Abstract
Objectives
Primary teeth work as guides for the eruption of permanent dentition, contribute for the development of the jaws, chewing process, preparing food for digestion, and nutrient assimilation. Treatment of pulp necrosis in primary teeth is complex due to anatomical and physiological characteristics and high number of bacterial species present in endodontic infections. The bacterial presence alone or in association in necrotic pulp and fistula samples from primary teeth of boys and girls was evaluated.
Material and Methods
Necrotic pulp (103) and fistula (7) samples from deciduous teeth with deep caries of 110 children were evaluated. Bacterial morphotypes and species from all clinical samples were determined.
Results
A predominance of gram-positive cocci (81.8%) and gram-negative coccobacilli (49.1%) was observed. In 88 out of 103 pulp samples, a high prevalence of Enterococcus spp. (50%), Porphyromonas gingivalis (49%), Fusobacterium nucleatum (25%) and Prevotella nigrescens (11.4%) was observed. Porphyromonas gingivalis was detected in three out of seven fistula samples, Enterococcus spp. in two out of seven samples, and F. nucleatum, P. nigrescens and D. pneumosintes in one out of seven samples.
Conclusions
Our results show that Enterococcus spp. and P. gingivalis were prevalent in necrotic pulp from deciduous teeth in boys from 2 to 5 years old, and that care of the oral cavity of children up to five years of age is important.
Keywords: Necrotic pulp, Primary teeth, Enterococcus spp., P. gingivalis, Children
INTRODUCTION
Since primary teeth work as guides for the eruption of permanent dentition and contribute to the development of jaws, chewing process, preparing food for digestion and nutrient assimilation, they are important for childhood. Premature loss of teeth can produce change in the eruption guide of the permanent tooth, which can cause phonetic disturbances and harmful oral habits, such as tongue interposition, and aesthetic consequences3.
Dental biofilm on occlusal surfaces of primary teeth is associated to active carious lesions2. The exposure of pulp tissue to the oral environment will allow that oral microorganisms have access into pulp chamber, producing necrosis10.
The treatment of pulp necrosis, particularly in primary teeth, is very complex due to anatomical and physiological characteristics, making the access to the root canal difficult13. Treatment of primary endodontic infections is based on the elimination of the root canal infection; although no protocol or techniques for canal instrumentation have been observed16. Bacterial species such as Enterococcus faecalis has been reported in high prevalence in primary endodontic infections affecting Turkish children15.
The presence of different bacteria involved in endodontic infections of primary teeth, such as pulpitis, pulp necrosis and apical lesion has been reported17,20,21; however, microbiological data of fistula are scarce.
Anaerobic bacteria, especially black-pigmented gram-negative rods, are implicated in the development of the acute periradicular inflammation, producing symptoms such as pain, swelling, tenderness and exudation12. Microorganisms found in the root canals of primary teeth are similar to those in the root canals of permanent teeth, and black-pigmented anaerobes have been isolated (30% to 50%) from endodontic infections24, but no relationship between any bacterial species and the etiology of pulp infection have been showed, although there is evidence that black-pigmented anaerobes are implicated in the development of acute periradicular inflammation26. In this study, the bacterial presence and the different morphotypes in necrotic pulp and fistula from primary teeth were determined.
MATERIAL AND METHODS
Patients and clinicai samples
A total of 110 children (69 boys and 41 girls), aged from 2 to 12 years old, with clinical and radiographic signs of necrotic pulp or fistula, observed at the School of Dentistry of the Federal University of Espírito Santo (Vitória, ES, Brazil), were selected. All children presented primary teeth with deep dental caries and dental pulp exposed to oral environment. Some children presented vestibular fistula in gingival area. A single clinical sample was collected per child. No child used antibiotics at least three months prior to the sample collection. Children presenting intact teeth, dental pain at oral examination or any chronic disease were excluded.
