-induced cellular proliferation and cytokines expression. Cells were incubated with S100A9 in the presence or obsence of PD98059 (50 μm) or SB203580 (10 μm) or BAY11-7082 (2 μm). (a) Cell viability was assessed by cell counting kit (CCK)-8. (b) The mRNA levels were measured by quantitative reverse transcription–polymerase chain reaction (qRT–PCR). (c) Culture supernatants were harvested 24 h later and cytokines in the supernatants were measured by enzyme-linked immunosorbent assay (ELISA). (d) Cell lysates were collected, and protein levels of α-small muscle actin (SMA) and receptor for advanced glycation end-product (RAGE) were analysed by Western blot. The intensity of each protein were normalized to β-actin loading control and then compared to control. The mean values ± standard deviation were averages of triplicate experiments. *P < 0·05; **P < 0·01.

Discussion

The present study showed that S100A9 had cell growth-promoting property and induced HLF cells production of several proinflammatory cytokines. We also found that α-SMA and RAGE expression in cells were up-regulated by S100A9. It was noted that S100A9 caused a significant increase in ERK1/2 phosphorylation, while the status of p38 and JNK/MAPK phosphorylation remained unchanged and also enhanced NF-κB activation in HLF cells. We observed further that S100A9 stimulation was suppressed significantly by RAGE-blocking antibody, ERK1/2 MAPK inhibitor and NF-κB inhibitor. Taken together, these results suggest that S100A9 can activate human lung fibroblasts through RAGE ligation and activation of the ERK1/2 MAPK and NF-κB pathways.

This is the first study to report that in-vitro human recombinant S100A9 could stimulate proliferation of human fetal lung fibroblast cells in a concentration-(10–500 ng/ml) and time-dependent manner. S100A9 also stimulated the incorporation of BrdU in fibroblasts. The growth-promoting activity of S100A9 almost equalled TGF-β (Fig. 1). A further pro-proliferation effect on HLF cells was not observed when S100A9 reached a concentration of 1000 ng/ml. The results are consistent with Shibata et al.'s findings that S100A9 stimulates the proliferation of mouse fetal fibroblasts at a concentration higher than 390 ng/ml [22, 32]. Our findings are also in agreement with a study by Ghavami et al., reporting that calprotectin (S100A8/A9), a complex form of S100A8 and S100A9, at low concentrations (protein concentrations below 25 μg/ml) promotes tumour cell growth [21]. Thus, we speculate that S100A9 has a growth-stimulating property on HLF cells.

Although the aetiology of pulmonary fibrosis has not yet been elucidated completely, numerous studies suggest that pulmonary fibrosis is characterized by prolonged inflammation that leads to an irreversible process. In this work, we found S100A9 induced both mRNA and protein expression of IL-6, IL-8 and IL-1β in HLF cells compared to control cells (Fig. 2). A large body of experimental evidence demonstrates that activated alveolar macrophages and lymphocytes secrete IL-6, IL-8 and IL-1β, which have inflammatory and fibroblast-activating characteristics, and play an important role in the maintenance of pulmonary inflammatory processes and subsequent fibrosis [33]. S100A9 is likely to contribute to the inflammatory environment in the disease via downstream cytokines IL-6, IL-8 and IL-1β. Previous studies have found that infiltration inflammatory cells such as neutrophils and macrophages are potent candidates for releasing S100A9. In addition this protein is, in turn, an important chemoattractant for inflammatory cells [34, 35]. We speculate that S100A9 could induce fibroblast secretion of proinflammatory mediators, and result in initiation and amplification of inflammation in the lung [36, 37].

Next, we determined whether or not S100A9 might have other functional roles in cells, as the data showed that the fibrogenic collagen III gene level was increased significantly in HLF cells after S100A9 treatment. It seems that S100A9 can influence collagen homeostasis in human lung fibroblasts via increasing type III collagen production. We also showed that S100A9 induced mesenchymal marker α-SMA expression, indicating that S100A9 promoted fibroblast transition to myofibroblast which, in turn, synthesized elevated levels of ECM proteins compared to original fibroblasts [38]. Therefore, S100A9 showed pro-fibrotic characteristics through inducing fibroblasts production type III collagen and transition to myofibroblasts.

