Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Feb 14.
Published in final edited form as: FEBS Lett. 2014 Jan 18;588(4):594–599. doi: 10.1016/j.febslet.2013.12.027

Identification of an arylalkylamine N-acyltransferase from Drosophila melanogaster that catalyzes the formation of long-chain N-acylserotonins

Daniel R Dempsey 1,1, Kristen A Jeffries 1,1, Ryan L Anderson 1, Anne-Marie Carpenter 1, Santiago Rodriguez Ospina 1, David J Merkler 1,*
PMCID: PMC3952154  NIHMSID: NIHMS558993  PMID: 24444601

Abstract

Arylalkylamine N-acyltransferase-like 22 (AANATL2) from Drosophila melanogaster was expressed and shown to catalyze the formation of long-chain N-acylserotonins and N-acydopamines. Subsequent identification of endogenous amounts of N-acylserotonins and colocalization of these fatty acid amides and AANATL2 transcripts gives supporting evidence that AANATL2 has a role in the biosynthetic formation of these important cell signalling lipids.

Keywords: Arylalkylamine N-acyltransferase, Arylalkylamine N-acetyltransferase, N-acyldopamines, N-acylserotonins, Drosophila melanogaster, thorax-abdomen, steady-state kinetics

1. Introduction

Fatty acid amides are an emerging class of cell signalling lipids. This family of bioactive amides consists of N-acyl amino acids, N-acylarylalkylamines, N-acylethanolamines, N-monoacylpolyamines, and primary fatty acid amides. The N-acylarylalkylamines can be subdivided into two groups called the N-acyldopamines and the N-acylserotonins. With the exception of the N-acylethanolamines, the biosynthetic routes to these long-chain fatty acids amides in vivo is largely unknown [1-2].

The N-acylserotonins were originally synthesized as inhibitors of fatty acid amino hydrolase (FAAH), the primary focus being N-arachidonoylserotonin with an IC50 = 12 μM [3]. Following this discovery, N-arachidonoylserotonin was shown to act as a vanilloid TRPV1 receptor antagonist [4], as an inhibitor of soybean lipoxygenase [5], as a regulator for gastric emptying [6], and also exhibited analgesic, anxiolytic, and anti-allergic activity in various model systems [4,7-8]. The biological roles for the other known long-chain N-acylserotonins have yet to be determined. Recently, Verhoeckx et al. [9] identified and quantified the endogenous amounts of long-chain N-acylserotonins in the different regions of the porcine gastrointestinal tract, including the ileum. Like the N-acylserotonins, activities have been ascribed to the N-acyldopamines, as the N-acyldopamines regulate pain perception, body temperature, and locomotion in mammals [10-13]. Little is known about the in vivo production of the N-acylserotonins and N-acyldopamines except for data showing that these could be produced by the direct conjugation of serotonin or dopamine to a fatty acid [9,14]. One set of biosynthetic reactions consistent with these data would be the initial formation of the acyl-CoA in a reaction requiring ATP, followed by a reaction between the resulting acyl-CoA and serotonin or dopamine to form the long-chain N-acylarylalkylamide (Fig. 1). Acyl-CoA formation is catalyzed by an acyl-CoA synthetase, a known enzyme [15], while the enzyme catalyzing the second reaction is reported here for the first time. This chemistry is consistent with reactions catalyzed by the arylalkylamine N-acetyltransferases (AANATs) and other enzymes of the GCN5-related N-acetyltransferase (GNAT) family enzymes [16-18].

Figure 1.

Figure 1

Proposed reaction for the formation of long-chain N-acylserotonins catalyzed by AANATL2.

AANATs from a number of organisms have been shown to catalyze the production of different N-acetylarylalkylamines like N-acetyldopamine and N-acetylserotonin [16-18]. Other than a single report that propionyl-CoA and butyryl-CoA are relatively poor substrates for human serotonin N-acetyltransferase [19], it has not been determined if the known AANATs will utilize long-chain acyl-CoA thioesters as substrates to generate the corresponding long chain N-acylarylalkylamides [19]. Eight putative arylalkylamine N-acetyltransferase-like (AANATL) enzymes [20] were identified in Drosophila melanogaster and we hypothesized that one of these enzymes would have a role in the formation of the long-chain N-acylserotonins.

Herein, we provide evidence that AANATL2, an AANATL enzyme from D. melanogaster (CG9486), will catalyze the formation of long-chain N-acylserotonins. We further define the expression of AANATL2 transcripts in different anatomical regions of the flies and find measureable levels of the endogenous N-acylserotonins in regions that overlap with the expression of the AANATL2 transcripts. While the N-acylserotonins are the major focus of this report, we also demonstrate that arylalkylamines other than serotonin are AANATL2 substrates, including dopamine, octopamine, and tyramine. These data suggest that AANATL2 could serve broadly in the cellular production of numerous different N-acylarylalkylamides.