Necrotic pulp samples (35 maxilla and 68 mandible region) from 103 children, and gingival fistulas (6 maxilla and 1 mandible region) from 7 children were collected. Necrotic pulp or fistula samples were collected by using two sterile paper points (N°. 15, Dentsply, Petrópolis, RJ, Brazil). Initially, tooth and pulp chamber were isolated by rubber dam and the tooth and the surrounding field were cleansed with 3% hydrogen peroxide and decontaminated with a 1% sodium hypochlorite solution for 1 min. The sterility of the tooth surface after cleaning and disinfection was evaluated by samples taken from the surface and processed by PCR. Before collecting fistula sample, antisepsis with iodine (2%) for 1 min was performed. Sodium hypochlorite and iodine solutions were neutralized with sodium thiosulfate (5%) for 30 s. In dry root canal, one drop of sterile saline (0.9%) was added, avoiding flooding27. The paper points were left in wet canal for 60 s and then transferred to tubes containing 250 µL of TE. All clinical samples were analyzed within 4 h after collection. All children's guardians signed a consent form approved by Committee for Ethics in Human Research of the Institute of Biomedical Sciences, University of São Paulo (Process N° CEH/678).
Bacterial morphotypes from pulp necrotic and fístula samples
Bacterial morphotypes were directly determined from collected samples by using Gram and Brown-Brenn staining. The stained smears were observed and photographed with a light microscopy (1000 X DMIL Leica, Wetzlar, Germany).
Bacterial DNA detection from pulp and fístula samples
Clinical samples were collected and resuspended in 100 µL of sterile ultrapure water (Milli-Q, Millipore, Bedford, MA, USA) and boiled for 10 min. After centrifugation, the supernatant (DNA) was obtained and stored at -80°C. DNA concentration and purity were determined by spectrophotometer (A260nm) and electrophoresis in 1% agarose gel.
PCR assays were performed in a thermal cycler (Perkin Elmer Gene Amp PCR System 2400, Norwalk, CT, USA) with final volumes of 25 µL containing 1X PCR buffer, 0.2 mM of dNTP mixture, 0.4 µM of each primer, 50 mM MgCl2, 0.5 U Platinum Taq DNA polymerase (Invitrogen do Brasil, Sao Paulo, SP, Brazil), and 1 ng DNA. The respective primers, amplification conditions, and amplicon sizes are described in Table 1. A universal primers pair was used to verify the presence of DNA in all samples.
Table 1.
Species-specific primers and amplification conditions used for bacterial detection
| Microorganisms | Sequence 51-—>3' | Amplicon | Amplification cycles | Reference |
|---|---|---|---|---|
| Prevotella intermedia | TTT GTT GGG GAG TAA AGC GGG | 600 | 30 cycles: | 11 |
| TCA ACA TCT CTG TAT CCT GCG T | 94ºC 30 sec | |||
| 50ºC 30 sec | ||||
| 72ºC 30 sec | ||||
| Prevotella nigrescens | ATG AAA CAA AGG TTT TCC GGT AAG | 804 | 30 cycles: | 11 |
| CCC ACG TCT CTG TGG GCT GCG A | 94ºC 30 sec | |||
| 60ºC 1 min | ||||
| 72ºC 2 min | ||||
| Porphyromonas endodontalis | GCT GCA GCT CAA CTG TAG TC | 672 | 30 cycles: | 11 |
| CCG CTT CAT GTC ACC ATG TC | 94ºC 30 sec | |||
| 60ºC 30 sec | ||||
| 72ºC 30 sec | ||||
| Porphyromonas gingivalis | AGG CAG CTT GCC ATA CTG CG | 404 | 30 cycles: | 11 |
