Abstract
Infections by the fish-borne liver flukes Opisthorchis viverrini and Clonorchis sinensis can lead to bile duct cancer. These neglected tropical disease pathogens occur in East Asia, with O. viverrini primarily in Thailand and Laos and C. sinensis in Cambodia, Vietnam, and China. Genomic information about these pathogens holds the potential to improve disease treatment and control. Transcriptome analysis indicates that mobile genetic elements are active in O. viverrini, including a novel non-Long Terminal Repeat (LTR) retrotransposon. A consensus sequence of this element, termed OV-RTE-1, was assembled from expressed sequence tags and PCR amplified genomic DNA. OV-RTE-1 was 3,330 bp in length, encoded 1,101 amino acid residues and exhibited hallmark structures and sequences of non-LTR retrotransposons including a single open reading frame encoding apurinic-apyrimidinic endonuclease (EN) and reverse transcriptase (RT). Phylogenetic analyses confirmed that OV-RTE-1 was member of the RTE clade of non-LTR retrotransposons. OV-RTE-1 is the first non-LTR retrotransposon characterized from the trematode family Opisthorchiidae. Sequences of OV-RTE-1 were targeted to develop a diagnostic tool for detection of infection by O. viverrini. PCR specific primers for detection of O. viverrini DNA showed 100% specificity and sensitivity for detection of as little as five femtograms of O. viverrini DNA whereas the PCR based approach showed 62% sensitivity and 100% specificity with clinical stool samples. The OV-RTE-1 specific PCR could be developed as a molecular diagnostic for Opisthorchis infection targeting parasite eggs in stool samples, especially in regions of mixed infection of O. viverrini and/or C. sinensis and minute intestinal flukes.
Keywords: Opisthorchis viverrini, liver fluke, retrotransposon, diagnosis, feces
1. Introduction
Human liver flukes of the family Opisthorchiidae, including Clonorchis sinensis, Opisthorchis felineus and O. viverrini infect >35 million people in East Asia, Siberia and Eastern Europe, and occasionally in countries of the western Europe including Italy (Mordvinov et al., 2012; Pozio et al., 2013; Sithithaworn et al., 2012; Sripa, 2012; Sripa et al., 2012). C. sinensis occurs in Korea, China, Taiwan, northern Vietnam and some regions of the far east of the former USSR, O. felineus is endemic in central Europe and Siberia, whereas O. viverrini distributes in Thailand, Laos PDR, Cambodia and southern Vietnam (Hong and Fang, 2012; Sithithaworn et al., 2012). Also, migration of C. sinensis beyond its more usual endemic range has been reported (Morsy and Al-Mathal, 2011; Traub et al., 2009). The geographical ranges of O. viverrini and C. sinensis partially overlap; co-endemic areas have been reported in central Vietnam (Le et al., 2006) and in central provinces of Thailand (Sithithaworn et al., 2012; Traub et al., 2009). Given that C. sinensis and O. viverrini may distribute to other sites beyond their usual geographic ranges, investigation of mixed infections of O. viverrini and C. sinensis is informative especially from epidemiological and evolutionary perspectives. Furthermore, with the recent establishment of Asean Economic Community (AEC), migration of people infected with these parasites will increase in the AEC. Accordingly, accuracy in the differential diagnosis of clonorchiasis and opisthorchiasis needs to be improved.
Microscopic examination of the egg of the parasite in feces is the standard method for diagnosis of infection with these opisthorchiid flukes (Sripa et al., 2010). However, the reliability of microscopic diagnosis targeting fecal eggs relies on the expertise of examiner. In addition, stool examination methods offer lower sensitivity than molecular detection approaches in the case of light infection (Carvalho et al., 2012; Duenngai et al., 2008). The eggs of O. viverrini, C. sinensis and O. felineus are very similar to each other, and indeed to eggs of small intestinal flukes such as Haplorchis taichui, thus creating diagnostic problems (Sripa et al., 2010). A number of PCR-based techniques using a multiplicity of gene targets including ribosomal DNA and mitochondrial genes can distinguish O. viverrini in the cases of mixed infections with C. sinensis and small intestinal flukes (Janwan et al., 2011; Le et al., 2006; Sato et al., 2009; Wongsawad et al., 2012). However, improved detection of opisthorchiasis and clonorchiasis in particular with high sensitivity, specificity and simplicity would be welcomed (Johansen et al., 2010; McCarthy et al., 2012).
The genomes of metazoan parasites generally include numerous copies of dispersed repetitive sequences or mobile genetic elements (MGE) (Brindley et al., 2003). MGEs are classified into two classes based on mode of transposition mechanism: Class I has a RNA intermediate; class II has a DNA intermediate. Class I MGEs transpose via transcribed to RNA and reverse transcribed to DNA whereas class II MGEs transpose directly from DNA to DNA. Class I includes the long terminal repeat (LTR) retrotransposons, the non-LTR retrotransposons, the short interspersed nuclear elements (SINEs), and the retroviruses. Class I MGEs occur in diverse taxa from fungi to mammals, are mobilized by replicative processes that generate numerous daughter copies, and thereby expand the size of the host genome (Huang et al., 2012). Retrotransposons have been described from many parasitic species (Laha et al., 2005; Laha et al., 2001; Yadav et al., 2009), and indeed sequences of non-LTR retrotransposons of the RTE family have been targeted for the application of DNA based diagnostics for parasitic infection with high sensitivity (Guo et al., 2012; Wang et al., 2011; Zhou et al., 2011). Here we report the sequence and predicted structure of a novel non-LTR retrotransposon from O. viverrini. Further, we present an analysis of its potential application for PCR based detection of O. viverrini and differential diagnosis of infection with O. viverrini, C. sinensis and/or small intestinal flukes.