2. Materials and Methods

2.1. Materials

Codon optimized AANATL2 was purchased from Genscript. Oligonucleotides were purchased from Eurofins MWG Operon. BL21(DE3) Escherichia coli competent cells and pET-28a(+) vector were purchased from Novagen. Probond™ nickel-chelating resin, Ambion MicroPoly(A) Purist, and Ambion Retroscript kit were purchased from Invitrogen. NdeI, XhoI, Antarctic Phosphatase, and T4 DNA ligase were purchased from New England Biolabs. Ampicillin sodium salt and IPTG were purchased from Gold Biotechnology. Long-chain acyl-CoAs were purchased from Sigma-Aldrich. D. melanogaster (Oregon R) and 4-24 Instant Medium were supplied by Carolina Biological. Silica was purchased from Suppelco. Long-chain N-acylserotonins and N-arachidonoylglycine-d8 standards were purchased from Cayman Chemical. All other reagents were of the highest quality available from either Sigma-Aldrich or Fisher Scientific.

2.2. Molecular cloning

AANATL2 (CG9486; Accession No. NM_135161.3) was codon optimized for expression in E. coli and purchased from Genscript. The codon optimized gene was inserted into a pET28a(+) vector using the NdeI and XhoI restriction sites. The AANATL2-pET28a vector was then transformed into E. coli BL21(DE3) competent cells and plated on a LB agar plate supplemented with 40 μg/mL kanamycin. A single colony from the transformation was then used for the expression of AANATL2.

2.3. Protein expression and purification

The BL21(DE3) E. coli cells containing the D. melanogaster AANATL2-pET28a vector were cultured in LB media supplemented with 40 μg/mL kanamycin and induced with 1 mM isopropyl β-D-1-thiogalactopyranoside at an OD600 of 0.6 for 4 hrs at 37°C. The final culture was then harvested by centrifugation at 5,000 g for 10 min at 4°C and the pellet was collected.

The pellet was then resuspended in 20 mM Tris, 500 mM NaCl, 5 mM imidazole; lysed by sonication; and then centrifuged at 10,000 g for 15 min at 4°C. The resulting supernatant was loaded onto 6 mL of Probond™ nickel-chelating resin. The column was first washed with 10 column volumes of 20 mM Tris-HCl, 500 mM NaCl, 5 mM imidazole, pH 7.9, then washed with 10 column volumes of 20 mM Tris-HCl, 500 mM NaCl, 60 mM imidazole, pH 7.9, and lastly eluted in 1 mL fractions of 20 mM Tris-HCl, 500 mM NaCl, 500 mM imidazole, pH 7.9. The AANATL2 within these fractions were analyzed for purity using a 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel, visualized using Coomassie stain, and pooled together. The pooled fractions are dialyzed overnight at 4°C in 20 mM Tris, 200 mM NaCl, pH 7.4 and stored at −80°C.

2.4. Activity assay

Steady-state kinetic characterization of AANATL2 was performed in 300 mM Tris-HCl, pH 8.0, 150 μM 5,5′-dithiobis(2-nitrobenzoic acid) (DTNB) [21], and varying concentrations of substrates. Initial rates were measured continuously at 412 nm. Kinetic constants for long-chain acyl-CoA substrates were determined by holding the initial serotonin concentration constant at 5 mM. Kinetic constants for the short-chain acyl-CoA substrates, acetyl-CoA and butyryl-CoA, were determined by holding the initial serotonin concentration constant at 100 μM. The steady-state kinetic constants for serotonin, dopamine, octopamine, and tyramine were delineated by holding the initial acyl-CoA concentration at 50 μM. Steady-state kinetic constants were obtained by fitting the data to the Michaelis-Menten equation in SigmaPlot 12.0.

2.5. AANATL2 product characterization

The product of the AANATL2-catalyzed reaction was generated by incubating 36 μg of the enzyme for 1 hour in 300 mM Tris-HCl, pH 8.0, 50 mM serotonin or dopamine, and 500 μM oleoyl-CoA. The reaction mixture was passed through a 10 kDa ultrafilter (Millipore) to remove the AANATL2 and resulting protein-free solution injected on an Agilent 6540 liquid chromatography/quadrupole time-of-flight mass spectrometer (LC/QTOF-MS) in positive ion mode. A Kinetex™ 2.6 μm C18 100 Å (50 × 2.1 mm) reverse phase column was used for AANATL2 product separation. Mobile phase A consisted of water with 0.1% formic acid and of mobile phase B consisted of acetonitrile with 0.1% formic acid. A linear gradient of 10% B increasing to 100% B over the course of 5 min, followed by a hold of 3 min at 100% B was used for the LC analysis of the reaction product. The reverse phase column was equilibrated with 10% B for 8 minutes after the run to prepare the column for the subsequent injections.