| ACT GTT AGC AAC TAC CGA TGT | 94ºC 30 sec | |||
| 60ºC 30 sec | ||||
| 72ºC 30 sec | ||||
| Tannerella forsythia | GCG TAT GTA ACC TGC CCG CA | 600 | 30 cycles: | 18 |
| TGC TTC AGT GTC AGT TAT ACC T | 94ºC 30 sec | |||
| 60ºC 30 sec | ||||
| 72ºC 30 sec | ||||
| Fusobacterium nucleatum | CAA ATG CTT GTG TCA ATA ATA CT | 500 | 30 cycles: | 23 |
| TTT AGA AGA AAT GGT AGA ATA AT | 94ºC 30 sec | |||
| 40ºC 30 sec | ||||
| 72ºC 30 sec | ||||
| Treponema denticola | TAA TAC CGA ATG TGC TCA TTT ACA T | 316 | 30 cycles: | 18 |
| TCA AAG AAG CAT TCC CTC TTC TTC TTA | 94ºC 30 sec | |||
| 60ºC 30 sec | ||||
| 72ºC 30 sec | ||||
| Eikenella corrodens | CTA ATA CCG CAT ACG TCC TAA G | 700 | 30 cycles: | 18 |
| CTA CTA AGC AAT CAA GTT GCC C | 94ºC 30 sec | |||
| 45ºC 30 sec | ||||
| 72ºC 30 sec | ||||
| Campylobacter rectus | TTT CGG AGC GTA AAC TCC TTT TC | 600 | 30 cycles: | 18 |
| TTT CTG CAA GCA GAC ACT CTT | 94ºC 30 sec | |||
| 50ºC 30 sec | ||||
| 72ºC 30 sec | ||||
| Enterococcus spp. | TACTGACAAACCATTCATGATG | 112 | 30 cycles: | 12 |
| AACTTCGTCACCAACGCGAAC | 94ºC 30 sec | |||
| 50ºC 30 sec | ||||
| 72ºC 1 min | ||||
| Dialister pneumosintes | TTC TAA GCA TCG CAT GGT GC | 1105 | 30 cycles: | 22 |
| GAT TTC GCT TCT CTT TGT TG | 94ºC 30 sec | |||
| 55ºC 1 min | ||||
| 72ºC 2 min | ||||
| Aggregatibacter actinomycetemcomitans | CCG GAC GTT AGC AGG AAA TTG | 3500 | 30 cycles: | 24 |
| TAA CGC CAC ATG AAA CAC TTC | 94ºC 30 sec | |||
| 56ºC 30 sec | ||||
| 72ºC 30 sec | ||||
| 16S rRNA universal primers | AGA GTT TGA TCC TGG CTC AG | 3480 | 30 cycles: | 8 |
| GGC TAC CTT GTT ACG ACT T | 94ºC 30 sec | |||
| 58ºC 30 sec | ||||
| 72ºC 30 sec |
PCR products were analyzed by electrophoresis (70 V, 2 h) in 1% agarose gel visualized and photographed under UV light. 1-kb DNA ladder was used as molecular marker. DNA from Enterococcus faecalis ATCC 29212, Aggregatibacter actinomycetemcomitans ATCC 29522, Fusobacterium nucleatum ATCC 25586, Porphyromonas gingivalis ATCC 33277, Porphyromonas endodontalis ATCC 35406, Prevotella intermedia ATCC 25611, Prevotella nigrescens ATCC 33563, Dialister pneumosintes ATCC 33048, Tannerella forsythia ATCC 43037, Eikenella corrodens ATCC 23834, Treponema denticola ATCC 33520, and Campylobacter rectus ATCC 33238 were used as positive controls. In all PCR reactions, sterile water was used as negative control instead of DNA.
Statistical analysis
The cumulative frequency of distribution and chi-square test were used to verify the bacterial occurrence vs. age and sex. P-values less than 0.05 were considered as statistically significant.
RESULTS
In this study, the lower molar teeth showed a high incidence of pulp necrosis (66%), followed by upper molars (24.1%) and incisors (4.7%). The presence of fistulas was often observed at upper molars (57.4%), followed by lower molars (28.6%) and upper central incisor (14.3%). Enterococcus spp. and P. gingivalis were prevalent in necrotic pulp of children from 2 to 5 years old, followed by children from 6 to 9 years and 10 to 12 years old. High bacterial numbers showing statistically significant values among boys from 6 to 9 years old (P=0.0520) and from 10 to 12 years (P=0.0261) were observed (Table 2).