2. Materials and methods
2.1. Flukes, parasite eggs
Adult worms of O. viverrini were maintained in Syrian hamsters (Flavell et al., 1983; Sripa and Kaewkes, 2002) at animal husbandry facilities of the Faculty of Medicine, Khon Kaen University. Protocols for vertebrate animal studies were approved by the Animal Ethics Committee of Khon Kaen University based on the Ethics of Animal Experimentation of the National Research Council of Thailand. Adult worms of C. sinensis were kindly provided by Dr. Nguyen Van De from Department of Parasitology, Ha Noi Medical University, Ha Noi, Vietnam. Adult worms of the small intestinal fluke, Haplorchis taichui were kindly provided by Dr. Do Trung Dung from National Institute of Malariology, Parasitology and Entomology, Vietnam (Sripa et al., 2010). Eggs of O. viverrini were obtained in vitro from adult worms; briefly adult worms were recovered from bile ducts of experimental infected hamster described above. Worms were washed for five times with PBS supplemented with 2X antibiotics (streptomycin/penicillin, 200 μg/ml), and cultured in RPMI 1640 medium supplemented with 1X antibiotics (streptomycin/penicillin, 100 μg/ml) at 37°C under 5% CO2 atmosphere. Eggs released from worms in vitro were collected at intervals of 48 h, washed several times in sterile PBS, and either used immediately or stored at -20°C.
2.2. Stool samples
Human stool samples from endemic sites in Khon Kaen province, Thailand were supplied by the Tropical Disease Research Laboratory, Khon Kaen University. The stools were positive for O. viverrini eggs, often included eggs of other helminth parasites, or were microscopically negative for parasite eggs. The stool samples were preserved in 70% alcohol at the time of collection, and were stored at room temperature thereafter until DNA extraction. Fecal egg counts were established using the quantitative formalin-ethyl acetate concentration techniques described (Haswell-Elkins et al., 1991). Additionally, negative human stool samples spiked with O.viverrini eggs were used as positive controls. To prepare spiked samples with known numbers of fluke eggs, exact numbers of O. viverrini eggs were counted under the microscope in a hemocytometer chamber, and transferred to aliquots of one gram of fresh, parasite-egg negative human feces (feces from one donor). Collection of these samples was approved by the Ethic Committee of Khon Kaen University, approval number HE451132.
2.3. DNA extraction from adult worms and human stool samples
Genomic DNA was extracted from adult developmental stages of O. viverrini, C. sinensis and H. taichui using Bio-Rad's genomic DNA extraction kit (Carlsbad, CA, USA). Genomic DNA was extracted from human feces using QIAgen's DNA extraction kit for stool samples (Qiagen, Germany). Genomic DNA from these sources was stored in kit elution buffers at -20°C.
2.4. Bioinformatics for detection of retrotransposon sequences
The keywords ‘reverse transcriptase’ and ‘retrotransposon’ were employed as search query terms of the database of expressed sequence tags of O. viverrini (Laha et al., 2007; Young et al., 2010a). Matches were retrieved and employed to search for homologues in the GenBank non-redundant sequence database using Blastn, Blastx and/or tBlastn (Altschul et al., 1997; Zhang et al., 2000). Consensus sequence of the novel O. viverrini retrotransposon was assembled from O. viverrini transcriptome sequence with 95% identities and 20 nucleotides overlapped using CAP contig assembly program in BioEdit package software (Hall, 1999).
2.5. O. viverrini retrotransposon specific primers design
Retrotransposon-like sequences of O. viverrini contig Ov_Contig10163 (Young et al., 2010a) was aligned with cDNA sequence databases of C. sinensis (Young et al., 2010a) with pairwise alignment. Non-conserved regions between O. viverrini and C. sinensis were identified and used to design primers specific for O. viverrini and C. sinensis. In addition, conserved sequences of O. viverrini and C. sinensis were identified for universal primer pair for detection of opisthorchiid DNA. Specific primers pairs for the O. viverrini retrotransposon were designated Ov_RTE_F1 (5′-GAATCCCTAGATCAGTCCTC-3′) and Ov_RTE_R1 (5′-CAGACCTCTATCAACTTGCC-3′). The specific primer for C. sinensis were termed CS_RTE_F1(5′CCTCAGGTATCTCCAAATCACTC) and CS_RTE_R1 (5′-CAGACATTGATCAACATCCC) and a universal primer pair for opisthorchiid DNA named Universal_OP_F (5′GTAGCTCTGACACCGTCAAAG) and Universal_OP_R (5′- CGATTTGTCCGCACCTTACGCC).
2.6. Evaluation of sensitivity of the PCR
Genomic DNA extracted from parasites and human feces were used as PCR templates. The retrotransposon gene of O. viverrini and C. sinensis were amplified using retrotransposon specific primers, as above. PCR conditions were optimized for the specific amplification of the OV-RTE-1 fragment. PCRs were performed in a volume of 25 μl, including 50 ng of DNA template, PCR buffer (20 mM Tris- HCl pH 8.4, 50mM KCl, 1.5 mM MgCl2), 200μM of each deoxynucleotide triphosphate, 1 μM Taq DNA polymerase, and each primer at 0.2 μM. The PCR was accomplished with a thermal cycler with 35 cycles of denaturation at 94°C for 30 sec, 60°C for 1 min and 72°C for 1 min, and final extension for 5 min at 72°C. Amplicons were sized by electrophoresis through 0.8% agarose in 1X Tris-acetate-EDTA buffer, stained with ethidium bromide, and photographed under UV illumination.
Sensitivity of PCR detection of the O. viverrini DNA was calculated from the least quantity of genomic DNA detectable by the PCR. Genomic DNA of adult O. viverrini was 10-fold serial diluted, starting at 0.5ng/μl, with one μl of each dilution employed as template for amplification, as above. Sensitivity for detection of isolated O. viverrini eggs was determined using increasing numbers of O. viverrini egg, ranging from one to seven eggs. In brief, eggs were added to 20 μl sterile distilled water and the preparation freeze-thawed three times in liquid nitrogen/ hot water, then incubated for 15 min at 100°C. Two μl of egg lysate was employed as the PCR template. The diagnostic sensitivity and specificity were calculated and expressed using the Galen's method:Sensitivity = [no. of true positives/(no. of true positives + no. offalse negatives)] × 100; Specificity = [no. of true negatives/ (no. of true negatives + no. of false positives)] × 100(Galen, 1980).
