Abstract
Molecular mechanisms of multidrug resistance in Vibrio cholerae belonging to non-O1, non-O139 serogroups isolated during 1997 to 1998 in Calcutta, India, were investigated. Out of the 94 strains examined, 22 strains were found to have class I integrons. The gene cassettes identified were dfrA1, dfrA15, dfrA5, and dfrA12 for trimethoprim; aac(6′)-Ib for amikacin and tobramycin; aadA1 and aadA2 for streptomycin and spectinomycin; and ereA2 for erythromycin resistance. To our knowledge, this is the first report of the presence of dfrA5, dfrA12, aac(6′)-Ib, and ereA2 cassettes in class I integrons of V. cholerae. Forty-three of 94 strains also had plasmids, and out of these, 14 contained both class I integrons and plasmids. Pulsed-field gel electrophoresis followed by Southern hybridization revealed that in the 14 plasmid-bearing strains, class I integrons resided either on chromosomes, on plasmids, or on both. Our results indicated that besides class I integrons and plasmids, a conjugative transposon element, SXT, possibly contributed to the multiple antibiotic resistance.
Cholera is a serious epidemic disease caused by the gram-negative bacterium Vibrio cholerae. Only V. cholerae strains belonging to the O1 and O139 serogroups are thought to be capable of causing epidemic cholera. Strains belonging to serogroups other than O1 and O139, collectively referred to as non-O1, non-O139 strains, are ubiquitously found in the aquatic environs (19) and are also capable of causing sporadic diarrhea. In 1996, an inexplicable upsurge in the incidence of cholera strains belonging to serogroups other than O1 and O139 occurred in Calcutta, India. After extensive molecular characterization, these strains were found to be devoid of the ctx filamentous phage (CTXφ) (31) and some other virulence genes (27). Based on these findings, it was concluded that some strains of V. cholerae belonging to different serotypes can cause diarrhea clinically indistinguishable from that associated with cholera (5) by a mechanism that could be distinct from that employed by the toxigenic V. cholerae O1 and O139 strains. The nomenclature “enteropathogenic V. cholerae” (EPVC) was proposed to include these serotypes (27). The incidence of EPVC had shown an upward trend from 1997 that continued into 1998. In the months of July and August 1998, the EPVC strains constituted one-third of the V. cholerae strains isolated from hospitalized patients (12). Recently a comparative study of clinical and environmental isolates of non-O1, non-O139 V. cholerae strains belonging to matching serogroups from our laboratories revealed that, despite sharing the same serogroups, the environmental and clinical isolates were genetically heterogeneous and also that the resistance to multiple antibiotics was more common among the clinical isolates (5). Multiple-antibiotic-resistant isolates of non-O1, non-O139 V. choelrae strains were identified in children with diarrhea in Bangkok, Thailand (7).
Reports of drug-resistant V. cholerae strains are appearing with increasing frequency (20). Emergence of resistance to multiple drugs is a serious clinical problem in the treatment and containment of the disease, as reflected by the increase in the fatality rate from 1% to 5.3% after the emergence of drug-resistant strains in Guinea-Bissau during the 1996-1997 epidemic of cholera (10). The molecular mechanisms responsible for the emergence of multiple-antibiotic-resistant V. cholerae are not very well worked out. Acquisition of antibiotic resistance genes across genera and species is mediated through horizontal and lateral gene transfer. Plasmids, conjugative transposons, and integrons are all vehicles for the acquisition of resistance genes (13, 14, 24, 29, 32). Integrons are genetic elements capable of integrating and mobilizing individual gene cassettes by a site-specific recombination mechanism involving a DNA integrase intI and an att1 site recognized by the integrase (13). Among the different integron families, class I integrons have been found to be most prevalent among clinical isolates. The 5′ conserved segment (5′-CS) of the class I integrons contains the integrase gene (intI1) and the recombination site attI1 (6). The 3′-CS of class I integrons normally carries the antiseptic resistance gene, qacEΔ1,and the sulfonamide resistance gene, sul1. It has been observed, however, that class I integrons do not always contain the entire 3′-CS (6, 22, 25, 28).
Class I integrons are widely present in multidrug-resistant enteropathogens (15-17) and have been identified in V. cholerae O1 strains isolated in Vietnam (8) and Albania and Italy (11), as well as in non-O1, non-O139 strains in Thailand (9). A 150-kb conjugative plasmid was found to contain class I integron in epidemic strains of V. cholerae O1 isolated in Guinea-Bissau (10). So far, there has been no report on the presence of class I integrons in strains of V. cholerae isolated in India.
In the present study, 94 strains of V. cholerae (17 of which were environmental isolates) belonging to serogroups other than O1 and O139 isolated in Calcutta, India, during the period 1997 to 1998, were analyzed for the prevalence of class I integrons and the nature of the antibiotic resistance genes carried by them. They were also investigated for the presence of plasmids and the conjugative transposon SXT element (32), which could also contribute to the multidrug resistance observed in these strains.
MATERIALS AND METHODS
Ninety-four isolates of V. cholerae belonging to serogroups other than O1 and O139 were collected between 1997 and 1998. Seventeen of these isolates were isolated from the aquatic environs in Calcutta, and the remaining ones were isolated from patients with acute cholera-like diarrhea admitted to the Infectious Disease Hospital, Calcutta, India. Hospital surveillance and environmental sampling have been described elsewhere (3, 5,12, 27).
Bacteriology and serogrouping.
V. cholerae isolates from stool and environmental samples were isolated on thiosulfate citrate-bile salts sucrose agar (TCBS agar) as described previously (7). Identification of V. cholerae was then performed (3, 5,12, 27).
Antimicrobial susceptibility.
All of the V. cholerae isolates included in this study were examined for resistance to ampicillin (10 μg), chloramphenicol (30 μg), ciprofloxacin (5 μg), furazolidone (50 μg), gentamicin (10 μg), neomycin (30 μg), nalidixic acid (30 μg), streptomycin (10 μg), sulfamethizole-sulfadiazine (100 μg), tetracycline (30 μg), and trimethoprim (25 μg) by using commercial discs (Hi Media, Bombay, India) as described previously (5) according to the interpretation criteria recommended by the World Health Organization (33).
Bacterial genomic DNA extraction.