RAGE is a member of the immunoglobulin superfamily of cell surface molecules which have diverse extracellular ligands, including HMGB1, advanced glycation end-products (AGE) S10012 and S100B1, and plays a potent role in innate immunity [26]. Significant similarities in structure between S100A9 and S100A12 suggest that RAGE may function as a signal-transducing receptor for S100A9. We examined whether or not RAGE ligation was responsible for S100A9-promoted cell activation. As shown in Fig. 3, the gene and protein levels of RAGE were clearly enhanced compared to the control, suggesting that S100A9 was able to induce HLF cells to produce RAGE ensuing a cycle of sustained receptor activation, facilitating S100A9 interaction with lung fibroblasts. These findings were consistent with Gebhardt et al. [39]. Furthermore, S100A9-mediated proliferation, cytokine production and α-SMA expression was inhibited markedly by anti-RAGE antibody (Fig. 6); thus, RAGE-blocking experiments provided strong evidence that RAGE is the receptor for S100A9, and RAGE-dependent signalling is involved in the cell activation of S100A9. Recent studies have found that RAGE might recognize a pro-fibrotic factor involved in ILD through induction of the epithelial–mesenchymal transition (EMT) process, facilitating the migration and adhesion of neutrophils to fibronectin and promoting fibrotic lung remodelling [27, 40]. However, another group reported that RAGE was decreased in the lungs as well as in alveolar epithelial type II cells of IPF patients, and RAGE could serve a protective role in the lung [41]. The paradoxical function of RAGE in pulmonary fibrosis needs further investigation. Given the expression of RAGE on HLF cells, we propose that extracellular S100A9 combined with lung fibroblasts via RAGE and further RAGE activation by S100A9 establishes sustained cell activation.

We then performed several experiments to exclude the possibility that endotoxin contaminates the S100A9 protein. The treatment of HLF cells with polymyxin B or TLR-4 blocking antibody did not affect S100A9-mediated HLF cell activation. However, boiled S100A9 could not induce proliferation or expression of inflammatory cytokines or NF-κB p65 nuclear translocation (Fig. 5). Therefore, S100A9 stimulation was not attributable to LPS contamination.

RAGE has been shown to transmit different signals, triggered by extracellular S100 proteins [42]. The precise signalling pathway of S100A9 in HLF cells has not yet been elucidated clearly. Our data show that S100A9 induced phosphorylation of the ERK1/2 signalling pathway, but not p38 or JNK/MAPK, in HLF cells. In addition, we observed that S100A9 enhanced NF-κB activation in stimulated HLF cells (Fig. 4). NF-κB p65 nuclear translocation studies also confirmed the NF-κB pathway phosphorylation. These findings were confirmed using specific ERK1/2 MAPK and NF-κB inhibitors. Both of the inhibitors could evidently block S100A9-mediated cell activation, while p38 MAPK inhibitor did not suppress S100A9 stimulation (Fig. 7). Based on this finding, we speculate that S100A9 affected the intracellular signalling cascade ERK1/2 and NF-κB towards the enhancement of lung fibroblast activity to produce proinflammatory cytokines and α-SMA.

However, there are some limitations to our study. Human embryo lung fibroblasts are immortalized cells and these cells are different in some aspects from primary adult human lung fibroblasts. Thus, we need to verify our results on primary human lung fibroblasts in further investigations. If available, we will compare the response to S100A9 in IPF patients' donor lung fibroblasts and healthy controls.

In summary, our present study provides direct evidence that S100A9 has a significant impact on lung fibroblast activity, including increasing fibroblast proliferation and stimulating proinflammatory cytokine production. Furthermore, S100A9 could activate fibroblasts to produce type III collagen, its own receptor RAGE, and differentiate to myofibroblast. S100A9 mediated the cellular activation response via RAGE-dependent signalling and subsequent phosphorylation of ERK1/2 MAPK and NF-κB pathways. Further studies are required to understand fully the role of S100A9 in the pathogenesis of pulmonary fibrosis, and primary human lung fibroblasts from IPF patients are an ideal tool. These findings could provide a preliminary understanding of the potential role of S100A9 in pulmonary fibrosis.

Acknowledgments

This study was supported partially by grants from the National Science Foundation of China (81270120 and 81072463), the Science and Technology Committee of Shanghai Municipality (10JC1402100 and 11410701800) and US NIH NIAID U01 (1U01AI090909).

Disclosure

The authors declare that they have no conflicts of interest related to the publication of this manuscript.