2.7. Long range PCR amplification
Long range PCR method was used to amplify the full length OV-RTE-1. Primers used were OV_RTEfull_F1 (5′- ATGCCACATCGGCCGTCGCG-3′) and OV_RTEfull_R1 (5′-GTTCCCCATCCTGGAAGGCG-3′) as forward and reverse primers, respectively. The conditions for long range PCR were recommended in the manufacturer's protocol (Qiagen, Germany). PCR amplification was carried out in a final volume of 50 μl, including 5 μl of 10× long range PCR buffer with Mg2+, 2.5 μl of dNTP mix (10mM each), 0.4 μM of each primer, 2 units of long-range PCR enzyme, 200ng O. viverrini genomic DNA, 30 μl RNase-free water. The PCR was carried out in a thermal cycler with initial denaturation at 93°C for 3 min, then 35 cycles including denaturation at 93°C for 15sec, annealing at 60°C for 30 sec, extension at 68°C for 4 min and final extension for 10 min at 68°C. Amplification products were analyzed as above.
2.8. The OV-RTE-1 gene
PCR products of the desired size, resolved through agarose by electrophoresis, were recovered after excision of bands from gels and purified from agarose using the GeneJET Gel Extraction Kit (Fermentas, EU). Amplicons were cloned into plasmid T-vector for propagation using a cloning kit (pGEM-T easy, Promega, USA). E. coli strain JM109 cells were transformed with the cloned products. Plasmid DNA was isolated from bacteria using the PureLink Quick Plasmid Miniprep Kit (Invitrogen, USA). DNA sequencing of PCR productsand recombinant plasmids was undertaken on an automated fluorescent DNA sequencing platform using the Big Dye terminator method (1st Base, Malaysia). Sequences were conceptually translated into amino acids and functional domains and motifs compared and contrasted with those of other retrotransposons. Alignments of amino acid sequences of functional domains were accomplished with ClustalW (Thompson et al., 1994), edited and annotated with BioEdit v5.0.9 software, and also manually edited to highlight conserved endonuclease (EN) and reverse transcriptase (RT) domains (Malik et al., 1999).
2.9. Phylogenetic analysis
Alignments of the RT and EN domains were utilized to construct phylograms of the relationships of the novel retrotransposon using MEGA version 5.2.2 (Tamura et al., 2011). Phylograms were assessed for bootstrap values of 1,000 replicates using the neighbor-joining method. The substitution model of Jones-Taylor-Thornton (JTT) was used. Alignment gaps were treated with complete deletion method. Sequences for phylogenetic analyses were accessed from the GenBank, EMBL and PIR databases, and included representatives from 11 major clades of the non-LTR retrotransposons (Malik et al., 1999). RT sequences of Group II introns and EN sequences from bacteria were used as outgroups for the RT and EN phylograms, respectively. The names and accession numbers of the aligned sequences included in the phylogenies are provided in the supporting information, Supplementary Table S1.
3. Results
3.1. OV-RTE-1, a non-LTR retrotransposon from the genome of O. viverrini
The entire open reading frame of a non-LTR retrotransposon gene designated OV-RTE-1 was amplified by long range PCR with the primers OV_RTEfull_R1 and OV_RTEfull_F1. The amplicon was cloned into pGEM-T and the construct used to transform bacteria from which the plasmid we have termed pOV-RTE-1was recovered. The consensus nucleotide sequence of the partial OV-RTE-1 retrotransposon was 3,330 bp in length and encoded a single read through open reading frame (ORF) (Fig.1). The ORF of OV-RTE-1 encoded 1,101 amino acids including endonuclease (EN) and reverse transcriptase (RT) domain, in that order. The EN domain of OV-RTE-1 was 261 amino acids in length and the RT domain was 319 amino acids. The consensus sequence of OV-RTE-1 has been assigned GenBank accession KF598866.
Figure 1.
Schematic representation of the consensus structure of OV-RTE-1 and the Ov_Contigs used for its construction. EN and RT refer to the endonuclease and reverse transcriptase domains of the pol open reading frame. Individual Ov_Contigs are shown as black lines, contigs names are listed on the right. Numbers beside each contig refer to regions sequenced.The sequence of Ov-RTE-1obtained from long range PCR is shown at the bottom. The region of PCR product from specific primers Ov_RTE_F1 and Ov_RTE_R1 is indicated by the red line.
The conserved domain architecture of the non-LTR retrotransposons encoded by the pol gene, both the reverse transcriptase (RT) and endonuclease (EN) domains,was used for phylogenetic investigation of the relationships of OV-RTE-1 to other retrotransposons (Malik et al., 1999). Alignments of RT and EN of OV-RTE-1 with orthologous motifs from other non-LTR retrotransposons from other informative families and taxa revealed high similarity and conservation of functional motifs. The seven conserved blocks of the RT domain (Xiong and Eickbush, 1990) were identified, as shown in Fig.2A. The RT domain of OV-RTE-1 contains an active site YXDD motif for reverse transcriptase in the sequence (Flavell, 1995). The nine conserved boxes of the EN domain of OV-RTE-1 were also identified (Fig.2B). The conserved sequences in non-LTR retrotransposon sequences were indicated in black colored font (Fig. 2, panel A and B), as described (Laha et al., 2005; Malik et al., 1999).
Figure 2.
Multiple alignment of amino acid sequence of the reverse transcriptase (A) and endonuclease (B) domains of OV-RTE-1 and other non-long terminal repeat retrotransposons belonging to several families of these mobile genetic elementsincluding OV-RTE-1 from Opisthorchis viverrini (KF598866), Cs-RTE-1 from Clonorchis sinensis (Cs_Contig4981), SjR2 from Schistosoma japonicum (AY027869), SR1(U66331) and SR2 (AF025672) from Schistosoma mansoni, Rte-1 from Caenorhabditis elegans (AF054983), CR1from Gallus gallus (U88211), Tad1 from Neurospora crassa (L25662), Jockey (M22874) and R1Dm (X51968) from Drosophila melanogaster, Cgt1 from Colletotrichum gloeosporioides (L76169), L1hs from Homo sapiens (U93574), R4 from Ascaris lumbricoides (U29445), R2 (X51967) and I (M14954) from D. melanogaster. Dark shading denotes identical amino acids in 50% or more of the sequences, while lighter shading denotes conservative substitutions. Boxes 1–7 denote the conserved regions within reverse transcriptase domains, the conserved active site YXDD located in box 5 is indicated, and boxes 1-9 represent the conserved domains within endonucleases of non-long terminal repeat retrotransposons.