Genomic DNA was extracted from the V. cholerae isolates following the method of Murray and Thompson (21) with minor modifications. In brief, V. cholerae organisms from 1.5 ml of an 18-h Luria broth (LB) culture were collected and resuspended in 567 μl of TE buffer (10 mM Tris HCl, 1 mM EDTA [pH 8.0]). This was followed by the addition of 30 μl of 10% sodium dodecyl sulfate and 3 μl of proteinase K (20 μg/ml) and incubation at 37°C. After 1 h, 100 μl of 5 M NaCl was added, followed by the addition of 80 μl of 10% CTAB (cetyltrimethylammonium bromide) in 0.7 M NaCl. The mixture was incubated at 65°C for 10 min and then extracted, first with chloroform and then with phenol chloroform. DNA from the aqueous phase was precipitated with an equal volume of isopropanol. The pellet after washing with 70% ethanol and drying was dissolved in TE buffer and treated with RNase for 30 min at 37°C.
Preparation of DNA probes and Southern and colony hybridizations.
Ribotyping and Southern hybridization analysis of the various genes (toxR, toxT, RS1, hlyA, and hlyU) were performed with probes and methods essentially as described previously (27). The SXT probe was a 0.8-kb PCR product representing a part of the SXT integrase (int) gene sequence. It was amplified from V. cholerae strain MO10 by using the primers SXT-F and SXT-B (Table 1) according to the manufacturer's instructions (Promega, Madison, Wis.). The annealing temperature used was 50°C. The probe was radiolabeled and used in colony hybridization following standard protocols (26). The 0.8-kb PCR amplicon obtained with the primers qacEΔ1-F and sul1-B was used as the class I integron-specific probe for Southern hybridization of the pulsed-field gel electrophoresis (PFGE) gel of 14 V. cholerae strains to find out whether the class I integron was localized on the chromosome or on plasmids.
TABLE 1.
PCR primers used in this study
| Primer | Sequence | Accession no. | Primer position | Source or reference |
|---|---|---|---|---|
| in-F | GGCATCCAAGCAGCAAGC | U12338 | 1416-1433 | 9 |
| in-B | AAGCAGACTTGACCTGAT | U12338 | 4831-4814 | 9 |
| qacEΔ1-F | ATCGCAATAGTTGGCGAAGT | X15370 | 211-230 | 9 |
| sull-B | GCAAGGCGGAAACCCGCC | X12869 | 1360-1341 | 9 |
| SXT-F | TTATCGTTTCGATGGC | AF099172 | 129-144 | This study |
| SXT-B | GCTCTTCTTGTCCGTTC | AF099172 | 915-931 | This study |
Plasmid isolation.
Plasmids were isolated from V. cholerae strains according to the protocol for small-scale plasmid DNA isolation by the alkaline lysis method as described by Sambrook et al. (26), except 0.75 ml of a culture was taken, and twice the recommended volumes of solutions I, II, and III were used. Plasmid DNAs were finally dissolved in 20 μl of TE buffer.
Bacterial transformation and plating on selective media.
Transformation of Escherichia coli JM109 with the plasmid preparations from V. cholerae was performed by electroporation. E. coli cells were prepared for electroporation according to the manufacturer's recommendations (Bio-Rad Laboratories, Richmond, Calif.). Approximately 20 to 50 ng of the plasmid preparations was used. Electroporated cells, after recovery, were screened for antibiotic resistance on LB plates containing different antibiotics. Transformants appearing on each selecting antibiotic plate were restreaked on the appropriate drug plates for confirmation.
PCR.
Primers qacEΔI-F and sul1-B (Table 1) were used in the PCR to identify class I integron-bearing strains of V. cholerae. In order to amplify the antibiotic resistance gene cassettes present in the class I integron-bearing strains, primers in-F (5′-CS) and in-B (3′-CS) (Table 1) were used. PCR amplifications were performed according to the method of Aarestrup et al. (1) with a few modifications. Fifty nanograms of genomic DNA was used as a template in the PCR, and Taq DNA polymerase (Promega) was used for amplification according to the manufacturer's instructions. For PCR with the qacEΔ1-F and sul1-B primers, the annealing temperature was kept at 58°C, and an extension time of 1 min was used. Strains yielding a 0.8-kb PCR product with the class I primers were used further for PCR with the integron primers in-F and in-B. These primers amplify the region between the 5′-CS and the 3′-CS, yielding products of various sizes, depending upon the length of the inserted gene cassettes. For PCR with this second set of primers, an annealing temperature of 55°C was used, and the extension in each cycle was carried out for 2.5 min. A 0.2-kb ladder (Promega) was used as the molecular size marker during electrophoresis of PCR products. All amplicons obtained with the integron primers in-F and in-B were sequenced to identify the antibiotic resistance gene cassettes.
DNA sequencing.
Amplified products, after PCR amplification, were separated by electrophoresis. The bands of interest were cut out, and DNA was eluted with a QIA Quick gel extraction kit (Qiagen, Hilden, Germany). Nucleotide sequences were determined by the ABI Prism 310 genetic analyzer by using the Big Dye Terminator kit (Applied Biosystems). The identities of the sequences determined were established by comparing the sequences obtained with the gene sequences in databases by using the BLAST software (2).
PFGE.
Bacterial cells were grown in LB at 37°C, to an optical density at 600 nm of 0.9. Cells from 1.0-ml culture were harvested by centrifugation. The pellet was resuspended in suspension buffer (10 mM Tris-HCl [pH 7.2], 20 mM NaCl, 50 mM EDTA [pH 8.0]) and equilibrated for 10 min at 50°C. An equal volume of 2.0% agarose (Bio-Rad Low Melt Preparative grade), prewarmed to 50°C, was mixed and cast in a mold. Blocks were treated with 1.0 ml of lysozyme solution (1 mg of lysozyme per ml in 10 mM Tris-HCl [pH 7.2], 50 mM NaCl, 0.2% Na-deoxycholate, 0.5% Na-laurylsarcosinate) for 12 h at 37°C. After washing with sterile distilled water twice, blocks were incubated in 1.0 ml of proteinase K solution (1 mg of proteinase K per ml in 100 mM EDTA [pH 8.0], 0.2% Na-deoxycholate, 1% Na-laurylsarcosinate) for 12 h at 50°C. Blocks were washed four times for 1 h each at room temperature with 1.5 ml of 1× wash buffer (20 mM Tris-HCl [pH 8.0], 50 mM EDTA [pH 8.0]) and then stored in 0.1× wash buffer at 4°C until use. Before the gel was run, blocks were equilibrated in 0.5× TBE (45 mM Tris, 45 mM boric acid, 1 mM EDTA [pH 8.3]) for 1 h. A 1.0% agarose gel (Bio-Rad PFG certified grade) in 0.5× TBE was run in CHEF MAPPER (Bio-Rad) at a voltage gradient of 6 V/cm, temperature of 14°C, included angle of 120, separation range of 10 to 600 kb, initial switch time of 0.47s, and final switch time of 44.17 s, for 20 h 18 min, along with the Lambda Ladder PFG marker (New England Biolabs). The gel was stained with 1 μg of ethidium bromide per ml in 0.5× TBE for 30 min and photographed.