2.6. AANATL2 transcript localization

D. melanogaster were grown on 4-24 Instant Medium from Carolina Biological, flash frozen for decapitation, and the heads were separated from thorax-abdomens using a wired mesh. Ambion MicroPoly(A) Purist kit was used to purify the mRNA and Ambion Retroscript kit was used to generate the cDNA library for subsequent RT-PCR localization of AANATL2 from D. melanogaster head and thorax-abdomen. Identification of AANATL2 transcripts was completed by RT-PCR (45 cycles of 95°C for 30 s; 60°C for 30 s; 72°C for 1 min). The primers used to amplify a 247 bp region of AANATL2 (forward - ATGACAATCGGGGATTACGA, reverse - CCTCCTGGTACTCCCTCTCC) were designed and synthesized by Eurofins MWG Operon. Amplified product from the RT-PCR reaction was analyzed by a 0.6 % agarose gel and the band visualized by 0.5 μg/mL ethidium bromide under ultraviolet light. The positive bands at 247 bp were cut out of the gel, purified by the Promega Wizard® SV Gel and PCR Clean-up system, and sequenced by Eurofins MWG Operon.

2.7. Endogenous quantification of long-chain N-acylserotonins

Four separate cultures of D. melanogaster were used for the analysis of endogenous levels of long-chain N-acylserotonins. Lipids were extracted using organic solvents followed by the solid phase purification of Farrell et al. [22]. The purified extracts were dried under N2, reconstituted in HPLC grade methanol, and injected on an Agilent 1260 connected to an Agilent 6540 LC/QTOF-MS in positive ion mode. Injected lipid extracts were separated by a Kinetex™ 2.6 μm C18 100 Å (50 × 2.1 mm) reverse phase column at 0.6 mL/min. Mobile phase A consisted of water with 0.1% formic acid and mobile phase B consisted of acetonitrile with 0.1% formic acid. A linear gradient was used for the separation of the injected lipid extracts by reverse phase chromatography starting at 10% B and increasing to 100% B over the course of 5 min, followed by a hold of 3 min at 100% B. The reverse phase column was equilibrated with 10% B for 8 minutes after the run to prepare the column for subsequent injections. N-Arachidonoylglycine-d8, 1 pmole per 10 μL injection, was spiked into each extraction to measure instrument performance and for data normalization. The four extractions from separate cultures of D. melanogaster were analyzed in triplicate for a total of 12 runs. Standard curves of commercially available N-acylserotonins and N-arachidonoylglycine-d8 were analyzed in triplicate with a linear range of 100 fmoles to 5 pmoles (r2 values >0.99).

3. Results and Discussion

The codon optimized D. melanogaster AANATL2 gene was prepared commercially by Genscript and cloned into a pet28a(+) vector that encodes for an N-terminal His6-tag protein. Recombinant D. melanogaster AANATL2 was expressed in Escherichia coli BL21(DE3) cells and purified using Probond™ nickel-chelating resin. The purified AANATL2 was then analyzed by SDS-PAGE (Fig. 2), yielding a single band at 25 kDa.

Figure 2.

Figure 2

SDS-PAGE analysis of purified D. melanogaster AANATL2. Left lane is PageRuler™ Prestained Protein Ladder. Right lane is purified AANATL2.

Potential substrates for AANATL2 were identified using Ellman's reagent [21] by measuring the acyl-CoA dependent release of CoA-SH which yields 2-nitro-5-thiobenzoate at 412 nm. Activity was observed with serotonin and oleoyl-CoA from our substrate screening studies which was evaluated in greater detail with subsequent steady-state kinetic analysis of AANATL2 with a set of acyl-CoA thioesters and serotonin. We found that acyl-CoA thioesters from acetyl-CoA to arachidonoyl-CoA are AANATL2 substrates with some variability in the apparent kinetic constants at saturating serotonin. The (KM,acyl-CoA)app values for all the acyl-CoA thioesters included in our study were approximately the same, ranging from ∼2 μM for butyryl-CoA and arachidonoyl-CoA to ∼ 10 μM for palmitoyl-CoA. Greater variability was observed for the (kcat,acyl-CoA)app and (kcat/KM)acyl-CoA,app values with a range of 20-30-fold. Based on our data, the short-chain acyl-CoA thioesters are, in general, substrates with higher (kcat/KM,acyl-CoA)app values than the long-chain acyl-CoA thioesters (Table 1). Amherd et al. [20] expressed D. melanogaster AANATL2 in COS-7 cells and report a (KM,acyl-CoA)app for acetyl-CoA of 7.2 ± 0.6 μM with tryptamine as a co-substrate that is similar to the value we measure using serotonin as the co-substrate. A comparison of (kcat,acyl-CoA)app and (kcat/KM)acyl-CoA,app values we measure (Table 1) to those reported by Amherd et al. [20] is difficult as these researchers did not purify recombinant AANATL2 from the COS-7 cells.