3.2. OV-RTE-1 is a member of the RTE clade of non-LTR retrotransposons
By Blast, the entire sequence of the novel O. viverrini retrotransposon shared highest similarity to the SR2 non-LTR retrotransposon from Schistosoma mansoni (Drew et al., 1999; Ziegler et al., 2011) and to the closely related SjR2 element of Schistosoma japonicum (Laha et al., 2002a). OV-RTE-1 shared 54% identity to SR2 and 53% identity to SjR2 at the amino acid level when compared with 1,101 amino acids. Phylograms were constructed to compare and contrast the reverse transcriptase (RT) and endonuclease (EN) domains of OV-RTE-1 with those of other retrotransposons including representatives from 11 clades of non-long terminal repeat retrotransposons. Comparison of the RT domains of these diverse elements revealed that the closest relatives of OV-RTE-1 were uncharacterized retrotransposon-like sequence from Clonorchis sinensis (Cs_Contig4981) and O. viverrini (Ov_Contig7125) retrieved from cDNA sequence databases of Young et al. (2010), SR2 from S. mansoni and SjR2 from S. japonicum, SR3 and Perere3 from S. mansoni, and ShR3 from S. haematobium (Fig. 3), firmly locating OV-RTE-1 within the RTE clade of non-LTR retrotransposons. Ov-RTE-1 groups with SR3, Perere3 and ShR3 with bootstrap value less than 50%. In addition, a phylogenetic tree was constructed based on the EN domain of eight clades of non-LTR retrotransposons. The topography of the EN tree, as well as the position of OV-RTE-1 within the RTE clade, was similar to the topography represented on the RT-based tree, thereby providing additional support to the assignment of OV-RTE-1 as a member of the RTE clade of RTE-like retrotransposons (Supplementary Fig. S1).
Figure 3.
Phylogram constructed using the neighbor-joining method to compare the relationships among reverse transcriptase encoding regions of OV-RTE-1 and of representative elements belonging to the major clades of non-long terminal repeat retrotransposons from a range of host genomes. Bootstrap values, where 500 or greater from a maximum of 1,000 replicates, are presented at the nodes.
3.3. Retrotransposon PCR detection for O. viverrini infection
Three sets of primers were designed based on the sequence of the novel O. viverrini non-LTR retrotransposon. PCR conditions were optimized for detection of O. viverrini DNA using these primers. Primer pairs OV_RTE_F1 and OV_RTE_R1 exhibited 100% specificity to distinguish O. viverrini from C. sinensis and H. taichui. In addition, primer pairs CS_RTE_F1 and CS_RTE_R1 showed 100% specificity to distinguish O. viverrini from C. sinensis DNA.The universal_OP_F and Universal_OP_R primer pairs successfully amplified genomic DNA of both O. viverrini and C. sinensis, providing a positive control. The OV_RTE_F1 and OV_RTE_R1 primers amplified a product of 388 bp solely from O. viverrini, whereas products were not amplified from C. sinensis or H.taichui DNA (Fig. 4A). The O.viverrini-specific primers OV_RTE F1 and OV_RTE R1 were also evaluated for specificity using stool DNA samples (17 samples) containing eggs of other helminths: minute intestinal flukes, echinostomes, Strongyloides stercoralis, Ascaris lumbricoides and Taenia spp. PCR products were not amplified from these samples.
Figure 4.
Panel A: PCR detection O. viverrini DNA with retrotransposon specific primers. Lanes 1-3 represent PCR product amplified from genomic DNA extracted from O. viverrini, C. sinensis and H. taichui, respectively. Lane 4 represents no DNA control. Lane M represents a DNA size marker. Panel B: Evaluation of the sensitivity of the specific PCR assay with O. viverrini genomic DNA by agarose gel electrophoresis. Lane 1 represents PCR product amplified from O. viverrini DNA with amount 0.5ng/ μl. Lanes 2-7 represent PCR products amplified from O. viverrini DNA diluted for 101, 102, 103, 104, 105, 106 times, respectively. Lane M shows DNA size standards. Panel C: Agarose gel electrophoresis showing PCR products of the OV-RTE-1 PCR assay using O.viverrini egg as the template. Lane 1 represents PCR products amplified from DNA of one O. viverrini egg. Lanes 2-7 represent PCR products amplified from 2, 3, 4, 5, 6, 7 eggs of O. viverrini, respectively. Lane M shows DNA size standards.
In evaluating the sensitivity of the PCR assay using the O. viverrini-specific OV_RTE_F1 and OV_RTE_R1 primers, we observed that the minimal amount of O. viverrini genomic DNA detectable by the specific PCR assay was 5 fg (Fig.4B). For detection of O. viverrini eggs by specific PCR, primers OV_RTE_F1 and OV_RTE_R1 detected a single egg of O. viverrini egg (Fig. 4C).
A total of 47 stool samples (confirmed to be infected with O. viverrini by examination for eggs by light microscopy using the FECT method) were examined. (These feces had been preserved in 70% ethanol and stored at room temperature). Of these, 11 fecal samples included 5-50 eggs per gram (EPG), 19 included 200-500 EPG and 17 included 500-1,000 EPG. In addition, 71 fresh, parasite-negative stool samples were spiked with increasing numbers of O. viverrini eggs: 5-50, 50-200, and 200-1,000 eggs in one gram of stool. Of these latter positive controls, 24 samples had 5-50 eggs, 35 had 50-200 eggs and 12 included 200-1,000 eggs. Furthermore, 17 stool samples that were positive for other helminth parasites were investigated; the other parasites were minute intestinal flukes (MIF) (n=2 stool samples), S. stercoralis (n=8), echinostomes (n=3), Taenia (n=1). Three additional samples were co-infected; one sample was co-infected with MIF and Ascaris lumbricoides whereas two samples were co-infected with MIF and S. stercoralis. In addition, five negative-by-microscopy stool samples were included as negative controls.