Nucleotide sequence accession numbers.
The nucleotide sequences of the aac(6′)-Ib, dfrA1, aadA1, In0, dfr12, and aadA2 (with 5′-CS and 3′-CS), dfrA1, and an unknown gene, dfr5, as well as ereA2 and open reading frame III (ORFIII) and partial 3′-CS have been assigned GenBank accession no. AY103455, AY103456, AY103457, AY103458, AY103459, AY103460, AF455254, AF512546, and AF512547, respectively.
RESULTS
Antimicrobial susceptibility.
Analysis of the antimicrobial resistance patterns of the 94 non-O1, non-O139 strains of V. cholerae revealed that most of the strains were multidrug resistant. The number of strains exhibiting different combinations of drug resistance is shown in Table 2. Ninety strains were resistant to furazolidone, 88 were resistant to ampicillin, 53 were resistant to neomycin, 41 were resistant to sulfonamide, 41 were resistant to trimethoprim, 40 were resistant to nalidixic acid, 38 were resistant to ciprofloxacin, 38 were resistant to streptomycin, 31 were resistant to chloramphenicol, 20 were resistant to tetracycline, and 11 were resistant to gentamicin. Out of the 17 environmental strains, 15 displayed resistance to two or more antibiotics; 9 were resistant to ampicillin, furazolidone, and neomycin; 4 were resistant to ampicillin and furazolidone; 1 was resistant to ampicillin, furazolidone, neomycin, and streptomycin; and 1 other was resistant to ampicillin, neomycin, streptomycin, and sulfonamide. Of the two remaining strains, one was resistant to ciprofloxacin only, while the other was sensitive to all 11 antibiotics tested. Resistance to multiple drugs was found to be more common among the clinical isolates.
TABLE 2.
Multidrug resistance combinations in isolates of non-O1, non-O139 V. cholerae
| Serial no. | No. of strainsa | Resistanceb
|
||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AMP | CHL | CIP | FUR | GEN | NEO | NAL | STR | SUF | TET | TMP | ||
| 1 | 3 | + | + | + | + | + | + | + | + | + | + | + |
| 2 | 3 | + | + | + | + | − | + | + | + | + | + | + |
| 3 | 4 | + | + | + | + | + | − | + | + | + | + | + |
| 4 | 1 | + | + | + | + | + | + | + | + | + | − | + |
| 5 | 1 | + | + | − | + | − | + | + | + | + | + | + |
| 6 | 1 | + | + | − | + | + | + | + | + | + | − | + |
| 7 | 1 | + | + | + | + | − | − | + | + | + | + | + |
| 8 | 3 | + | + | + | + | − | + | + | + | + | − | + |
| 9 | 1 | + | + | + | + | + | − | + | + | + | − | + |
| 10 | 1 | + | − | + | + | − | + | + | + | − | + | + |
| 11 | 1 | + | − | + | + | − | + | + | + | + | − | + |
| 12 | 1 | + | + | − | + | − | + | − | + | + | + | + |
| 13 | 1 | + | + | − | + | + | − | + | + | + | − | + |
| 14 | 1 | + | + | + | + | − | + | + | − | − | + | + |
| 15 | 1 | + | + | + | + | − | − | + | − | + | + | + |
| 16 | 1 | + | + | + | + | − | − | + | + | + | − | + |
| 17 | 1 | + | + | + | + | − | + | + | − | + | − | + |
| 18 | 1 | − | + | + | + | − | + | + | − | + | + | + |
| 19 | 1 | + | − | − | + | − | + | + | + | + | − | + |
| 20 | 1 | + | + | + | + | − | − | + | − | + | − | + |
| 21 | 1 | + | − | + | + | − | − | + | + | + | − | + |
| 22 | 1 | + | − | + | + | − | + | − | + | + | − | + |
| 23 | 1 | + | − | + | + | − | − | + | + | − | − | + |
| 24 | 1 | + | − | + | + | − | − | + | − | + | − | + |
| 25 | 1 | + | − | + | + | − | + | − | + | + | − | − |
| 26 | 1 | + | − | − | + | − | − | + | + | + | − | + |
| 27 | 1 | + | + | + | + | − | − | + | − | − | + | − |
| 28 | 2 | + | − | + | + | − | + | − | + | + | − | − |
| 29 | 1 | − | + | − | + | − | + | − | + | + | − | + |
| 30 | 1 | + | + | + | + | − | − | + | − | − | − | − |
| 31 | 1 | + | − | + | + | − | + | + | − | − | − | − |
| 32 | 1 | + | − | − | + | − | + | + | − | − | − | + |
| 33 | 1 | + | − | − | + | − | + | − | − | + | − | + |
| 34 | 1 | + | + | + | + | − | − | − | − | − | + | − |
| 35 | 1 | + | + | + | + | − | + | − | − | − | − | − |
| 36 | 1 | + | − | − | + | − | − | + | − | + | − | + |
| 37 | 1 | + | − | − | + | − | − | + | + | + | − | − |
| 38 | 1 | + | − | − | + | − | + | − | − | − | + | − |
| 39 | 2 | + | − | − | + | − | − | − | − | + | − | + |
| 40 | 1 | − | + | − | + | − | − | + | + | − | − | − |
| 41 | 1 | + | − | + | + | − | + | − | − | − | − | − |
| 42 | 1 | − | − | − | + | − | − | + | − | + | − | + |
| 43c | 1 | + | − | − | − | − | + | − | + | + | − | − |
| 44d | 2 | + | − | − | + | − | + | − | + | − | − | − |
| 45 | 1 | + | − | − | + | − | − | − | − | + | − | − |
| 46 | 1 | + | − | − | + | − | − | − | + | − | − | − |
| 47d | 20 | + | − | − | + | − | + | − | − | − | − | − |
| 48d | 12 | + | − | − | + | − | − | − | − | − | − | − |
| 49 | 1 | + | − | − | − | − | − | − | − | − | − | − |
| 50c | 1 | − | − | + | − | − | − | − | − | − | − | − |
| 51 | 1 | − | − | − | − | − | − | − | − | − | − | − |
| 52c | 1 | − | − | − | − | − | − | − | − | − | − | − |
Total number of strains with a particular combination of antibiotic resistance.
AMP, ampicillin; CHL, chloramphenicol; CIP, ciprofloxacin; FUR, furazolidone; GEN, gentamicin; NEO, neomycin; NAL, nalidixic acid; STR, streptomycin; SUF, sulfamethizole-sulfadiazine; TET, tetracycline; TMP, trimethoprim.
Environmental isolate.
One of 2 serial no. 44, 9 of 20 serial no. 47, and 4 of 12 serial no. 48 strains are environmental isolates.