Table 2.
Bacterial detection from necrotip pulp (88) and fistula (7) samples of children
| Microorganisms | Age (years) and sex | Total | |||||
|---|---|---|---|---|---|---|---|
| 2 to 5 | 6 to 9 | 10 to 12 | |||||
| B | G | B | G | B | G | ||
| Necrotic pulp | |||||||
| Enterococcus spp. | 15 | 7 | 8 | 8 | 4 | 2 | 44 |
| Porphyromonas gingivalis | 14 | 4 | 9 | 9 | 4 | 3 | 43 |
| Fusobacterium nucleatum | 7 | 4 | 5 | 4 | 2 | 0 | 22 |
| Prevotella nigrescens | 2 | 0 | 0 | 3 | 3 | 2 | 10 |
| Prevotella intermedia | 1 | 1 | 1 | 1 | 1 | 0 | 5 |
| Treponema denticola | 1 | 0 | 0 | 2 | 0 | 0 | 3 |
| Tannerella forsythia | 0 | 0 | 0 | 2 | 0 | 0 | 2 |
| Eikenella corrodens | 0 | 1 | 1 | 0 | 0 | 0 | 2 |
| Campylobacter rectus | 0 | 0 | 0 | 2 | 0 | 0 | 2 |
| Porphyromonas endodontalis | 0 | 0 | 1 | 0 | 0 | 0 | 1 |
| Total | 40 | 17 | 25 | 31 | 14 | 7 | 134 |
| Fistula | |||||||
| Enterococcus spp. | 0 | 0 | 0 | 0 | 1 | 1 | 2 |
| Porphyromonas gingivalis | 1 | 0 | 0 | 1 | 1 | 0 | 3 |
| Fusobacterium nucleatum | 1 | 0 | 0 | 0 | 0 | 0 | 1 |
| Prevotella nigrescens | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
| Dialister pneumosintes | 0 | 0 | 0 | 1 | 0 | 0 | 1 |
| Total | 2 | 0 | 0 | 3 | 2 | 1 | 8 |
B: boys; G: girls
Different bacterial morphotypes in necrotic pulp and fistula samples were observed. Gram-positive cocci were predominant (81.8%), followed by gram-negative coccobacilli (49%) and gram-positive bacilli (15.5%) (Figure 1A). In addition, the occurrence of gram-positive cocci and gram-negative coccobacilli did not present statistically significant values for sex or age (P=0.7380). Associations of different bacterial morphotypes were also observed (Figure 1B).
Figure 1.
Bacterial morphotypes observed in 88 necrotip pulp and 7 fistula samples. (A) Gram and Brown-Brenn staining. (B) Bacterial morphotypes in association
Bacterial DNA was detected in 88 out of 103 necrotic pulps and in 7 fistula samples by using the universal primers. In necrotic pulp samples, Enterococcus spp. (50%), P. gingivalis (48.9%) and F. nucleatum (25%) were predominantly found (Figure 2A). The occurrence of Enterococcus spp. was higher in boys than girls and presented statistically significant values (P=0.0297); however, no significant difference regarding age (P=0.2994) was observed. In Figure 2B, the bacterial associations are observed.
Figure 2.
Bacterial detection by PCR in 88 necrotic pulps of deciduous teeth. (A) Bacteria detected. (B) Bacterial association
Three out of seven fistula samples harbored P. gingivalis, two samples Enterococcus spp., and, one sample, F. nucleatum, P. nigrescens and D. pneumosintes. In addition, in two fistulas, P. gingivalis was found associated with Enterococcus spp. and F. nucleatum, and P. nigrescens with D. pneumosintes. Pulp or fistula samples did not harbor A. actinomycetemcomitans.