For the 47 samples preserved in ethanol, the specific PCR detected 18 samples (38.3%). Of these, four of 11 (36.4 %) samples with 5-50 EPG, five of 19 (26.3%) samples with 50-200 EPG and nine of 17 (52.9%) samples with 200-1,000 EPG were detected. To compare the efficiency of retrotransposon PCR versus FECT, 71 samples of fresh negative human stool samples into which different numbers of O. viverrini eggs were spiked were screened by PCR. The PCR detected 44 samples of 71 samples (62%); more specifically, the assay detected 14 of 24 (58.3 %) samples with 5-50 EPG, 23 of 35 (65.7%) samples with 50-200 EPG and 7 of 12 (58.33%) samples with 200-1,000 EPG. To examine the sensitivity of FECT, 40 fresh human stool samples spiked with increasing numbers of O. viverrini eggs (5-50, 50-200, 200-1,000) were screened. The assay failed to detect O. viverrini eggs in 15 samples to which 5-50 eggs had been added. However, the assay detected eight of 15 (53.33%) samples spiked with 50-200 eggs and 10 of 10 (100%) samples spiked with 200-1,000 eggs. In total, 18 of 40 (45%) samples were detected by FECT. PCR targeting DNA from five negative fecal samples failed to yield amplicons.
4. Discussion
Mobile sequences are key drivers of genome evolution (Kazazian, 2004). A number of families of retrotransposons have been characterized from trematode genomes including CsRn1, PwRn1, Gulliver, the LTR retrotransposons from C. sinensis (Bae et al., 2001), Paragonimus westermani (Bae et al., 2008) and S. japonicum (Laha et al., 2001), respectively. Moreover, numerous non-LTR retrotransposons have been characterized from schistosome genomes (Brindley et al., 2003; Drew et al., 1999; Laha et al., 2005). These reports generally employed approaches pairing bioinformatics and screening of genomic DNA libraries to locate novel non-LTR retrotransposons (Laha et al., 2002a; Laha et al., 2002b; Laha et al., 2005, 2006). The approach presented here used bioinformatics and long range PCR approaches, both of which are straightforward methods, to isolate a long fragment of retrotransposon sequence from genomic DNA template.
The retrotransposon OV-RTE-1 is the first mobile genetic element to be described in the genome of O. viverrini, and the first non-LTR retrotransposon characterized in depth from the family Opisthorchiidae. The sequence, structure, and phylogenetic relationships of OV-RTE-1are presented here. Transcriptome-based estimates indicate that the genome of O. viverrini includes ∼20,000 protein encoding genes along with numerous repetitive sequences (Young et al., 2010a; Young et al., 2010b). Abundant retrotransposon sequences occur in the transcriptome of O. viverrini which, along with the presence of putatively functional domains of OV-RTE-1, indicates that OV-RTE-1 and other retrotransposons are actively mobilized in the genome of O. viverrini. Indeed, it is feasible that active or autonomous OV-RTE-1copies may be of practical use as a transgenesis vector in future functional genomics analysis of these fish born flukes (Izsvak et al., 1997; Kopera et al., 2011; Laha et al., 2001).
Multiple sequence alignments of both the reverse transcriptase (RT) and endonucleases (EN) domains of the deduced polyprotein of the retrotransposon and phylograms demonstrated that OV-RTE-1 belonged to the RTE clade of non-LTR retrotransposons. The closest relatives of OV-RTE-1 were SR2 from S. mansoni and SjR2 from S. japonicum.OV-RTE-1 encoded a single open reading frame containing a domain with homology to the apurinic-apyrimidic endonucleases and reverse transcriptase domain. The RT and EN domains of OV-RTE-1 represented the most highly conserved regions that characterization of RTE clade of non-LTR retrotransposon (Malik et al., 1999; Malik and Eickbush, 1998). Deeper analysis of O. viverrini retrotransposons can be expected to enhance understanding on the evolutionary relationships and history of O. viverrini and platyhelminths at large and will facilitate the annotation of the liver fluke genome (which is ongoing; unpublished).
The potential for deployment of OV-RTE-1 as a gene target for opisthorchiasis detection was supported by the findings presented here. Retrotransposon OV-RTE-1 specific primers, OV_RTE_F1 and OV-RTE_R1, showed 100% specificity to detect O. viverrini DNA and could detect as little as five femtograms of genomic DNA. The outcome showed, further, that OV_RTE_F1 and OV-RTE_R1 primers were specific for O. viverrini and do not interact with the DNA of other known trematode and nematode species. The findings also indicated that OV_RTE_F1 and OV-RTE_R1 primers can differentiate O. viverrini from other parasites especially the closely related species, C. sinensis.
The sensitivity of PCR using OV-RTE-1 specific primers for detection of O. viverrini infection with DNA extracted from human stool that had been preserved in ethanol was lower than that for detection of O. viverrini by microscopic examination of stool specimens using the FECT technique. However, the sensitivity of PCR using DNA extracted from human stool samples spiked with O. viverrini eggs was higher than FECT. These results revealed that OV-RTE-1 specific primers exhibit potential for development as molecular diagnostic tools for Opisthorchis infection especially in the areas of mixed infection with O. viverrini, C. sinensis and/or H. taichui such as in northeastern Thailand and adjacent countries (Pitaksakulrat et al., 2013; Rim et al., 2013; Wongsawad et al., 2012).
Because the sensitivity of PCR detect of O. viverrini was lower than might be expected, in future trials we will consider inclusion of a spike of O. viverrini genomic DNA and additional sets of primers against human gene(s) that would be expected in feces as positive controls. This should improve interpretation of negatives as being truly negative and address whether potential inhibitors for the PCR in the stool samples influenced the outcome. Furthermore, the variation of the number of stool samples used in each group might have affected the sensitivity but availability of these kinds of samples can be problematic. To improve efficiency, sufficiently more samples can be included in future investigations. For ethanol preservation, the conditions imposed by long term preservation may have led to inhibitory factors, and we will investigate alternative methods for preservation of samples. To conclude, however, The OV-RTE-1 specific PCR can likely be developed as a molecular diagnostic for Opisthorchis infection targeting parasite eggs in stool samples, especially in regions of mixed infection of O. viverrini and/or C. sinensis and minute intestinal flukes.