Ribotyping and genotyping.
Most of the V. cholerae strains used in this study belonged to diverse ribotypes. The ribotypes of V. cholerae strains containing class I integrons were analyzed for relatedness between these strains. Except for a few, most strains were found to have distinct ribotypes. Interestingly two strains, viz. PL149b and PL78/6, belonging to two different serogroups were found to have identical ribotypes. The genotypes of the class I integron-containing strains were also analyzed with respect to the toxR, toxT, RS1, hlyA, and hlyU genes (Table 3), but no overall corelationship among ribotypes, drug resistance profiles, and the presence of these genes could be established.
TABLE 3.
Phenotypic and genotypic characterization of non-O1, non-O139 V. cholerae strains containing the class I integron
| Seial no.a | Strainb | Serogroup designation | Date of isolation (day/mo/yr) | Antibiogramc | Class 1 integron ORF size (kb) | Encoded antibiotic resistanced | Presence of:
|
||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Plasmid(s) | toxR | toxT | RS1 | hlyA | hlyU | SXT int | |||||||
| 1 | PG224 | NDe | 10/9/98 | AMP, CIP, FUR, NAL, SUF, TMP | 1.25 | dfrA1-TMP | − | + | − | − | + | + | − |
| 2 | PL134 | O2 | 01/9/98 | FUR, NAL, SUF, TMP | 1.25 | dfrA1-TMP | − | + | − | − | + | + | − |
| 3 | PL141 | O2 | 02/9/98 | CHL, CIP, FUR, NEO, NAL, SUF, TET, TMP | 1.25 | dfrA1-TMP | − | + | − | − | + | + | − |
| 4 | PG9 | O37 | 10/3/98 | AMP, FUR, NEO, NAL, STR, SUF, TMP | 1.25 | dfrA1-TMP | + | + | − | + | − | + | − |
| 5 | PG92 | O37 | 25/6/98 | AMP, FUR, NAL, SUF, TMP | 1.25 | dfrA1-TMP | + | + | − | + | + | + | − |
| 6 | PL78/6 | O2 | 30/7/98 | AMP, CHL, CIP, FUR, GEN, NEO, NAL, STR, SUF, TET, TMP | 1.25 | dfrA1-TMP | + | − | − | + | + | + | + |
| 7 | PG149b | O144 | 06/8/98 | AMP, CHL, CIP, FUR, NAL, STR, SUF, TET, TMP | ∼3.0 | ND | + | − | − | − | + | − | + |
| 8 | PG262(b) | O151 | 24/9/98 | AMP, CHL, FUR, GEN, NEO, NAL, STR, SUF, TMP | 1.25 | dfrA1-TMP | + | − | − | − | − | − | + |
| 9 | PG95 | O2 | 29/6/98 | CHL, FUR, NAL, STR, SUF, TMP | 1.25 | dfrA1-TMP | − | − | − | − | + | + | + |
| 10 | PL105b | O130 | 10/8/98 | AMP, CHL, FUR, GEN, NEO, NAL, STR, SUF, TMP | 1.25 | dfrA1-TMP | + | − | − | − | − | − | + |
| 11 | AS438 | O62 | 17/7/97 | AMP, CIP, FUR, NEO, NAL, STR, SUF, TMP | 1.25 | dfrA1-TMP | − | − | − | − | − | − | − |
| 12 | PG149a | O19 | 06/8/98 | AMP, CHL, FUR, NAL, STR, SUF, TET, TMP | 1.25 | dfrA1-TMP | − | − | − | − | − | − | − |
| 13 | PL96 | O150 | 14/8/98 | AMP, FUR, SUF, TMP | 0.7 | dfrA15-TMP | + | + | − | − | + | + | + |
| 14 | PG153/1 | R | 11/8/98 | AMP, CHL, CIP, FUR, NAL, SUF, TMP | 2.0 | dfrA5-TMP, ereA2-ERY | + | − | − | − | − | − | − |
| 15 | PG170 | ND | 20/8/98 | AMP, CHL, CIP, FUR, GEN, NAL, STR, SUF, TET, TMP | 0.7 | dfrA15-TMP | + | − | − | + | − | − | − |
| 0.85 | aac(6′)-Ib-AMK | ||||||||||||
| 16 | PL107b | ND | 19/8/98 | AMP, CHL, CIP, FUR, GEN, NEO, NAL, STR, SUF, TMP | 0.85 | aac(6′)-Ib-AMK | + | − | − | + | − | − | − |
| 17 | AS482 | O26 | 12/8/97 | AMP, FUR, NAL, STR, SUF | 1.0 | aadA1-S | − | + | − | + | + | + | − |
| 18 | AS634 | O39 | 25/11/97 | AMP, FUR, NEO, STR, SUF, TMP | 1.0 | aadA1-S | + | − | − | − | − | − | − |
| 19 | PL1 | O8 | 20/2/98 | AMP, CIP, FUR, NAL, STR, SUF, TMP | 1.25 | dfrA1-TMP | + | + | − | − | + | + | − |
| 1.0 | aadA1-S | ||||||||||||
| 20 | PL61 | O2 | 14/7/98 | AMP, CHL, CIP, FUR, GEN, NAL, STR, SUF, TET, TMP | 1.25 | dfrA1-TMP | + | − | − | − | − | − | + |
| 2.0 | aadA2-S | ||||||||||||
| 21 | PL91 | O110 | 11/8/98 | AMP, NAL, STR, SUF, TET, TMP | ≤0.2 | + | − | − | − | − | − | − | |
| 22 | PL107/4 | ND | 20/8/98 | AMP, CHL, CIP, FUR, GEN, NEO, NAL, STR, SUF, TET, TMP | ND | − | − | − | − | − | − | − | |
Strains at serial no. 8 to 22 belong to different ribotypes, distinct from one another.
Strains PG224, PL134, and PL141 had identical ribotypes; strains PG9 and PG92 had identical ribotypes; and strains PL78/6 and PG149b had identical ribotypes.
Drug names are abbreviated as in Table 2.
S, streptomycin, spectinomycin; ERY, erythromycin; AMK, amikacin.
ND, not determined.
PCR mapping of antibiotic resistance gene cassettes of class I integrons.