Supporting information

Additional Supporting Information may be found in the online version of this article at the publisher's website:

Fig. S1. Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE), 15%, was used for analysis of S100A9 protein (5 μg).

cei0173-0523-sd1.tif (141.8KB, tif)

References

  • 1.Latsi PI, du Bois RM, Nicholson AG, et al. Fibrotic idiopathic interstitial pneumonia: the prognostic value of longitudinal functional trends. Am J Respir Crit Care Med. 2003;168:531–537. doi: 10.1164/rccm.200210-1245OC. [DOI] [PubMed] [Google Scholar]
  • 2.Donato R. S100: a multigenic family of calcium-modulated proteins of the EF-hand type with intracellular and extracellular functional roles. Int J Biochem Cell Biol. 2001;33:637–668. doi: 10.1016/s1357-2725(01)00046-2. [DOI] [PubMed] [Google Scholar]
  • 3.Kerkhoff C, Klempt M, Sorg C. Novel insights into structure and function of MRP8 (S100A8) and MRP14 (S100A9) Biochim Biophys Acta. 1998;1448:200–211. doi: 10.1016/s0167-4889(98)00144-x. [DOI] [PubMed] [Google Scholar]
  • 4.Schafer BW, Heizmann CW. The S100 family of EF-hand calcium-binding proteins: functions and pathology. Trends Biochem Sci. 1996;21:134–140. doi: 10.1016/s0968-0004(96)80167-8. [DOI] [PubMed] [Google Scholar]
  • 5.Hessian PA, Edgeworth J, Hogg N. MRP-8 and MRP-14, two abundant Ca(2+)-binding proteins of neutrophils and monocytes. J Leukoc Biol. 1993;53:197–204. [PubMed] [Google Scholar]
  • 6.Vogl T, Ludwig S, Goebeler M, et al. MRP8 and MRP14 control microtubule reorganization during transendothelial migration of phagocytes. Blood. 2004;104:4260–4268. doi: 10.1182/blood-2004-02-0446. [DOI] [PubMed] [Google Scholar]
  • 7.Simard JC, Girard D, Tessier PA. Induction of neutrophil degranulation by S100A9 via a MAPK-dependent mechanism. J Leukoc Biol. 2010;87:905–914. doi: 10.1189/jlb.1009676. [DOI] [PubMed] [Google Scholar]
  • 8.Perera C, McNeil HP, Geczy CL. S100 Calgranulins in inflammatory arthritis. Immunol Cell Biol. 2010;88:41–49. doi: 10.1038/icb.2009.88. [DOI] [PubMed] [Google Scholar]
  • 9.Foell D, Frosch M, Sorg C, Roth J. Phagocyte-specific calcium-binding S100 proteins as clinical laboratory markers of inflammation. Clin Chim Acta. 2004;344:37–51. doi: 10.1016/j.cccn.2004.02.023. [DOI] [PubMed] [Google Scholar]
  • 10.Foell D, Wittkowski H, Ren Z, et al. Phagocyte-specific S100 proteins are released from affected mucosa and promote immune responses during inflammatory bowel disease. J Pathol. 2008;216:183–192. doi: 10.1002/path.2394. [DOI] [PubMed] [Google Scholar]
  • 11.Foell D, Hernandez-Rodriguez J, Sanchez M, Vogl T, Cid MC, Roth J. Early recruitment of phagocytes contributes to the vascular inflammation of giant cell arteritis. J Pathol. 2004;204:311–316. doi: 10.1002/path.1660. [DOI] [PubMed] [Google Scholar]
  • 12.Lovell DJ, Ruth NM. Pediatric clinical research. Curr Opin Rheumatol. 2005;17:265–270. doi: 10.1097/01.bor.0000159925.35138.6c. [DOI] [PubMed] [Google Scholar]
  • 13.Korthagen NM, Nagtegaal MM, van Moorsel CH, Kazemier KM, van den Bosch JM, Grutters JC. MRP14 is elevated in the bronchoalveolar lavage fluid of fibrosing interstitial lung diseases. Clin Exp Immunol. 2010;161:342–347. doi: 10.1111/j.1365-2249.2010.04181.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Hara A, Sakamoto N, Ishimatsu Y, et al. S100A9 in BALF is a candidate biomarker of idiopathic pulmonary fibrosis. Respir Med. 2012;106:571–580. doi: 10.1016/j.rmed.2011.12.010. [DOI] [PubMed] [Google Scholar]