Table 1. Acyl-CoA Specificity for AANATL2.

Substratea (KM,acyl-CoA)app
μM
(Kcat,acyl-CoA)app
s−1
(Kcat/KM)acyl-CoA,app
M−1s−1
Acetyl-CoA 6.1 ± 0.27 1.3 ± 0.012 (2.2 ± 0.020) × 105
Butyryl-CoA 1.8 ± 0.17 0.53 ± 0.011 (2.9 ± 0.058) × 105
Palmitoyl-CoA 9.9 ± 1.6 0.16 ± 0.0090 (1.6 ± 0.091) × 104
Stearoyl-CoA 6.0 ± 0.75 0.059 ± 0.0023 (9.8 ± 0.39) × 103
Oleoyl-CoA 3.6 ± 0.58 0.075 ± 0.0033 (2.1 ± 0.091) × 104
Arachidonoyl-CoA 1.9 ± 0.25 0.043 ± 0.0013 (2.3 ± 0.068) × 104
a

Background rates of acyl-CoA hydrolysis were obtained at each CoA concentration in the absence of serotonin and subtracted from the rate obtained in the presence of serotonin. The non-serotonin background rates were ≤15% of rates obtained in the presence of serotonin, with exception of steroyl-CoA. For stearoyl-CoA, the background hydrolysis rates were ≤30%.

We have also evaluated biologically relevant arylalkylamines other than serotonin as substrates for AANATL2, namely dopamine, octopamine, and tyramine. Ahmerd et al. [20] have already demonstrated that tryptamine is a substrate for D. melanogaster AANATL2. Neither tyramine nor octopamine were substrates when the acyl acceptor was oleoyl-CoA as the observed rate of CoA release from oleoyl-CoA was equivalent to the background rate of hydrolysis obtained in the absence of the arylalkylamine. However, both were substrates when the acyl acceptor was acetyl-CoA. The kinetic constants for the AANATL2-catalyzed formation of N-acetyltyramine and N-acetyloctopamine are similar to those determined for the formation of N-acetylserotonin except for a relatively high (KM,amine)app for octopamine of 78 ± 3.9 μM (Table S1, supplementary materials). Dopamine is a substrate for AANATL2 when the co-substrate is acetyl-, palmitoyl-, or oleoyl-CoA (Table 2). Again, the kinetic constants for the formation of N-acetyldopamine are similar to those determined for the generation of the other N-acetylarylalkylamides.

Table 2. Apparent Kinetic Constants for Serotonin and Dopamine using Different Acyl-CoA Substrates.

Substratea (KM,amine)app
μM
(Kcat,amine)app
s−1
(Kcat/KM)amine,app
M−1 s−1
Serotonin
Acetyl-CoA 7.2 ± 1.1 2.4 ± 0.097 (3.3 ± 0.13) × 105
Butyryl-CoA 2.9 ± 0.33 0.52 ± 0.011 (1.8 ± 0.040) × 105
Palmitoyl-CoA 870 ± 60 0.15 ± 0.0034 (1.7 ± 0.039) × 102
Stearoyl-CoA 350 ± 35 0.057 ± 0.0014 (1.6 ± 0.040) × 102
Oleoyl-CoA 490 ± 86 0.085 ± 0.0059 (1.7 ± 0.12) × 102
Arachidonoyl-CoA 460 ± 69 0.030 ± 0.0014 66 ± 3.0

Substratea (KM,amine)app mM (Kcat,amine)app s−1 (kcat/KM)amine,app M−1s−1

Dopamine
Acetyl-CoA 0.042 ± 0.0097 6.5 ± 0.67 (1.6 ± 0.16) × 105
Palmitoyl-CoA 1.1 ± 0.13 0.14 ± 0.0050 (1.2 ± 0.045) × 102
Oleoyl-CoA 1.2 ± 0.20 0.058 ± 0.0033 47 ± 2.7
a

Background rates of acyl-CoA hydrolysis were obtained at a saturating CoA concentration in the absence of the arylalkylamine and subtracted from the rate obtained in the presence of arylalkylamine. The non-arylalkylamine (background rates) were ≤20% of rates obtained in the presence of arylalkylamine.