A 0.8-kb 3′-CS PCR product was obtained from 22 of the 94 strains used in this study with the primers qacEΔ1-F and sul1-B. This product was then sequenced by using the same set of primers to confirm the existence of the qacEΔ1 and sul1 genes, found at the 3′-CS of the class I integrons in the 0.8-kb amplicon (22, 24, 27, 29, 32). All 22 isolates were of clinical origin. When the primers in-F and in-B were used to amplify the class I integron gene cassettes from these strains, at least five distinct products could be identified (see Fig. 2 and Table 3). Thirteen of 22 strains produced a 1.25-kb amplicon that was found to contain, by sequence analysis, the dfrA1 gene for trimethoprim resistance and orfC (24). Two strains had a 0.73-kb gene cassette, which upon sequence analysis showed the presence of the dfrA15 gene for trimethoprim resistance. Both the 1.25-kb amplicon and the 0.73-kb amplicon showed complete identity to the integron cassettes described by Dalsgaard et al. (9). The third amplicon obtained in three clinical isolates, was a 1-kb product that contains the aadA1 gene for aminoglycoside resistance (30). Sequence analysis of a 0.85-kb product obtained from two strains, PG170 and P107b, revealed the presence of the aac(6′)-Ib gene, which codes for aminoglycoside 6′-N-acetyltransferase. It showed complete identity with the aac(6′)-Ib gene of class I integrons described in K. pneumonia plasmid pY2 (accession no. AF227505). A 2-kb amplicon was obtained from two strains, namely PG153/1 and PL61, used in this study. Sequence analysis of the 2-kb amplicon from PG153/1 revealed that it had two ORFs: one containing dfrA5 for trimethoprim resistance (28) and the other containing ereA2 for erythromycin resistance (accession no. AF099140). The ORF for dfrA5 was present immediately downstream of the integrase I and upstream of the ereA2 gene, at the 3′ end of the class I integron. Sequencing of the 2-kb amplicon from PL61 revealed the presence of the dfrA12 and aadA2 genes. A similar amplicon has been reported in the class I integron of Serratia marcescens (accession no. AF284063). Strain PL91 (Table 3) had a ≤0.2-kb amplicon, which upon sequencing was found to be a class I integron element without any gene cassette in it. A similar integron element called In0 in a Pseudomonas aeruginosa plasmid was described earlier (4). The nucelotide sequence of the 3-kb amplicon obtained from strain PG149b, obtained with the primer in-B (Table 3), showed identity to an unidentified ORF, ORFIII, present in a 5-kb class I integron cassette of the Acinetobacter sp. genome (accession no. AF369871). This ORF has also been reported in P. aeruginosa (accession no. AY029772) (18) and S. marcescens (accession no. AY030343). However, the 5′ end of the nucleotide sequence obtained with the in-F primer showed no identity to the 5′-CS of class I integrons. Another interesting strain was PL107/4 (Table 3). Although this strain had the 3′-CS of the class I integron, as confirmed by nucleic acid sequencing of the 0.8-kb PCR product by using the primers qacEΔ1-F and sul1-B, no amplicon could be generated with in-F and in-B primers under the same conditions; a long PCR protocol may be necessary. It may be mentioned here that recently a hybrid integron has been described in Acinetobacter baumannii, which has the 3′-CS of class I integrons and the 5′ intI2 of class II integrons (23). It would be of interest to see if the integrons present in PL107/4 and PG149b are also hybrid integrons.
FIG. 2.
Schematic representation of different types of gene cassettes identified in class I integrons in non-01, non-0139 strains of V. cholerae. The gene cassettes are represented by solid lines, and their 59-base elements are represented by solid circles. A hatched box represents the att1 recombination site. The bottom panel shows the locations of the 5′- and 3′-CS of class 1 integrons and those of the primers in-F, in-B, qacEΔ1-F, and sul1-B.
Plasmid profile and antibiotic resistance conferred by plasmids.
Examination of the plasmid profiles of the 94 strains showed that 43 strains carried plasmids. Fourteen of the plasmid-bearing strains were found to contain class I integrons also. Most of these strains had high-molecular-weight plasmids, but some carried small plasmids as well, besides the large ones (data not shown). By PFGE and hybridization analysis, 8 of the plasmid-bearing strains, namely PG262b, PL61, PL91, PL107b, PL78/6, PL105b, PG170, and PG149b, were found to have class I integrons on the plasmids (described below). Out of these, three strains, viz. PL61, PL105b, and PL91, had integrons both on the chromosome and on the plasmids (Fig. 1). Interestingly when the genomic DNAs from these three strains were PCR amplified with in-F and in-B primers, only one amplicon could be obtained from both PL105b and PL91 in repeated attempts, while two amplicons were produced by PL61 (Table 3). A possible explanation for this apparent anomaly could be that either the same integron cassettes—dfrA1 (for PL105b) and the “null” cassette, In0 (for PL91)—were present on both the chromosome and the plasmid or that under the PCR condition used, only one integron cassette could be amplified. Electroporation of E. coli JM109 by the plasmids from these strains conferred resistance to a few antibiotics in the transformants, as shown in Table 4.
FIG. 1.
(A) Separation of large plasmids from chromosomal DNA by PFGE. Lanes1 to 14, strains PG262b, PG149b, PL78/6, PG9, PG92, PG153/1, PG170, PL1, PL61, PL96, PL105b, PL107b, AS634, and PL91, respectively. Lane M, lambda ladder molecular size marker. The positions of 50- to 450-kb bands are shown. (B) Autoradiogram of the gel described above hybridized with class I integron-specific probe. Arrows indicate the positions of the bands, which, although faint, were clearly visible on the autoradiogram.
TABLE 4.
Antibiotic resistance markers present on plasmids obtained from V. cholerae strains carrying class I integrons on plasmids
| Serial no. | Strain name | Size of class I integron-containing plasmids identified by PFGE | Antibiogram ofa:
|
Antibiotic resistance gene(s) carried by class I integrons on V. cholerae plasmid | |
|---|---|---|---|---|---|
| V. cholerae parent strains | E. coli JM109 transformantsb | ||||
| 1 | PG262(b) | 370 | AMP, CIP, FUR, GEN, NEO, NAL, STR, SUL, TMP | STR, SUF, TMP | dfrA1-TMP |
| 2 | PL61 | 370 | AMP, CHL, CIP, FUR, GEN, NAL, STR, SUF, TET, TMP | AMP, CHL, GEN, STR, SUF, TMP | dfrA1, dfrA12-TMP, aadA2-S* |
| 3 | PL107(b) | 165 | AMP, CHL, CIP, FUR, GEN, NEO, NAL, STR, SUF, TMP | AMP, STR, SUF, TMP | aac(6′)-Ib-AMK |
| 4 | PG170 | 315, 50 | AMP, CHL, CIF, FUR, GEN, NAL, STR, SUF, TET, TMP | SUF, TET, TMP | dfrA15-Tr, aac(6′)- Ib-AMK |
| 5 | PL78/6 | 240 | AMP, CHL, CIF, FUR, GEN, NEO, NAL, STR, SUF, TET, TMP | AMP, STR, SUF | dfrA1-TMP |
| 6 | PL105(b) | 370 | AMP, CHL, FUR, GEN, NEO, NAL, STR, SUF, TET, TMP | AMP, GEN, NEO, STR, SUF, TET | dfrA1-TMP |
| 7 | PG149(b) | 355 | AMP, CHL, CIF, FUR, NAL, STR, SUF, TET, TMP | AMP, STR, SUF, TMP | NDc |
Drug names are abbreviated as in Table 2.