Supplementary Material
Table S1. Name, species and GenBank accession number of sequences included in the multiple sequences alignments and phylogenetic analyses.
Figure S1. Phylogram constructed using the neighbor-joining method to compare the relationships among endonuclease encoding regions of OV-RTE-1 and of representative elements belonging to the major clades of non-long terminal repeat retrotransposons from a range of host genomes. Bootstrap values, where 500 or greater from a maximum of 1,000 replicates, are presented at the nodes.
Highlights
The genome of Opisthorchis viverrini has a multi-copy retrotransposon
This novel non-long terminal repeat retrotransposon has been termed Ov-RTE-1
PCR based analysis targeting Ov-RTE-1 detected O. viverrini eggs in human feces
PCR targeting Ov-RTE-1 discriminated O. viverrini from Clonorchis sinensis
Acknowledgments
Luyen Thi Phung was supported by a Postgraduate Scholarship for International Students, Faculty of Medicine, Khon Kaen University, Thailand. This research was supported by award number P50AI098639 (Tropical Medicine Research Center) from the National Institute of Allergy and Infectious Disease (NIAID) of the United States National Institutes of Health (NIH). The content is solely the responsibility of the authors and does not necessarily represent the official views of the NIAID or the NIH.
Footnotes
Disclosure statement: The authors declare no conflict of interest.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References
- Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bae YA, Ahn JS, Kim SH, Rhyu MG, Kong Y, Cho SY. PwRn1, a novel Ty3/gypsy-like retrotransposon of Paragonimus westermani: molecular characters and its differentially preserved mobile potential according to host chromosomal polyploidy. BMC Genomics. 2008;9:482. doi: 10.1186/1471-2164-9-482. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bae YA, Moon SY, Kong Y, Cho SY, Rhyu MG. CsRn1, a novel active retrotransposon in a parasitic trematode, Clonorchis sinensis, discloses a new phylogenetic clade of Ty3/gypsy-like LTR retrotransposons. Mol Biol Evol. 2001;18:1474–1483. doi: 10.1093/oxfordjournals.molbev.a003933. [DOI] [PubMed] [Google Scholar]
- Brindley PJ, Laha T, McManus DP, Loukas A. Mobile genetic elements colonizing the genomes of metazoan parasites. Trends in parasitology. 2003;19:79–87. doi: 10.1016/s1471-4922(02)00061-2. [DOI] [PubMed] [Google Scholar]
- Carvalho GC, Marques LH, Gomes LI, Rabello A, Ribeiro LC, Scopel KK, Tibirica SH, Coimbra ES, Abramo C. Polymerase chain reaction for the evaluation of Schistosoma mansoni infection in two low endemicity areas of Minas Gerais, Brazil. Memorias do Instituto Oswaldo Cruz. 2012;107:899–902. doi: 10.1590/s0074-02762012000700010. [DOI] [PubMed] [Google Scholar]
- Drew AC, Minchella DJ, King LT, Rollinson D, Brindley PJ. SR2 elements, non-long terminal repeat retrotransposons of the RTE-1 lineage from the human blood fluke Schistosoma mansoni. Mol Biol Evol. 1999;16:1256–1269. doi: 10.1093/oxfordjournals.molbev.a026216. [DOI] [PubMed] [Google Scholar]
- Duenngai K, Sithithaworn P, Rudrappa UK, Iddya K, Laha T, Stensvold CR, Strandgaard H, Johansen MV. Improvement of PCR for detection of Opisthorchis viverrini DNA in human stool samples. J Clin Microbiol. 2008;46:366–368. doi: 10.1128/JCM.01323-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Flavell AJ. Retroelements, reverse transcriptase and evolution. Comp Biochem Physiol B Biochem Mol Biol. 1995;110(1):3–15. doi: 10.1016/0305-0491(94)00122-b. [DOI] [PubMed] [Google Scholar]
- Flavell DJ, Flavell SU, Field GF. Opisthorchis viverrini: the relationship between egg production, worm size and intensity of infection in the hamster. Transactions of the Royal Society of Tropical Medicine and Hygiene. 1983;77:538–545. doi: 10.1016/0035-9203(83)90132-3. [DOI] [PubMed] [Google Scholar]
- Galen R. Predictive value and efficiency of laboratory testing. Pediatr Clin North. 1980;27:861–869. doi: 10.1016/s0031-3955(16)33930-x. [DOI] [PubMed] [Google Scholar]
- Guo JJ, Zheng HJ, Xu J, Zhu XQ, Wang SY, Xia CM. Sensitive and specific target sequences selected from retrotransposons of Schistosoma japonicum for the diagnosis of schistosomiasis. PLoS Negl Trop Dis. 2012;6:e1579. doi: 10.1371/journal.pntd.0001579. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hall T. Nucl Acids Symp Ser. 5.0.9 ed. Carlsbad, CA: 1999. BioEdit is a biological sequence alignment editor written for Windows 95/98/NT/2000/XP. [Google Scholar]
- Haswell-Elkins MR, Sithithaworn P, Mairiang E, Elkins DB, Wongratanacheewin S, Kaewkes S, Mairiang P. Immune responsiveness and parasite-specific antibody levels in human hepatobiliary disease associated with Opisthorchis viverrini infection. Clin Exp Immunol. 1991;84:213–218. doi: 10.1111/j.1365-2249.1991.tb08151.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hong ST, Fang Y. Clonorchis sinensis and clonorchiasis, an update. Parasitology international. 2012;61:17–24. doi: 10.1016/j.parint.2011.06.007. [DOI] [PubMed] [Google Scholar]
- Huang CR, Burns KH, Boeke JD. Active transposition in genomes. Annual review of genetics. 2012;46:651–675. doi: 10.1146/annurev-genet-110711-155616. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Izsvak Z, Ivics Z, Hackett PB. Repetitive elements and their genetic applications in zebrafish. Biochemistry and cell biology = Biochimie et biologie cellulaire. 1997;75:507–523. [PubMed] [Google Scholar]