We evaluated the relationship between the (KM,amine)app for serotonin or dopamine as a function of acyl chain length for the acyl-CoA substrates (Table 2) because both of these were substrates when acetyl-CoA and the long-chain acyl-CoA were co-substrates. The pattern in the data was the same for both serotonin and dopamine, the (KM,amine)app increased, the (kcat,amine)app decreased, and the (kcatKM)amine,app decreased as the acyl chain length increased from acetyl to arachidonoyl. The ratio of (kcatKM)amine,appacetyl–CoA/(kcatKM)amine,apparachidonoyl–CoA is 3,400 for dopamine and 5,000 for serotonin indicating that acetyl-CoA is substantially preferred by AANATL2. Side-by-side comparisons of the acyl-CoA thioesters between serotonin and dopamine show that AANATL2 exhibits a slight preference for serotonin as the amine donor substrate.

An examination of our kinetic data reveals some patterns: (a) limited variation in the (KM,acyl-CoA)app values for the acyl-CoA substrates as all are in the range of 2-10 μM, (b) limited variation (kcat,amine)app and (kcat/KM)amine,app values on the amine substrate, (c) an increase in the (KM,amine)app values for the amine substrates as the length of the acyl chain increases for the acyl-CoAs, and (d) a decrease in the (kcat,amine)app and (kcat/KM)amine,app values as the length of the acyl chain increases for the acyl-CoAs. These data suggest that the long-chain acyl group either interferes with the binding of the arylalkylamine substrates or that the binding of the long-chain acyl-CoAs results in an AANATL2 conformation that is less optimal for catalysis. An X-ray structure of AANATL2 with bound acetyl-CoA or oleoyl-CoA could differentiate between these two possibilities. We also note the relatively low kcat,app values [(kcat,acyl-CoA)app and (kcat,amine)app] values for the long-chain acyl-CoA substrates; however, low kcat,app values are not surprising since the long-chain N-acyl- serotonins and dopamines likely serve as potent cell signaling lipids [9-13]. The cellular function of AANATL2 may be the generation of the long-chain N-acylarylalkylamides and the measured kcat,app values are sufficient to supply the cellular needs of these potent lipid amides. Saghatelian and Cravatt [23] have shown in their studies of FAAH(-/-) that in vitro measurements of kinetic constants may not provide a complete understanding of the functional role of an enzyme in vivo.

The products from the AANATL2 catalyzed reaction between oleoyl-CoA and serotonin or dopamine were positively identified as N-oleoylserotonin and N-oleoyldopamine (Table 3). AANATL2 was incubated with serotonin or dopamine and oleoyl-CoA for one hour, the enzyme was removed by ultrafiltration using a 10 kDa cutoff filter, followed by product analysis by liquid chromatography/quadrupole time-of-flight mass spectrometry (LC/QTOF-MS). AANATL2-generated N-oleoylserotonin or N-oleoyldopamine was compared to a commercial standard. Positive identification was delineated by a comparable retention time and molecular ion m/z for the AANATL2 product and the standard (Table 3).

Table 3. Standards used for identification of endogenous long-chain N-acylserotonins and the AANATL2 product characterization.

N-Acylarylalkylamine Standard Retention Time
Min
Molecular Ion
[M+H]+ m/z
N-Oleoylserotonin 6.132 441.3878
N-Palmitoylserotonin 6.038 415.3344
N-Stearoylserotonin 6.368 443.3620
N-Arachidonoylserotonin 5.900 463.3291
N-Oleoyldopamine 5.929 418.3326
AANATL2 Producta 6.130 441.3464
AANATL2 Productb 5.929 418.3325
a

Reaction conditions: 300 mM Tris-HCl, pH 8.0, 50 mM serotonin, and 500 μM oleoyl-CoA was incubated with 36 μg of AANATL2 for one hour.

b

Reaction conditions: 300 mM Tris-HCl, pH 8.0, 50 mM dopamine, and 500 μM oleoyl-CoA was incubated with 36 μg of AANATL2 for one hour.

The in vitro data we obtained using purified AANATL2 (substrate specificity and product characterization) lead to questions such as: (a) are the long-chain N-acylarylalkylamides found in D. melanogaster, (b) if so, what are the steady-state endogenous levels of these fatty acid amides, and (c) would we find colocalization of endogenous N-acylarylalkylamides and AANATL2? To address these intriguing questions, we first identified the localization of the AANATL2 transcripts by RT-PCR. Primers were designed and synthesized commercially to generate a 247 bp AANATL2-derived RT-PCR product from the cDNA libraries generated from D. melanogaster head and thorax-abdomen. The RT-PCR experiments show that AANATL2 transcripts were only found in the thorax-abdomen of D. melanogaster (Fig. 3).