  • 15.Bargagli E, Olivieri C, Cintorino M, et al. Calgranulin B (S100A9/MRP14): a key molecule in idiopathic pulmonary fibrosis? Inflammation. 2011;34:85–91. doi: 10.1007/s10753-010-9210-7. [DOI] [PubMed] [Google Scholar]
  • 16.Fietta A, Bardoni A, Salvini R, et al. Analysis of bronchoalveolar lavage fluid proteome from systemic sclerosis patients with or without functional, clinical and radiological signs of lung fibrosis. Arthritis Res Ther. 2006;8:R160. doi: 10.1186/ar2067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Phan SH. The myofibroblast in pulmonary fibrosis. Chest. 2002;122:286S–289. doi: 10.1378/chest.122.6_suppl.286s. [DOI] [PubMed] [Google Scholar]
  • 18.Lawson WE, Polosukhin VV, Zoia O, et al. Characterization of fibroblast-specific protein 1 in pulmonary fibrosis. Am J Respir Crit Care Med. 2005;171:899–907. doi: 10.1164/rccm.200311-1535OC. [DOI] [PubMed] [Google Scholar]
  • 19.Hashimoto D, Ohmuraya M, Hirota M, et al. Involvement of autophagy in trypsinogen activation within the pancreatic acinar cells. J Cell Biol. 2008;181:1065–1072. doi: 10.1083/jcb.200712156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Tang CH, Yang RS, Chen YF, Fu WM. Basic fibroblast growth factor stimulates fibronectin expression through phospholipase C gamma, protein kinase C alpha, c-Src, NF-kappaB, and p300 pathway in osteoblasts. J Cell Physiol. 2007;211:45–55. doi: 10.1002/jcp.20896. [DOI] [PubMed] [Google Scholar]
  • 21.Ghavami S, Rashedi I, Dattilo BM, et al. S100A8/A9 at low concentration promotes tumor cell growth via RAGE ligation and MAP kinase-dependent pathway. J Leukoc Biol. 2008;83:1484–1492. doi: 10.1189/jlb.0607397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Shibata F, Miyama K, Shinoda F, Mizumoto J, Takano K, Nakagawa H. Fibroblast growth-stimulating activity of S100A9 (MRP-14) Eur J Biochem. 2004;271:2137–2143. doi: 10.1111/j.1432-1033.2004.04129.x. [DOI] [PubMed] [Google Scholar]
  • 23.Ahmad A, Bayley DL, He S, Stockley RA. Myeloid related protein-8/14 stimulates interleukin-8 production in airway epithelial cells. Am J Respir Cell Mol Biol. 2003;29:523–530. doi: 10.1165/rcmb.2002-0286OC. [DOI] [PubMed] [Google Scholar]
  • 24.Schelbergen RF, Blom AB, van den Bosch MH, et al. Alarmins S100A8 and S100A9 elicit a catabolic effect in human osteoarthritic chondrocytes that is dependent on Toll-like receptor 4. Arthritis Rheum. 2012;64:1477–1487. doi: 10.1002/art.33495. [DOI] [PubMed] [Google Scholar]
  • 25.Baillet A. [S100A8, S100A9 and S100A12 proteins in rheumatoid arthritis] Rev Med Interne. 2010;31:458–461. doi: 10.1016/j.revmed.2009.10.435. [DOI] [PubMed] [Google Scholar]
  • 26.Bierhaus A, Humpert PM, Morcos M, et al. Understanding RAGE, the receptor for advanced glycation end products. J Mol Med (Berl) 2005;83:876–886. doi: 10.1007/s00109-005-0688-7. [DOI] [PubMed] [Google Scholar]
  • 27.He M, Kubo H, Ishizawa K, et al. The role of the receptor for advanced glycation end-products in lung fibrosis. Am J Physiol Lung Cell Mol Physiol. 2007;293:L1427–1436. doi: 10.1152/ajplung.00075.2007. [DOI] [PubMed] [Google Scholar]
  • 28.Liang X, So YH, Cui J, et al. The low-dose ionizing radiation stimulates cell proliferation via activation of the MAPK/ERK pathway in rat cultured mesenchymal stem cells. J Radiat Res. 2011;52:380–386. doi: 10.1269/jrr.10121. [DOI] [PubMed] [Google Scholar]