- Janwan P, Intapan PM, Thanchomnang T, Lulitanond V, Anamnart W, Maleewong W. Rapid detection of Opisthorchis viverrini and Strongyloides stercoralis in human fecal samples using a duplex real-time PCR and melting curve analysis. Parasitol Res. 2011;109:1593–1601. doi: 10.1007/s00436-011-2419-z. [DOI] [PubMed] [Google Scholar]
- Johansen MV, Sithithaworn P, Bergquist R, Utzinger J. Towards improved diagnosis of zoonotic trematode infections in Southeast Asia. Advances in parasitology. 2010;73:171–195. doi: 10.1016/S0065-308X(10)73007-4. [DOI] [PubMed] [Google Scholar]
- Kazazian HH., Jr Mobile elements: drivers of genome evolution. Science. 2004;303:1626–1632. doi: 10.1126/science.1089670. [DOI] [PubMed] [Google Scholar]
- Kopera HC, Moldovan JB, Morrish TA, Garcia-Perez JL, Moran JV. Similarities between long interspersed element-1 (LINE-1) reverse transcriptase and telomerase. Proceedings of the National Academy of Sciences of the United States of America. 2011;108:20345–20350. doi: 10.1073/pnas.1100275108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Laha T, Brindley PJ, Smout MJ, Verity CK, McManus DP, Loukas A. Reverse transcriptase activity and untranslated region sharing of a new RTE-like, non-long terminal repeat retrotransposon from the human blood fluke, Schistosoma japonicum. International journal for parasitology. 2002a;32:1163–1174. doi: 10.1016/s0020-7519(02)00063-2. [DOI] [PubMed] [Google Scholar]
- Laha T, Brindley PJ, Verity CK, McManus DP, Loukas A. pido, a non-long terminal repeat retrotransposon of the chicken repeat 1 family from the genome of the Oriental blood fluke, Schistosoma japonicum. Gene. 2002b;284:149–159. doi: 10.1016/s0378-1119(02)00381-5. [DOI] [PubMed] [Google Scholar]
- Laha T, Kewgrai N, Loukas A, Brindley PJ. Characterization of SR3 reveals abundance of non-LTR retrotransposons of the RTE clade in the genome of the human blood fluke, Schistosoma mansoni. BMC Genomics. 2005;6:154. doi: 10.1186/1471-2164-6-154. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Laha T, Kewgrai N, Loukas A, Brindley PJ. The dingo non-long terminal repeat retrotransposons from the genome of the hookworm, Ancylostoma caninum. Experimental parasitology. 2006;113:142–153. doi: 10.1016/j.exppara.2005.12.018. [DOI] [PubMed] [Google Scholar]
- Laha T, Loukas A, Verity CK, McManus DP, Brindley PJ. Gulliver, a long terminal repeat retrotransposon from the genome of the oriental blood fluke Schistosoma japonicum. Gene. 2001;264:59–68. doi: 10.1016/s0378-1119(00)00601-6. [DOI] [PubMed] [Google Scholar]
- Laha T, Pinlaor P, Mulvenna J, Sripa B, Sripa M, Smout MJ, Gasser RB, Brindley PJ, Loukas A. Gene discovery for the carcinogenic human liver fluke, Opisthorchis viverrini. BMC Genomics. 2007;8:189. doi: 10.1186/1471-2164-8-189. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Le TH, Van De N, Blair D, Sithithaworn P, McManus DP. Clonorchis sinensis and Opisthorchis viverrini: development of a mitochondrial-based multiplex PCR for their identification and discrimination. Exp Parasitol. 2006;112:109–114. doi: 10.1016/j.exppara.2005.09.012. [DOI] [PubMed] [Google Scholar]
- Malik HS, Burke WD, Eickbush TH. The age and evolution of non-LTR retrotransposable elements. Mol Biol Evol. 1999;16:793–805. doi: 10.1093/oxfordjournals.molbev.a026164. [DOI] [PubMed] [Google Scholar]
- Malik HS, Eickbush TH. The RTE class of non-LTR retrotransposons is widely distributed in animals and is the origin of many SINEs. Mol Biol Evol. 1998;15:1123–1134. doi: 10.1093/oxfordjournals.molbev.a026020. [DOI] [PubMed] [Google Scholar]
- McCarthy JS, Lustigman S, Yang GJ, Barakat RM, Garcia HH, Sripa B, Willingham AL, Prichard RK, Basanez MG. A research agenda for helminth diseases of humans: diagnostics for control and elimination programmes. PLoS Negl Trop Dis. 2012;6:e1601. doi: 10.1371/journal.pntd.0001601. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mordvinov VA, Yurlova NI, Ogorodova LM, Katokhin AV. Opisthorchis felineus and Metorchis bilis are the main agents of liver fluke infection of humans in Russia. Parasitology international. 2012;61:25–31. doi: 10.1016/j.parint.2011.07.021. [DOI] [PubMed] [Google Scholar]
- Morsy AT, Al-Mathal EM. Clonorchis sinensis a new report in Egyptian employees returning back from Saudi Arabia. Journal of the Egyptian Society of Parasitology. 2011;41:221–225. [PubMed] [Google Scholar]
- Pitaksakulrat O, Sithithaworn P, Laoprom N, Laha T, Petney TN, Andrews RH. A cross-sectional study on the potential transmission of the carcinogenic liver fluke Opisthorchis viverrini and other fishborne zoonotic trematodes by aquaculture fish. Foodborne pathogens and disease. 2013;10:35–41. doi: 10.1089/fpd.2012.1253. [DOI] [PubMed] [Google Scholar]
- Pozio E, Armignacco O, Ferri F, Gomez Morales MA. Opisthorchis felineus, an emerging infection in Italy and its implication for the European Union. Acta tropica. 2013;126:54–62. doi: 10.1016/j.actatropica.2013.01.005. [DOI] [PubMed] [Google Scholar]