Figure 3.

Figure 3

RT-PCR of AANATL2 in D. melanogaster head and thorax-abdomen. Lane 1-4 is data generated from the D. melanogaster head cDNA library at 45°C, 50°C, 55°C, and 60°C annealing temperatures respectively. Lane 5 is 100 bp DNA ladder from New England Biolabs. Lane 6-9 is data generated from the D. melanogaster thorax-abdomen cDNA library at 45°C, 50°C, 55°C, and 60°C annealing temperature respectively. Lane 10 is a 1 kb DNA ladder from New England Biolabs.

AANATL2 was positively identified by the 247 bp RT-PCR product generated from the D. melangaster thorax-abdomen cDNA library; however, a similar RT-PCR product was not observed from the head cDNA library. The sequence of the 247 bp product from the thorax-abdomen library was confirmed as AANATL2 by DNA sequencing. These data are in slight contrast to the report a faint band for AANATL2 from D. melanogaster head by Northern analysis [20]. Together, our data and that from Amherd et al. [20] indicate that AANATL2 transcripts are found at substantially higher levels in the thorax-abdomen relative to the head in D. melanogaster.

Our identification of the AANATL2 transcripts in the thorax-abdomen and the relatively high levels of serotonin in the mammalian gastrointestinal tract [9,24] strongly suggested to us that the long-chain N-acylserotonins would exist endogenously in the thorax-abdomen of D. melanogaster. Four long-chain N-acylserotonins were identified in the thorax-abdomen by molecular ion m/z and retention time comparisons to commercially available standards (Table 4) by LC/QTOF-MS in positive ion mode. Endogenous amounts of N-acylserotonins were not identified in the heads, consistent with our RT-PCR data in which the AANATL2 transcripts were not found. Standard curves with a linear range of 100 fmoles to 5 pmoles (r2 values >0.99) were used to quantify the endogenous amounts of N-acylserotonins in the thorax-abdomen. N-Stearoylserotonin was the most abundant followed by N-palmitoylserotonin, N-arachidonoylserotonin, and N-oleoylserotonin (Table 4). The N-acylserotonin levels that we found in the thorax-abdomen of D. melanogaster are similar to that reported for these fatty acid amides in porcine gastrointestinal tract [9]. In contrast to the long-chain N-acylserotonins, the long-chain N-acyldopamines are found in both the thorax-abdomen and the heads of D. melanogaster [25]. The dissimilarities in the localization of the long-chain N-acylserotonins relative to the long-chain N-acyldopamines are likely the result of differences in biosynthesis, degradation, and/or transport of these different N-acylarylalkylamides.

Table 4.

Endogenous amounts of N-acylserotonins found in D. melanogaster head and thorax-abdomen

N-Acylserotonin Heada Thorax-abdomenb

Extracted amount Extracted amount Retention Time Molecular Ion

pmoles g−1 pmoles g−1 min [M+H]+ m/z
N-Oleoylserotonin ndc 0.42 ± 0.55 6.147 441.2633
6.009 441.2684
6.149 441.2666
6.180 441.2622
N-Palmitoylserotonin ndc 1.16 ± 0.12 6.036 415.3249
6.032 415.3237
6.023 415.3203
6.040 415.3243
N-Stearoylserotonin ndc 53.5 ± 33.3 6.367 443.3143
6.244 443.2986
6.368 443.3167
6.262 443.2993
N-Arachidonoylserotonin ndc 0.25 ± 0.15 5.907 463.2998
5.906 463.3022
5.882 463.3478
5.940 463.3138
a

Identification and quantification of endogenous amounts extracted from one gram of D. melanogaster heads.

b

Identification and quantification of endogenous amounts extracted from one gram of D. melanogaster thorax-abdomen.

c

nd indicates that these N-acylserotonins were “not detected” in one gram of this anatomical location of D. melanogaster.

In summary, AANATL2 from D. melanogaster was shown to catalyze the formation of a diverse set of N-acylarylalkylamides with the most intriguing products being the long-chain N-acylserotonins and N-acyldopamines. Colocalization of AANATL2 transcripts and endogenous long-chain N-acylserotonins to the thorax-abdomen points to an important role for this enzyme in the biosynthesis of these cell signalling long-chain N-acylarylalkylamides. Future work to expand our understanding of biosynthesis and degradation of the N-acylserotonins, N-acyldopamines, and other long-chain N-acylarylalkylamides involving the inhibition of key enzymes is ongoing.