Antibiogram of E. coli JM109 after transformation with plasmid preparations from V. cholerae strains mentioned in the second column.
ND, not determined.
In the strain PG262(b), because trimethoprim resistance and sulfonamide resistance are due to the dfrA1 and the sul-1 genes of the class I integron present on the 370-kb plasmid in the strain, transfer of only the streptomycin resistance to the E. coli recipient besides the above two markers indicated that the resistance of the parent strain to the other antibiotics was due to other undetermined factors. In contrast, a plasmid preparation from PL61 conferred upon E. coli resistance to ampicillin, chlaromphenicol, and gentamicin besides that to trimethoprim and streptomycin. Because the class I integron contained in the 370-kb plasmid of PL61 carried the gene cassettes dfrA12 and addA2, which confer resistance to only trimethoprim and streptomycin, it could be inferred that the plasmids in PL61 carried genes responsible for resistance to ampicillin, chloramphenicol, and gentamicin as well. It was not determined whether all of these drug-resistant determinants resided on the 370-kb megaplasmid or were carried by other small plasmids present in the total plasmid preparation. The E. coli JM109 colonies transformed with PL107(b) plasmids were resistant to ampicillin, streptomycin, and trimethoprim in addition to sulfonamide, the resistance against which was conferred by the class I integron residing on the 165-kb plasmid of this strain. Hence, here it was also concluded that, as in the other cases, the plasmid preparation from PL107b contained genes conferring resistance to ampicillin, streptomycin, and trimethoprim. Once again, it was not known whether they were located on the megaplasmid. Similarly the plasmid preparation from PG170 conferred resistance to tetracyline in addition to resistance to sulfonamide and trimethoprim, which were due to the class I integrons residing on the plasmids. Plasmids of PL78/6 did not confer trimethoprim resistance to E. coli, but bestowed upon it resistance to ampicillin, streptomycin, and sulfonamide. This result was quite surprising, because in this strain, the class I integron residing on the plasmid had the dfrA1 gene cassette, and the plasmid could be recovered from the E. coli transformant, eliminating the possibility that it was getting degraded in E. coli.
Similarly, a plasmid preparation from PL105b conferred upon the recipient E. coli strain resistance to ampicillin, gentamicin, neomycin, streptomycin, sulfonamide, and tetracycline, but not to trimethoprim, despite the presence of the dfrA1 gene on the class I integron in this strain. Since PL105b was shown to have class I integrons on both the chromosome and the plasmid (described below), one trivial explanation for this result could be that the dfrA1 gene on the plasmid is nonfunctional or that the integron cassette of this plasmid could not be amplified under the PCR conditions used. However, no such explanation can be proffered for strain PL78/6, which is trimethoprim resistant and in which dfrA1 resides only on the plasmid. Plasmids of PG149b conferred upon E. coli JM109 resistance to ampicillin, streptomycin, sulfonamide, and trimethoprim. However, as discussed in the last section, the nature of the antibiotic resistance genes contained in the class I integron of this strain could not be identified. In repeated attempts, E. coli JM109 could not be transformed by plasmids of strain PL91, in which the class I integron resides only on the 169-kb plasmid (described below).
PFGE.
On the basis of the results described in the previous sections, 14 plasmid-bearing strains positive for class I integrons were subjected to PFGE to separate the large plasmids from the chromosomes (Fig. 1A). Upon Southern hybridization with the 3′ conserved region of class I integron as the probe, a band corresponding to chromosomal DNA lit up in all strains, except PG262(b), PG149(b), PL78/6, PL107(b), and PG170, in which a positive signal could be seen only with plasmid bands with sizes of 370, 355, 240, and 370 kb, respectively, in the first four strains and with two bands with sizes of 315 and 50 kb from PG170. This suggested that in these strains, class I integrons reside on the large plasmids (Fig. 1B). Interestingly, in three strains, namely PL61, PL105(b), and PL91, class 1 integrons were found on both the chromosomes and the large plasmids (Fig. 1B, lanes 9, 11, and 14).
Colony hybridization with SXT int probe.
Out of the 94 strains analyzed for the possible presence of SXT—a 62-kb conjugative transposon that is known to confer resistance to streptomycin, sulfonamide, and trimethoprim (32)—12 strains hybridized with the SXT int-specific probe in colony hybridization experiments, suggesting the presence of this element in these strains. The strains that were positive for SXT int were PG262b, PG149b, PG153, PG171b, PG95, PG58, PL105b, PL96, PL80, PL78/6, PL61, and PL30.
DISCUSSION
The present study deals with 94 non-O1, non-O139 strains of V. cholerae isolated in Calcutta, India, during 1997 to 1998, a period in which the isolation of these strains was on the increase (12). The antibiotic resistance pattern revealed that resistance to furazolidone and ampicillin was predominant. Resistance to tetracycline and gentamicin, although noticed in only a few strains, could be of significance, because the very presence of such resistance is an indication of the potential to spread. Significantly, multiple-antibiotic resistance was more common among the clinical isolates. Out of 94 strains, 22 contained class I integrons, in which 18 had only one type of cassette; 3 had 2 types; and 1 had none (Table 2).
The dfrA1 and dfrA15 gene cassettes, coding for trimethoprim resistance, found among several strains, have also been detected among the strains isolated in Thailand (9). Similarly, the aadA1 gene for aminoglycoside resistance (spectinomycin and streptomycin) found in three strains in our collection was detected by Falbo et al. (11) among the outbreak strains in Albania and Italy in 1994. Several gene cassettes were detected for the first time in V. cholerae: aac(6′)-Ib coding for amikacin resistance in PG170 and PL107b, ereA2 coding for erythromycin resistance in PG153/1, and dfrA5 and dfrA12 coding for trimethoprim resistance in PG153/1 and PL61, respectively. It is worth mentioning here that ereA2 has so far been reported only in Providencia stuartii (accession no. AF099140). A 3-kb amplicon obtained from one strain, PG149(b), which showed identity to ORFIII (accession no. AF369871), and had the 59-base elements and a small part of 3′-CS of class I integrons, but did not have the 5′-CS of the class I integron, has also been identified by us in a non-O1, non-O139 strain of V. cholerae isolated in June 2001 (our unpublished observation), suggesting that the existence of such strains may not be very rare.