DISCUSSION
In this study, children presented high incidence of dental caries with necrotic pulp at mandible molars. It may be explained by the food retention and poor oral hygiene in children of this age, producing large accumulation ofdental biofilm2.
In adults, the occurrence of bacterial morphotypes in primary endodontic infections has been described, and they are represented by cocci, bacilli, spirillum and filamentous forms19. In children, the presence of different morphotypes in oral infections of primary teeth, such as caries followed by pulp necrosis, has also been observed20. Studies have shown that in root canals of primary teeth with necrotic pulp there is predominance of anaerobic microorganisms, similar to the microbiota of permanent teeth21. In addition, the presence of different microorganisms in canal or necrotic pulp can represent the maintenance of infection or any synergistic infection.
Gram-positive cocci and gram-negative coccobacilli appear to be able to colonize necrotic pulp and fistula tissues alone or synergistically, and may collaborate for the maintenance of infection16. The lack of endodontic treatment may alter the development of permanent tooth and, also, increase root resorption, leading to premature loss of deciduous teeth.
Different bacterial species belonging to genera Prevotella, Porphyromonas, Fusobacterium, Treponema, Campylobacter, Enterococcus, Tannerella and Dialister have been identified in adults with primary endodontic infections14,22.
In this study, the primers used presented high sensitivity for detecting enterococci10 from root canal. The presence of Enterococcus spp. was observed in 50% of pulp necrotic samples, and most of them (19%) were not associated with other bacteria; it may lead to the progression of a chronic disease14. On the other hand, Siqueira, et al.20 (2002) identified the presence of E. faecalis in root canal samples (7.5%) and asymptomatic lesions (11.5%) by using a checkerboard DNA-DNA hybridization.
Studies have shown that enterococci isolated from foods are able to colonize the oral cavity, suggesting that these microorganisms can survive in dental biofilm, participating of endodontic infections1,25. In addition, it was reported that E. faecalis isolated from necrotic root canals and fecal material of adults with endodontic infection did not present any genetic similarity, suggesting an exogenous contamination, mainly by industrial food25. On the other hand, enterococci have been found in 52.5% of dairy foods, such as milk and cheese, and it was suggested that the consumption of foods containing enterococci could collaborate with the increase of E. faecalis in necrotic pulp; however, it is not fully defined6.
The high prevalence of Enterococcus spp. and P. gingivalis observed in necrotic pulp of children from 2 to 5 years old can be explained by difficulty to perform effective tooth brushing. Microbiological studies showing the bacterial prevalence in deciduous teeth with pulp infections are scarce. Since E. faecalis can acquire resistance to antimicrobials commonly used in endodontic treatment15, the detection of this microorganism from different endodontic infections is of interest.
The presence of black-pigmented anaerobic rods, such as Porphyromonas spp. and Prevotella spp. has been associated with primary endodontic infections and acute periradicular abscesses5. It may suggest a possible cross infection between root canal and periodontal pocket. In addition, several possible ways to access the pulp are suggested, such as root canals, dentin, cement, and physiological areas of root resorption14.
The presence of P. gingivalis has been shown in endodontic infections affecting approximately 27% of the deciduous teeth8,27; however, in this study, this microorganism was observed in 49% of the analyzed necrotic pulps, and this result is similar to that found in adults22. In addition, pulp samples harbored P. nigrescens (11%), P. intermedia (6%) and P. endodontalis (11%), and, certainly, their association with other bacteria may contribute to the pathogenicity and maintenance of the infectious process.
Bacterial associations such as Porphyromonas spp./Prevotella spp. and P. gingivalis/Enterococcus spp. were detected, suggesting that these microorganisms are able to survive in necrotic tissues, alone or in association. The availability of nutrients, low oxygen tension and bacterial interactions are important ecological determinants for these bacteria in root canals with necrotic pulp24.