Supplementary Material

01

Highlights.

  • Recombinant D. melanogaster AANATL2 was expressed and purified from E. coli.

  • AANATL2 was found to catalyze the formation of long-chain N-acylarylalkylamides.

  • AANATL2 transcripts were localized to the D. melanogaster thorax-abdomen by RT-PCR.

  • Endogenous levels of long-chain N-acylserotonins were quantified from the fly.

  • AANATL2 and long-chain N-acylserotonins were co-localized to the thorax-abdomen.

Acknowledgments

This work has been support, in part, by grants from the National Institutes of Health (R03-DA03434) and the Florida Center for Excellence for Biomolecular Identification and Targeted Therapeutics (FCoE-BITT grant no. GALS020) and support from the Mass Spectrometry and Peptide Facility, Department of Chemistry, University of South Florida. The authors acknowledge Dr. Ryan Young for many helpful discussions and Dr. K. Kenneth Caswell for a critical reading of the manuscript.

Abbreviations

AANATL2

arylalkylamine N-acyltransferase like 2

FAAH

fatty acid amino hydrolase

ATP

adenosine triphosphate

AANAT

arylalkyamine N-acetyltransferase

D. melanogaster

Drosophila melanogaster

E. coli

Escherichia coli

SDS-PAGE

sodium dodecyl sulfate polyacrylamide gel electrophoresis

DTNB

5,5′-dithiobis(2-nitrobenzoic acid)

RT-PCR

reverse transcription polymerase chain reaction

LC/QTOF-MS

liquid chromatography/quadrupole time-of-flight mass spectrometry

Footnotes

2

The authors recommend the change of arylalkylamine N-acetyltransferase to arylalkylamine N-acyltransferase due to the discovery of acyl-CoA substrates longer than C2 (acetyl).