All V. cholerae strains positive for class I integrons were resistant to multiple antibiotics. However, as our data showed, the presence of class I integrons could account for the resistance to only a few drugs. This leads to the obvious conclusion that there exist other determinants of antibiotic resistance in these strains. In a few cases in which it was examined, it was found that some of these “determinants” reside on plasmids (Table 4). Since 43 out of the 94 strains examined in this study carried plasmids, it is possible that many of these plasmids carry drug resistance genes, irrespective of whether they carry class I integrons. Furthermore, the presence of class I integrons on the plasmids of around 8% of the strains examined (8 of 94) indicated that large plasmids carrying integrons may not be very rare among the non-O1, non-O139 strains of V. cholerae.
Colony hybridization of the 94 strains with the SXT integrase (int)-specific probe identified 12 strains that were positive for the presence of SXT int gene. The integrase gene of SXT element was used as an SXT-specific probe, because it does not have homology with the nucleotide sequence of other similar genes in the database. Thus, the strains that were identified as having the SXT int gene could actually harbor the 62-kb SXT element. All of these strains, except PL96, exhibited a drug resistance pattern characteristic of the SXT element. PL96 did not show resistance to streptomycin, suggesting the presence of a defective gene on the SXT. Seven of the strains that appeared to harbor the SXT element (PG262b, PG149b, PL78/6, PG95, PL61, PL96, and PL105b) also carried the class I integron. Almost all of these had the dfrA gene for trimethoprim resistance. Thus, in these strains, trimethoprim resistance was conferred by both the SXT element and the class I integron. The strain PL61 had the aadA2 gene for streptomycin in addition to the dfrA1 and dfrA12 genes for trimethoprim. The presence of multiple determinants for trimethoprim resistance is alarming, because this drug is used for the treatment of cholera in children and pregnant women. The presence of an ereA2 gene cassette is also of concern, because erythromycin also is used in the treatment of cholera in children.
Most of the strains included in the study were heterogeneous with respect to their serogroups and ribotypes, as well as a few genotypic markers examined: toxR, toxT, RS1, hlyA, and hlyU. V. cholerae strains PG224, PL134, and PL141 belonged to the same ribotype and displayed an identical genotype with respect to the markers mentioned above. Both PL134 and PL141 belonged to serogroup O2; the serotype of PG224 was not known. All three strains had class I integrons with a 1.25-kb cassette containing a dfrA1 gene for trimethoprim resistance and orfC (24). Although the antibiotic resistance patterns of these strains were not identical, it appeared from observations described above that these three isolates could have a common origin. In contrast, the strains PG9 and PG92, although they belonged to the same serogroup, displayed identical ribotypes, and had identical class I integron cassettes, differed from each other not only with respect to their antibiograms, but also with respect to their genotypes. V. cholerae strains PL78/6 and PG149b constituted an interesting pair in the sense that although they both had identical ribotypes and harbored the SXT element, they differed in all other attributes examined, including their class I integron cassette structure. Our findings thus showed that class I integrons, SXT elements, and plasmids bearing drug resistance markers were distributed fairly widely in the non-O1, non-O139 strains of V. cholerae, isolated from patients admitted into the Infectious Diseases Hospital, Calcutta, India. It also revealed for the first time the presence of gene cassettes, aac(6′)-Ib, dfrA5, dfrA12, and ereA2, and also possibly a hybrid integron in V. cholerae. Since there are more and more reports of cholera-like diarrhea being caused by non-O1 strains (27), and since these strains appear to survive better than O1 strains in a wide range of foods (25), it is important to monitor the distribution of integrons and SXTs in emerging strains of V. cholerae.
Acknowledgments
Financial support was received from the Department of Biotechnology and Council of Scientific & Industrial Research, Government of India.
M. Thungapathra gratefully acknowledges the Council of Scientific & Industrial Research, Government of India, for a Senior Research Associateship under the Scientists' Pool Scheme.
REFERENCES
- 1.Aarestrup, F. M., P. Ahrens, M. Madsen, L. V. Pallesen, R. L. Poulsen, and H. Westh. 1996. Glycopeptide susceptibility among Danish Enterococcus faecium and Enterococcus faecalis isolates of animal and human origin and PCR identification of genes within the VanA cluster. Antimicrob. Agents Chemother. 40:1938-1940. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410. [DOI] [PubMed] [Google Scholar]
- 3.Bhattacharya, M. K., D. Dutta, S. K. Bhattacharya, A. Deb, A. K. Mukhopadhyaya, G. B. Nair, T. Shimada, Y. Takeda, A. Chawdhury, and D. Mahalanabes. 1998. Association of a disease approximating cholera caused by Vibrio cholerae of serogroups other than O1 and O139. Epidemiol. Infect. 120:1-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Bissonnette, L., and P. H. Roy. 1992. Characterization of In0 of Pseudomonas aeruginosa plasmid pVS1, an ancestor of integrons of multiresistance plasmids and transposons of gram-negative bacteria. J. Bacteriol. 174:1248-1257. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Chakraborty, S., Pallavi Garg, T. Ramamurthy, M. Thungapathra, J. K. Gautam, C. Kumar, S. Maiti, S. Yamaski, T. Shimada, Y. Takeda, A. Ghosh, and G. Balakrish Nair. 2001. Comparison of antibiogram, virulence genes, ribotypes and DNA fingerprints of Vibrio cholerae of matching serogroups isolated from hospitalized diarrhoea cases and from the environment during 1997-98 in Calcutta, India. J. Med. Microbiol. 50:879-888. [DOI] [PubMed] [Google Scholar]
- 6.Collis, C. M., G. Grammaticopoulos, J. Briton, H. W. Stokes, and R. M. Hall. 1993. Site-specific insertion of gene cassettes into integrons. Mol. Microbiol. 9:41-52. [DOI] [PubMed] [Google Scholar]
- 7.Dalsgaard, A., A. Forslund, D. Bodhidatta, C. Serichantalergs, L. Pitarangsi, T. Pang, T. Shimada, and P. Echeverria. 1999. A. high proportion of V. cholerae isolated from children with diarrhoea in Bangkok, Thailand are multiple antibiotic resistant and belong to heterogeneous non-O1, non-O139 O-serotypes. Epidemiol. Infect. 122:217-226. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Dalsgaard, A., A. Forslund, N. V. Tam, D. X. Vinh, and P. D. Cam. 1999. Cholera in Vietnam: changes in genotypes and emergence of class I integrons containing aminoglycoside resistance gene cassettes in Vibrio cholerae or strains isolated from 1979 to 1996. J. Clin. Microbiol. 37:734-741. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Dalsgaard, A., A. Forslund, O. Serichantalergs, and D. Sandvang. 2000. Distribution and content of class 1 integrons in different Vibrio cholerae O-serotype strains isolated in Thailand. Antimicrob. Agents Chemother. 44:1315-1321. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Dalsgaard, A., A. Forslund, A. Petersen, D. J. Brown, F. Dias, S. Monteiro, K. Molbak, P. Aaby, A. Rodrigues, and A. Sandstrom. 2000. Class I integron-borne, multiple antibiotic resistance encoded by a 150-kilobase conjugative plasmid in epidemic Vibrio cholerae O1 strains isolated in Guinea-Bissau. J. Clin. Microbiol. 38:3774-3779. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Falbo, V., A. Carattoli, F. Tosini, C. Pezzella, A. M. Dionisi, and I. Luzzi. 1999. Antibiotic resistance conferred by a conjugative plasmid and a class I integron in Vibrio cholerae O1 El Tor strains isolated in Albania and Italy. Antimicrob. Agents Chemother. 43:693-696. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Garg, P., T. Ramamurthy, A. Ghosh, S. K. Bhattacharya, Y. Takeda, and G. B. Nair. 1998. Molecular shifts within clonal populations of Vibrio cholerae O1 and O139 and its impact on the persistence and spread of cholera, p. 43-49. In S. Gupta and O. P. Sood (ed.), Molecular intervention in disease. Fifth Annual Ranbaxy Science Foundation Symposium, New Delhi, India.