Fusobacterium nucleatum colonizes the oral cavity, and has often been isolated from primary endodontic infections in adult patients7. This microorganism has been found in between 4% and 18% of the pulp infections of deciduous teeth27. In this study, F. nucleatum was found in 25% of the necrotic pulps, alone or in association with Enterococcus spp. and/or P. gingivalis. Synergistic association between F. nucleatum and P. gingivalis has been described in various forms of periodontitis, and associated to the dental biofilm formation18.
Spirochetes such as Treponema denticola and Treponema socranskii have been detected in 77% of adults with primary endodontic infections, and both bacteria are considered prevalent in these infectious processes. Species of Treponema have been found in 2.6% of the pulp infections of deciduous teeth27. Notwithstanding, P. gingivalis and Treponema spp. are considered important microorganisms in patients with adult periodontitis22, but the presence of T. denticola has been detected in small proportion and in association with P. gingivalis, Enterococcus spp. or P. nigrescens. It is suggested that bacterial association contributes to the pathogenic biofilms formation. In this study, the low detection rate (2.3%) of Tannerella forsythia, Campylobacter rectus and Eikenella corrodens is in accordance with the literature17. Recently, Campylobacter spp. was detected in 3.3% of children with endodontic abscesses27.
Dialister pneumosintes has been observed in children and young adults with gingivitis and periodontitis, as well as lung and brain abscesses, and root canal4. In this study, only one fistula sample harbored D. pneumosintes in association with P. nigrescens. Both microorganisms have been isolated from primary endodontic infections, mainly in periapical lesions, and their presence in association can suggest any synergistic effect in the infected sites.
Aggregatibacter actinomycetemcomitans is a capnophilic bacteria which is considered a causal agent of localized aggressive periodontitis in young adults; the absence of this bacterium in the analyzed samples can be explained by the fact that this microorganism is not able to survive in the root canal18.
Studies have associated the failure of endodontic treatment in adults with the presence of E. faecalis. This microorganism shows high resistance to calcium hydroxide and irrigating solutions commonly used in endodontic treatment12,15. In addition, this bacterial resistance may also occur in treatment of primary teeth, producing a persistent infection. On the other hand, it has been pointed out that some chemical substances commonly used in endodontic treatment can produce changes in the physicochemical properties of dentin, microbiota, bacterial adherence and biofilm formation9.
Enterococcus faecalis, P. gingivalis and F. nucleatum were found in high numbers, and their presence may contribute to the development of chronic infections, such as gingivitis or periodontitis. Since the presence of Enterococcus spp. and P. gingivalis in pulp and fistula samples from deciduous teeth was observed, a possible bacterial synergism inside the root canal is suggested, and, certainly, it might increase their resistance against the antimicrobial agents most commonly used in Pediatric Dentistry.
ACKNOWLEDGEMENTS
The authors thank Marcia Harumi Fukugaiti for her technical support. This study was supported by CNPq grant N° 143056/2006-9 and FAPESP N° 08/58738-7. During the course of this work, VN was supported by FAPESP Proc. 08/57330-4.