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Farrell EK, Merkler DJ. Biosynthesis, degradation and pharmacological importance of the fatty acid amides. Drug Discov Today. 2008;13:558–68. doi: 10.1016/j.drudis.2008.02.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Okamoto Y, Tsuboi K, Ueda N. Enzymatic formation of anandamide. Vitam Horm. 2009;81:1–24. doi: 10.1016/S0083-6729(09)81001-7. [DOI] [PubMed] [Google Scholar]
  • 3.Bisogno T, et al. Arachidonoylserotonin and other novel inhibitors of fatty acid amide hydrolase. Biochem Biophys Res Commun. 1998;248:515–22. doi: 10.1006/bbrc.1998.8874. [DOI] [PubMed] [Google Scholar]
  • 4.Maione S, et al. Analgesic actions of N-arachidonoyl-serotonin, a fatty acid amide hydrolase inhibitor with antagonistic activity at vanilloid TRPV1 receptors. Br J Pharmacol. 2007;150:766–81. doi: 10.1038/sj.bjp.0707145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Nguyen MD, Nguyen DH, Yoo JM, Myung PK, Kim MR, Sok DE. Effect of endocannabinoids on soybean lipoxygenase-1 activity. Bioorg Chem. 2013;49:24–32. doi: 10.1016/j.bioorg.2013.06.001. [DOI] [PubMed] [Google Scholar]
  • 6.Di Marzo V, et al. The role of endocannabinoids in the regulation of gastric emptying: alterations in mice fed a high-fat diet. Br J Pharmacol. 2008;153:1272–80. doi: 10.1038/sj.bjp.0707682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Yoo JM, Sok DE, Kim MR. Effect of endocannabinoids on IgE-mediated allergic response in RBL-2H3 cells. Int Immunopharmacol. 2013;17:123–31. doi: 10.1016/j.intimp.2013.05.013. [DOI] [PubMed] [Google Scholar]
  • 8.Micale V, Cristino L, Tamburella A, Petrosino S, Leggio GM, Drago F, Di Marzo V. Anxiolytic effects in mice of a dual blocker of fatty acid amide hydrolase and transient receptor potential vanilloid type-1 channels. Neuropsychopharmacology. 2009;34:593–606. doi: 10.1038/npp.2008.98. [DOI] [PubMed] [Google Scholar]
  • 9.Verhoeckx KCM, Voortman T, Balvers MGJ, Hendriks HFJ, Wortelboer HM, Witkamp RF. Presence, formation and putative biological activities of N-acyl serotonins, a novel class of fatty-acid derived mediators, in the intestinal tract. Biochim Biophys Acta. 2011;1811:578–86. doi: 10.1016/j.bbalip.2011.07.008. [DOI] [PubMed] [Google Scholar]
  • 10.Bisogno T, Melck D, Bobrov M Yu, Gretskaya NM, Bezuglov VV, De Petrocellis L, Di Marzo V. N-acyl-dopamines: novel synthetic CB(1) cannabinoid-receptor ligands and inhibitors of anandamide inactivation with cannabimimetic activity in vitro and in vivo. Biochem J. 2000;351 Pt 3:817–24. [PMC free article] [PubMed] [Google Scholar]
  • 11.Huang SM, et al. An endogenous capsaicin-like substance with high potency at recombinant and native vanilloid VR1 receptors. Proc Natl Acad Sci U S A. 2002;99:8400–5. doi: 10.1073/pnas.122196999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Chu CJ, et al. N-oleoyldopamine, a novel endogenous capsaicin-like lipid that produces hyperalgesia. J Biol Chem. 2003;278:13633–9. doi: 10.1074/jbc.M211231200. [DOI] [PubMed] [Google Scholar]
  • 13.De Petrocellis L, Chu CJ, Moriello AS, Kellner JC, Walker JM, Di Marzo V. Actions of two naturally occurring saturated N-acyldopamines on transient receptor potential vanilloid 1 (TRPV1) channels. Br J Pharmacol. 2004;143:251–6. doi: 10.1038/sj.bjp.0705924. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Akimov MG, Gretskaya NM, Shevchenko KV, Shevchenko VP, Myasoedov NF, Bobrov MY, Bezuglov VV. New aspects of biosynthesis and metabolism of N-acyldopamines in rat tissues. Russ J Bioorg Chem. 2003;33:648–52. doi: 10.1134/s1068162007060118. [DOI] [PubMed] [Google Scholar]
  • 15.Soupene E, Kuypers FA. Mammalian long-chain acyl-CoA synthetases. Exp Biol Med (Maywood) 2008;233:507–21. doi: 10.3181/0710-MR-287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Dyda F, Klein DC, Hickman AB. GCN5-related N-acetyltransferases: a structural overview. Annu Rev Biophys Biomol Struct. 2000;29:81–103. doi: 10.1146/annurev.biophys.29.1.81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Vetting MW, de Carvalho LP, Yu M, Hegde SS, Magnet S, Roderick SL, Blanchard JS. Structure and functions of the GNAT superfamily of acetyltransferases. Arch Biochem Biophys. 2005;433:212–26. doi: 10.1016/j.abb.2004.09.003. [DOI] [PubMed] [Google Scholar]
  • 18.Zheng W, Cole PA. Serotonin N-acetyltransferase: mechanism and inhibition. Curr Med Chem. 2002;9:1187–99. doi: 10.2174/0929867023370013. [DOI] [PubMed] [Google Scholar]
  • 19.Ferry G, et al. Substrate specificity and inhibition studies of human serotonin N-acetyltransferase. J Biol Chem. 2000;275:8794–805. doi: 10.1074/jbc.275.12.8794. [DOI] [PubMed] [Google Scholar]
  • 20.Amherd R, Hintermann E, Walz D, Affolter M, Meyer UA. Purification, cloning, and characterization of a second arylalkylamine N-acetyltransferase from Drosophila melanogaster. DNA Cell Biol. 2000;19:697–705. doi: 10.1089/10445490050199081. [DOI] [PubMed] [Google Scholar]
  • 21.Ellman GL. Tissue sulfhydryl groups. Arch Biochem Biophys. 1959;82:70–7. doi: 10.1016/0003-9861(59)90090-6. [DOI] [PubMed] [Google Scholar]
  • 22.Farrell EK, Chen Y, Barazanji M, Jeffries KA, Cameroamortegui F, Merkler DJ. Primary fatty acid amide metabolism: conversion of fatty acids and an ethanolamine in N18TG2 and SCP cells. J Lipid Res. 2012;53:247–56. doi: 10.1194/jlr.M018606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Saghatelian A, Cravatt BF. Discovery metabolite profiling – forgoing functional connections between the proteome and metabolome. Life Sci. 2005;77:1759–66. doi: 10.1016/j.lfs.2005.05.019. [DOI] [PubMed] [Google Scholar]
  • 24.Gershon MD, Tack J. The serotonin signaling system: from basic understanding to drug development for functional GI disorders. Gastroenterology. 2007;132:397–414. doi: 10.1053/j.gastro.2006.11.002. [DOI] [PubMed] [Google Scholar]
  • 25.Jeffries KA, Dempsey DR, Behari AL, Anderson RL, Merkler DJ. Drosophila melanogaster as a model system to study long-chain fatty acid amide metabolism. FEBS Lett (submitted) 2014 doi: 10.1016/j.febslet.2014.02.051. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01

RESOURCES