- 13.Hall, R. M., and H. W. Stokes. 1993. Integrons: novel DNA elements which capture genes by site-specific recombination. Genetica 90:115-132. [DOI] [PubMed] [Google Scholar]
- 14.Hall, R. M., and C. M. Collis. 1995. Mobile gene cassettes and integrons: capture and spread of genes by site specific recombination. Mol. Microbiol. 15:593-600. [DOI] [PubMed] [Google Scholar]
- 15.Hannecart-Pokorni, E., F. Depuydt, L. De Wit, E. Van Bossuyt, J. Content, and R. Vanhoof. 1997. Characterization of the 6′-N-aminoglycoside acetyltransferase gene aac(6′)-Il associated with a sulI-type integron. Antimicrob. Agents Chemother. 41:314-318. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Jones, M. E., E. Peters, A. M. Weersink, A. Fluit, and J. Verhoef. 1997. Widespread occurrence of integrons causing multiple antibiotic resistance in bacteria. Lancet 349:1742-1743. [DOI] [PubMed] [Google Scholar]
- 17.Kazama, H., H. Hamashima, M. Sasatsu, and T. Arai. 1998. Distribution of the antiseptic resistance genes qacE and qacE1 in Gram-negative bacteria. FEMS Microbiol. Lett. 59:173-178. [DOI] [PubMed] [Google Scholar]
- 18.Lee, K., J. B. Lim, J. H. Yum, D. Yong, Y. Chong, J. M. Kim, and D. M. Livermore. 2002. blaVIM-2 cassette containing novel integrons in metallo-β-lactamase-producing Pseudomonas aeruginosa and Pseudomonas putida isolates disseminated in a Korean hospital. Antimicrob. Agents Chemother. 46:1053-1058. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Morris, J. G. 1990. Non-O1 group Vibrio cholerae. A look at the epidemiology of an occasional pathogen. Epidemiol. Rev. 12:179-191. [DOI] [PubMed] [Google Scholar]
- 20.Mukhopadhyay, A. K., S. Garg, R. Mitra, A. Basu, K. Rajendran, D. Dutta, S. K. Bhattacharya, T. Shimada, T. Takeda, Y. Takeda, and G. B. Nair. 1996. Temporal shifts in traits of Vibrio cholerae strains isolated from hospitalized patients in Calcutta: a 3-year (1993 to 1995) analysis. J. Clin. Microbiol. 34:2537-2543. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Murray, M. G., and W. F. Thompson. 1980. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8:4321-4325. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Paulsen, I. T., T. G. Littlejohn, P. Rådström, L. Sundström, O. Sköld, G. Swedberg, and R. A. Skurray. 1993. The 3′ conserved segment of integrons contains a gene associated with multidrug resistance to antiseptics and disinfectants. Antimicrob. Agents Chemother. 37:761-768. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Ploy, M.-C., F. Denis, P. Courvalin, and T. Lambert. 2000. Molecular characterization of integrons in Acinetobacter baumannii: description of a hybrid class 2 integron. Antimicrob. Agents Chemother. 44:2684-2688. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Recchia, G. D., and R. M. Hall. 1995. Gene cassettes: a new class of mobile element. Microbiology 141:3015-3027. [DOI] [PubMed] [Google Scholar]
- 25.Roberts, D., and R. J. Gilbert. 1979. Survival and growth of non-cholera vibrios in various foods. J. Hyg. 82:123-131. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
- 27.Sharma, C., M. Thungapathra, A. Ghosh, A. K. Mukhopadhyay, A. Basu, R. Mitra, I. Basu, S. K. Bhattacharya, T. Shimada, T. Ramamurthy, T. Takeda, S. Yamasaki, Y. Takeda, and G. B. Nair. 1998. Molecular analysis of non-O1, non-O139 Vibrio cholerae associated with an unusual upsurge in the incidence of cholera-like disease in Calcutta, India. J. Clin. Microbiol. 36:756-763. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Sundstrom, L., P. Radstrom, G. Swedberg, and O. Skold. 1988. Site specific recombination promotes linkage between trimethoprim and sulfonamide resistance genes. Sequence determination of dhfrV and sul1 and a recombination active locus of Tn21. Mol. Gen. Genet. 213:191-201. [DOI] [PubMed] [Google Scholar]
- 29.Sundstrom, L. 1998. The potential of integrons and connected programmed rearrangements for mediating horizontal gene transfer. APMIS 84:37-42. [DOI] [PubMed] [Google Scholar]
- 30.Tosini, F., P. Visca, I. Luzzi, A. M. Dionisi, C. Pezzella, A. Petrucca, and A. Carattoli. 1998. Class I integron-borne multiple-antibiotic resistance carried by IncFI and IncL/M plasmids in Salmonella enterica serotype Typhimurium. Antimicrob. Agents Chemother. 42:3053-3058. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Waldor, M. K., and J. J. Mekalanos. 1996. Lysogenic conversion by a filamentous phage encoding cholera toxin. Science 272:1910-1914. [DOI] [PubMed] [Google Scholar]
- 32.Waldor, M. K., H. Tschäpe, and J. J. Mekalanos. 1996. A new type of conjugative transposon encodes resistance to sulfamethoxazole, trimethoprim, and streptomycin in Vibrio cholerae O139. J. Bacteriol. 178:4157-4165. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.World Health Organization. 1993. Guidelines for cholera control. World Health Organization, Geneva, Switzerland.