REFERENCES
- 1.Al-Ahmad A, Maier J, Follo M, Spitzmüller B, Wittmer A, Hellwig E, et al. Food-borne enterococci integrate into oral biofilm: an in vivo study. J Endod. 2010;36(11):1812–1819. doi: 10.1016/j.joen.2010.08.011. [DOI] [PubMed] [Google Scholar]
- 2.Braga MM, Martignon S, Ekstrand KR, Ricketts DN, Imparato JC, Mendes FM. Parameters associated with active caries lesions assessed by two different visual scoring systems on occlusal surfaces of primary molars a multilevel approach. Community Dent Oral Epidemiol. 2010;38(6):549–558. doi: 10.1111/j.1600-0528.2010.00567.x. [DOI] [PubMed] [Google Scholar]
- 3.Cuoghi AO, Bertoz FA, Mendonca MR, Santos EC. Loss of space and dental arch length after the loss of the lower first primary molar: a longitudinal study. J Clin Pediatr Dent. 1998;22(2):117–120. [PubMed] [Google Scholar]
- 4.Doan N, Contreras A, Flynn J, Slots J, Chen C. Molecular Identification of Dialister pneumosintes in subgingival plaque of humans. J Clin Microbiol. 2000;38(8):3043–3047. doi: 10.1128/jcm.38.8.3043-3047.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Fouad AF, Barry J, Caimano M, Clawson M, Zu Q, Carver R, et al. PCR-based identification of bacteria associated with endodontic infections. J Clin Microbiol. 2002;40(9):3223–3231. doi: 10.1128/JCM.40.9.3223-3231.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Gomes BP, Pinheiro ET, Sousa EL, Jacinto RC, Zaia AA, Ferraz CC, et al. Enterococcus faecalis in dental root canals detected by culture and by polymerase chain reaction analysis. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2006;102(2):247–253. doi: 10.1016/j.tripleo.2005.11.031. [DOI] [PubMed] [Google Scholar]
- 7.Jacinto RC, Montagner F, Signoretti FGC, Almeida GC, Gomes BPFA. Frequency, microbial interactions and antimicrobial susceptibility of Fusobacterium nucleatum and Fusobacterium necrophorum isolated from primary endodontic infections. J Endod. 2008;34(12):1451–1456. doi: 10.1016/j.joen.2008.08.036. [DOI] [PubMed] [Google Scholar]
- 8.Ito IY, Matoba F, Junior, Paula-Silva FWG, Silva LAB, Leonardo MR, Nelson P., Filho Microbial culture and checkerboard DNA-DNA hybridization assessment of bacteria in root canals of primary teeth pre- and post-endodontic therapy with a calcium hydroxide/ chlorhexidine paste. Int J Paed Dent. 2011;21(5):353–360. doi: 10.1111/j.1365-263X.2011.01131.x. [DOI] [PubMed] [Google Scholar]
- 9.Kishen A, Sum C, Mathew S, Lim C. Influence of irrigation regimens on the adherence of Enterococcus faecalis to root canal dentin. J Endod. 2008;34(7):850–854. doi: 10.1016/j.joen.2008.04.006. [DOI] [PubMed] [Google Scholar]
- 10.Morabito A, Defabianis P. A SEM investigation on pulpal-periodontal connections in primary teeth. ASDC J Dent Child. 1992;59(1):53–57. [PubMed] [Google Scholar]
- 11.Nandakumar R, Mirchandani R, Fouad A. Primer sensitivity: can it infuence the results in Enterococcus faecalis prevalence studies? Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2007;103(3):429–432. doi: 10.1016/j.tripleo.2006.08.020. [DOI] [PubMed] [Google Scholar]
- 12.Ohara PK, Torabinejad M, Kettering JD. Antibacterial effects of various endodontic irrigants on selected anaerobic bacteria. Endod Dent Traumatol. 1993;9(3):95–100. doi: 10.1111/j.1600-9657.1993.tb00258.x. [DOI] [PubMed] [Google Scholar]
- 13.Õnçag O, Cogulu D, Uzel A. Efficacy of various intracanal medicaments against Enterococcus faecalis in primary teeth: an in vivo study. J Clin Pediatr Dent. 2006;30(3):233–237. [PubMed] [Google Scholar]
- 14.Ozbek SM, Ozbek A, Erdogaan AS. Analysis of Enterococcus faecalis in samples from Turkish patients with primary endodontic infections and failed endodontic treatment by real time PCR SYBR green method. J Appl Oral Sci. 2009;17(5):370–374. doi: 10.1590/S1678-77572009000500004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Queiroz AM, Nelson-Filho P, Silva LA, Assed S, Silva RA, Ito IY. Antibacterial activity of root canal filling materials for primary teeth: zinc oxide and eugenol cement, Calen paste thickened with zinc oxide, Sealapex and EndoRez. Braz Dent J. 2009;20(4):290–296. doi: 10.1590/s0103-64402009000400005. [DOI] [PubMed] [Google Scholar]
- 16.Rocha CT, Rossi MA, Leonardo MR, Rocha LB, Nelson-Filho P, Silva LA. Biofilm on the apical region of root in primary teeth with vital and necrotic pulps with or without radiographically evident apical pathosis. Int Endod J. 2008;41(4):664–669. doi: 10.1111/j.1365-2591.2008.01411.x. [DOI] [PubMed] [Google Scholar]
- 17.Ruviére DB, Leonardo MR, Silva LAB, Ito IY, Nelson-Filho P. Assessment of the microbiota in root canals of human primary teeth by checkerboard DNA-DNA hybridization. J Dent Child (Chic) 2007;74(2):118–123. [PubMed] [Google Scholar]
- 18.Saito Y, Fujii R, Nakagawa K, Kuramitsu HK, Okuda K, Ishihara K. Stimulation of Fusobacterium nucleatum biofilm formation by Porphyromonas gingivalis. Oral Microbiol Immunol. 2008;23(1):1–6. doi: 10.1111/j.1399-302X.2007.00380.x. [DOI] [PubMed] [Google Scholar]
- 19.Siqueira JF, Jr, Rôças IN, Lopes HP. Patterns of microbial colonization in primary root canal infections. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2002;93(2):174–178. doi: 10.1067/moe.2002.119910. [DOI] [PubMed] [Google Scholar]
- 20.Siqueira JF, Roças IN, Souto R, Uzeda M, Colombo AP. Actinomyces species, streptococci, and Enterococcus faecalis in primary root canal infections. J Endod. 2002;28(3):168–172. doi: 10.1097/00004770-200203000-00006. [DOI] [PubMed] [Google Scholar]
- 21.Silva LAB, Nelson-Filho P, Faria G, Souza-Gugelmin MCM, Ito IY. Bacterial profile in primary teeth with necrotic pulp and periapical lesions. Braz Dent J. 2006;17(2):144–148. doi: 10.1590/s0103-64402006000200012. [DOI] [PubMed] [Google Scholar]
- 22.Slots J, Ashimoto A, Flynn MJ, Li G, Chen C. Detection of putative periodontal pathogens in subgingival specimens by 16S ribosomal DNA amplification with the polymerase chain reaction. Clin Infect Dis. 1995;20(Suppl 2):S304–S307. doi: 10.1093/clinids/20.supplement_2.s304. [DOI] [PubMed] [Google Scholar]
- 23.Sundqvist G. Associations between microbial species in dental root canal infections. Oral Microbiol Immunol. 1992;7(5):257–262. doi: 10.1111/j.1399-302x.1992.tb00584.x. [DOI] [PubMed] [Google Scholar]
- 24.Sundqvist G, Johansson E, Sjögren U. Prevalence of black-pigmented Bacteroides species in root canal infections. J Endod. 1989;15(1):13–19. doi: 10.1016/S0099-2399(89)80092-5. [DOI] [PubMed] [Google Scholar]
- 25.Tronstad L, Kreshtool D, Barnett F. Microbiological monitoring and results of treatment of extraradicular endodontic infection. Endod Dent Traumatol. 1990;6(3):129–136. doi: 10.1111/j.1600-9657.1990.tb00407.x. [DOI] [PubMed] [Google Scholar]
- 26.Van Winkelhoff AJ, Carlee AW, Graaff J. Bacteroides endodontalis and other black-pigmented Bacteroides species in odontogenic abscesses. Infect Immun. 1985;49(3):494–497. doi: 10.1128/iai.49.3.494-497.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Yang QB, Fan LN, Shi Q. Polymerase chain reaction-denaturing gradient gel electrophoresis, cloning, and sequence analysis of bacteria associated with acute periapical abscesses in children. J Endod. 2010;36(2):218–223. doi: 10.1016/j.joen.2009.11.001. [DOI] [PubMed] [Google Scholar]