- Rim HJ, Sohn WM, Yong TS, Eom KS, Chai JY, Min DY, Lee SH, Hoang EH, Phommasack B, Insisiengmay S. Fishborne trematode metacercariae in Luang Prabang, Khammouane, and Saravane Province, Lao PDR. The Korean journal of parasitology. 2013;51:107–114. doi: 10.3347/kjp.2013.51.1.107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sato M, Thaenkham U, Dekumyoy P, Waikagul J. Discrimination of O. viverrini, C. sinensis, H. pumilio and H. taichui using nuclear DNA-based PCR targeting ribosomal DNA ITS regions. Acta Trop. 2009;109:81–83. doi: 10.1016/j.actatropica.2008.09.015. [DOI] [PubMed] [Google Scholar]
- Sithithaworn P, Andrews RH, Nguyen VD, Wongsaroj T, Sinuon M, Odermatt P, Nawa Y, Liang S, Brindley PJ, Sripa B. The current status of opisthorchiasis and clonorchiasis in the Mekong Basin. Parasitology international. 2012;61:10–16. doi: 10.1016/j.parint.2011.08.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sripa B. Global burden of food-borne trematodiasis. The Lancet infectious diseases. 2012;12:171–172. doi: 10.1016/S1473-3099(11)70321-8. [DOI] [PubMed] [Google Scholar]
- Sripa B, Brindley PJ, Mulvenna J, Laha T, Smout MJ, Mairiang E, Bethony JM, Loukas A. The tumorigenic liver fluke Opisthorchis viverrini-multiple pathways to cancer. Trends in parasitology. 2012;28:395–407. doi: 10.1016/j.pt.2012.07.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sripa B, Kaewkes S. Gall bladder and extrahepatic bile duct changes in Opisthorchis viverrini-infected hamsters. Acta tropica. 2002;83:29–36. doi: 10.1016/s0001-706x(02)00052-9. [DOI] [PubMed] [Google Scholar]
- Sripa B, Kaewkes S, Intapan PM, Maleewong W, Brindley PJ. Food-borne trematodiases in Southeast Asia epidemiology, pathology, clinical manifestation and control. Advances in parasitology. 2010;72:305–350. doi: 10.1016/S0065-308X(10)72011-X. [DOI] [PubMed] [Google Scholar]
- Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011;28:2731–2739. doi: 10.1093/molbev/msr121. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic acids research. 1994;22:4673–4680. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Traub RJ, Macaranas J, Mungthin M, Leelayoova S, Cribb T, Murrell KD, Thompson RC. A new PCR-based approach indicates the range of Clonorchis sinensis now extends to Central Thailand. PLoS Negl Trop Dis. 2009;3:e367. doi: 10.1371/journal.pntd.0000367. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang C, Chen L, Yin X, Hua W, Hou M, Ji M, Yu C, Wu G. Application of DNA-based diagnostics in detection of schistosomal DNA in early infection and after drug treatment. Parasites & vectors. 2011;4:164. doi: 10.1186/1756-3305-4-164. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wongsawad C, Phalee A, Noikong W, Chuboon S, Nithikathkul C. Co-infection with Opisthorchis viverrini and Haplorchis taichui detected by human fecal examination in Chomtong district, Chiang Mai Province, Thailand. Parasitology international. 2012;61:56–59. doi: 10.1016/j.parint.2011.10.003. [DOI] [PubMed] [Google Scholar]
- Xiong Y, Eickbush TH. Origin and evolution of retroelements based upon their reverse transcriptase sequences. The EMBO journal. 1990;9:3353–3362. doi: 10.1002/j.1460-2075.1990.tb07536.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yadav VP, Mandal PK, Rao DN, Bhattacharya S. Characterization of the restriction enzyme-like endonuclease encoded by the Entamoeba histolytica non-long terminal repeat retrotransposon EhLINE1. FEBS J. 2009;276:7070–7082. doi: 10.1111/j.1742-4658.2009.07419.x. [DOI] [PubMed] [Google Scholar]
- Young ND, Campbell BE, Hall RS, Jex AR, Cantacessi C, Laha T, Sohn WM, Sripa B, Loukas A, Brindley PJ, Gasser RB. Unlocking the transcriptomes of two carcinogenic parasites, Clonorchis sinensis and Opisthorchis viverrini. PLoS Negl Trop Dis. 2010a;4:e719. doi: 10.1371/journal.pntd.0000719. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Young ND, Jex AR, Cantacessi C, Campbell BE, Laha T, Sohn WM, Sripa B, Loukas A, Brindley PJ, Gasser RB. Progress on the transcriptomics of carcinogenic liver flukes of humans--unique biological and biotechnological prospects. Biotechnology advances. 2010b;28:859–870. doi: 10.1016/j.biotechadv.2010.07.006. [DOI] [PubMed] [Google Scholar]
- Zhang Z, Schwartz S, Wagner L, Miller W. A greedy algorithm for aligning DNA sequences. Journal of computational biology : a journal of computational molecular cell biology. 2000;7:203–214. doi: 10.1089/10665270050081478. [DOI] [PubMed] [Google Scholar]
- Zhou L, Tang J, Zhao Y, Gong R, Lu X, Gong L, Wang Y. A highly sensitive TaqMan real-time PCR assay for early detection of Schistosoma species. Acta tropica. 2011;120:88–94. doi: 10.1016/j.actatropica.2011.06.006. [DOI] [PubMed] [Google Scholar]
- Ziegler AD, Andrews RH, Grundy-Warr C, Sithithaworn P, Petney TN. Fighting liverflukes with food safety education. Science. 2011;331:282–283. doi: 10.1126/science.331.6015.282-b. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Table S1. Name, species and GenBank accession number of sequences included in the multiple sequences alignments and phylogenetic analyses.
Figure S1. Phylogram constructed using the neighbor-joining method to compare the relationships among endonuclease encoding regions of OV-RTE-1 and of representative elements belonging to the major clades of non-long terminal repeat retrotransposons from a range of host genomes. Bootstrap values, where 500 or greater from a maximum of 1,000 replicates, are presented at the nodes.