  • 29.Ikeda F, Matsubara T, Tsurukai T, Hata K, Nishimura R, Yoneda T. JNK/c-Jun signaling mediates an anti-apoptotic effect of RANKL in osteoclasts. J Bone Miner Res. 2008;23:907–914. doi: 10.1359/jbmr.080211. [DOI] [PubMed] [Google Scholar]
  • 30.Ramasamy R, Yan SF, Schmidt AM. RAGE: therapeutic target and biomarker of the inflammatory response – the evidence mounts. J Leukoc Biol. 2009;86:505–512. doi: 10.1189/jlb.0409230. [DOI] [PubMed] [Google Scholar]
  • 31.Gao B, Wang Y, Tsan MF. The heat sensitivity of cytokine-inducing effect of lipopolysaccharide. J Leukoc Biol. 2006;80:359–366. doi: 10.1189/jlb.1205738. [DOI] [PubMed] [Google Scholar]
  • 32.Shibata F, Ito A, Ohkuma Y, Mitsui K. Mitogenic activity of S100A9 (MRP-14) Biol Pharm Bull. 2005;28:2312–2314. doi: 10.1248/bpb.28.2312. [DOI] [PubMed] [Google Scholar]
  • 33.Kienast K, Knorst M, Muller-Quernheim J, Ferlinz R. Modulation of IL-1 beta, IL-6, IL-8, TNF-alpha, and TGF-beta secretions by alveolar macrophages under NO2 exposure. Lung. 1996;174:57–67. doi: 10.1007/BF00167951. [DOI] [PubMed] [Google Scholar]
  • 34.Ryckman C, Vandal K, Rouleau P, Talbot M, Tessier PA. Proinflammatory activities of S100: proteins S100A8, S100A9, and S100A8/A9 induce neutrophil chemotaxis and adhesion. J Immunol. 2003;170:3233–3242. doi: 10.4049/jimmunol.170.6.3233. [DOI] [PubMed] [Google Scholar]
  • 35.Vandal K, Rouleau P, Boivin A, Ryckman C, Talbot M, Tessier PA. Blockade of S100A8 and S100A9 suppresses neutrophil migration in response to lipopolysaccharide. J Immunol. 2003;171:2602–2609. doi: 10.4049/jimmunol.171.5.2602. [DOI] [PubMed] [Google Scholar]
  • 36.Hussein MR, Hassan HI, Hofny ER, et al. Alterations of mononuclear inflammatory cells, CD4/CD8+ T cells, interleukin 1beta, and tumour necrosis factor alpha in the bronchoalveolar lavage fluid, peripheral blood, and skin of patients with systemic sclerosis. J Clin Pathol. 2005;58:178–184. doi: 10.1136/jcp.2004.019224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Green FH. Overview of pulmonary fibrosis. Chest. 2002;122:334S–339. doi: 10.1378/chest.122.6_suppl.334s. [DOI] [PubMed] [Google Scholar]
  • 38.Willis BC, Borok Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 2007;293:L525–534. doi: 10.1152/ajplung.00163.2007. [DOI] [PubMed] [Google Scholar]
  • 39.Gebhardt C, Riehl A, Durchdewald M, et al. RAGE signaling sustains inflammation and promotes tumor development. J Exp Med. 2008;205:275–285. doi: 10.1084/jem.20070679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Morbini P, Villa C, Campo I, Zorzetto M, Inghilleri S, Luisetti M. The receptor for advanced glycation end products and its ligands: a new inflammatory pathway in lung disease? Mod Pathol. 2006;19:1437–1445. doi: 10.1038/modpathol.3800661. [DOI] [PubMed] [Google Scholar]
  • 41.Queisser MA, Kouri FM, Konigshoff M, et al. Loss of RAGE in pulmonary fibrosis: molecular relations to functional changes in pulmonary cell types. Am J Respir Cell Mol Biol. 2008;39:337–345. doi: 10.1165/rcmb.2007-0244OC. [DOI] [PubMed] [Google Scholar]
  • 42.Stern D, Yan SD, Yan SF, Schmidt AM. Receptor for advanced glycation endproducts: a multiligand receptor magnifying cell stress in diverse pathologic settings. Adv Drug Deliv Rev. 2002;54:1615–1625. doi: 10.1016/s0169-409x(02)00160-6. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1. Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE), 15%, was used for analysis of S100A9 protein (5 μg).

cei0173-0523-sd1.tif (141.8KB, tif)

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES