Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Apr 1.
Published in final edited form as: Mol Oral Microbiol. 2014 Feb 12;29(2):67–78. doi: 10.1111/omi.12045

Danger Signal Adenosine via Adenosine 2a Receptor Stimulates Growth of P. gingivalis in Primary Gingival Epithelial Cells

Ralee Spooner 1,§, Jefferson DeGuzman 1,§, KyuLim Lee 1, Özlem Yilmaz 1,2,*
PMCID: PMC3960722  NIHMSID: NIHMS551445  PMID: 24517244

SUMMARY

Extracellular signaling during inflammation and chronic diseases involves molecules referred to as ‘Danger Signals’ (DS), including the small molecule adenosine. We demonstrate that primary gingival epithelial cells (GECs) express a family of G-protein coupled receptors known as adenosine receptors, including the high affinity receptors A1 and A2a and low affinity receptors A2b and A3. Treatment of Porphyromonas gingivalis-infected GECs with A2a receptor-specific agonist CGS-21680 resulted in elevated intracellular bacterial replication as determined by fluorescence microscopy and antibiotic protection assay. Additionally, A2a receptor antagonism and knockdown via RNA interference significantly reduced metabolically active intracellular P. gingivalis. Furthermore, analysis of anti-inflammatory mediator cyclic AMP (cAMP) following A2a receptor selective agonist CGS-21680 stimulation induced significantly higher levels of cAMP during P. gingivalis infection, indicating adenosine signaling may attenuate inflammatory processes associated with bacterial infection. This study reveals that the GECs express functional A2a receptor and P. gingivalis may utilize the A2a receptor coupled DS Adenosine signaling as a means to establish successful persistence in the oral mucosa, possibly via down-regulation of pro-inflammatory response.

Keywords: purinergic signaling, A2a receptor, persistence, epithelial mucosa, periodontal disease

INTRODUCTION

Porphyromonas gingivalis is a Gram-negative opportunistic pathogen that has been strongly involved in severe forms of periodontitis and recently associated with a number of other chronic pathologies. Gingival epithelial cells (GECs), which form the initial barrier to the colonizing bacteria in the gingival crevice and function as an important arm of the immune system, are among the first host cells populated by P. gingivalis (Yilmaz et al., 2008). The organism has been demonstrated to successfully enter and replicate in GECs and exhibit highly specialized host-adaptive mechanisms to establish persistence in the oral epithelium (Yilmaz et al., 2008; Yao et al., 2010, Choi et al., 2011, Choi et al., 2013).

Infected, dying, or stressed cells release “danger signals (DSs)” that are normally found in the cytosol and nucleus of healthy cells, including ATP and adenosine. A key DS molecule is adenosine-triphosphate (ATP), a nucleoside molecule involved in cellular energetics. Despite its commonly understood role as an energy source, it is becoming increasingly evident that ATP is a potent regulator of inflammation (Ishii & Akira, 2008). ATP released from inflamed tissues acts through ionotropic purinergic receptors, notably P2X7 receptor, to activate specific pro-inflammatory signaling cascades (Miller et al., 2011). These downstream effects of ATP-P2X7 coupling can also limit the ability of opportunistic pathogens to establish intracellular infections (Coutinho-Silva & Ojcius, 2012). We previously demonstrated that P. gingivalis effectively subverts ATP-P2X7 mediated host response in GECs to support its colonization in the oral mucosa (Yilmaz et al., 2008; Choi et al., 2013).

A less appreciated component of the innate immune armamentarium is the DS adenosine, a metabolite of ATP that is generated via a series of enzymatic reactions in normal, stressed, and infected tissues (Yegutkin, 2008). The pro-inflammatory features of ATP, especially for limiting of intracellular infections, have been thoroughly studied, while the anti-inflammatory nature of adenosine during infection remains largely unexplored (Bours et al., 2006). Adenosine receptors are G-protein coupled receptors (GPCRs) belonging to the P1 superfamily, including A1, A2a, A2b, and A3 subtypes, all of which have varying degrees of sensitivity to adenosine. The A2a receptor is highly sensitive to adenosine and suppresses inflammation by relying on cAMP-dependent activation of downstream effectors including Akt, CREB, and NF-kB (Jacobson & Gao, 2006). Recent studies demonstrate that stimulation of the A2a receptor with receptor-specific agonist CGS-21680 reduces lung inflammation by interfering with neutrophil migration (Impellizzerri et al., 2011) and protects activated T-cell lymphocytes from activation-induced cell death (Himer et al., 2010). During infection, the A2a receptor has been shown to suppress inflammation caused by gastric T-cell lymphocytes while simultaneously promoting persistence of Helicobacter pylori (Alam et al., 2009). While additional studies have evaluated the importance of other adenosine receptors in infection, notably A2b during the infections by Chlamydia (Pettengill et al., 2009) and Klebsiella (Barletta et al., 2012) in neutrophils and HeLa cells, little is known about A2a receptor function in controlling intracellular bacterial infections. Furthermore, the role of adenosine signaling in the context of oral bacteria and gingival epithelium interaction remains completely uncharacterized.

Recent literature supports the importance of adenosine signaling in the oral cavity, particularly for periodontal disease. Bitto et al. (2013) reported an adenosine-dependent reduction in periodontal inflammation in rat models, while another study detected elevated A2a receptor mRNA expression in gingival tissues of patients diagnosed with chronic periodontal disease (Sun et al., 2011). Furthermore, macrophages have been shown to upregulate A2a receptor mRNA when challenged with LPS (Streitová et al., 2011). For the opportunistic pathogens, Staphylococcus aureus and Bacillus anthracis, manipulation of adenosine concentration appears to be a key survival mechanism and contributor to pathogenesis (Thammavongsa et al., 2009). Given the anti-inflammatory nature of P. gingivalis infection in the GECs, including antagonism of pro-inflammatory cytokine IL-8 induced by other pathogens (Takeuchi et al., 2013) and attenuation of host cell apoptosis, it became logical for us to explore adenosine and the A2a receptor coupling during P. gingivalis infection.

The present study demonstrates for the first time that primary GECs express the full complement of adenosine receptors, including the A2a receptor that is distributed across the cell membrane. Stimulation of P. gingivalis-infected GECs with A2a receptor-specific agonist CGS-21680 strongly induces proliferation of intracellular P. gingivalis, while treatment with broad-spectrum adenosine receptor agonist NECA has much lesser effect on the amount of infection. Antibiotic protection assay of P. gingivalis-infected GECs treated with A2a receptor-specific agonist CGS-21680 revealed significantly higher amounts of recoverable P. gingivalis than the un-stimulated infected cells. Treatment of P. gingivalis-infected GECs with A2a receptor-specific antagonist SCH-58261 inhibited intracellular growth of bacteria. Additionally, siRNA depletion of A2a receptor resulted in substantially reduced levels of metabolically active flavin mononucleotide-based fluorescent protein-expressing P. gingivalis (PgFbFP), further strengthening the results of this study. Furthermore, stimulation of GECs with A2a receptor-specific agonist CGS-21680 resulted in elevated cAMP, indicating activation of anti-inflammatory A2a receptor signaling. This study shows a novel anti-inflammatory immune response utilized by P. gingivalis to further promote successful subsistence in the oral mucosa.

METHODS

Bacteria and cell culture

The P. gingivalis ATCC 33277 was cultured anaerobically for 24 h at 37°C in trypticase soy broth supplemented with yeast extract (1 μg/ml), hemin (5 μg/ml), and menadione (1 μg/ml). Bacteria were grown for 24 h, harvested by centrifugation at 6000 g and 4°C for 10 min, washed and re-suspended in Dulbecco’s phosphate-buffered saline (PBS), pH 7.3, before incubation with host cells. Bacteria were quantified using a Klett–Summerson photometer.

Primary GECs were obtained after oral surgery in the clinics of the University of Florida from healthy gingival tissue as previously described (Yilmaz, et al., 2002). Cells were cultured as monolayers in serum-free keratinocyte growth medium (Lonza, Walkersville, MD) at 37°C in 5% CO2. GECs were used for experimentation at 80% confluence and cultured for 48 h before infection with bacterial cells or exposure to other test reagents in keratinocyte growth medium. The passage number of the primary GECs utilized for the experiments ranged from 3–7 with consistently similar results.

Reverse transcription PCR analysis for adenosine receptors

Total RNA was isolated from primary GECs using RNeasy kit (Qiagen) following the manufacturer’s instructions. Total RNA was converted into cDNA by standard reverse transcription with M-MLV-Reverse Transcriptase (Promega). cDNAs were amplified using the MJ, Mini (BIO-RAD laboratories) in a 25 μl reaction mixture containing one-fifteenth of the cDNA generated from reverse transcription reaction, 10X PCR buffer, 2.5 mM MgCl2, 0.25 mM (each) dNTPs, 0.5 μM forward and reverse primers, and 1 U GoTaq DNA polymerase (Promega). The sequences of the primers used for A1, A2a, A2b, and A3 were designed and obtained from Invitrogen (Table 1). The optimum annealing temperatures for each set of primers was determined prior to beginning PCR cycling (data not shown). The PCR protocol for the respective primers was initiated at 94°C for 1 min, pre-determined annealing temperature for 1 min, and 72°C for 1 min. The protocol was conducted for 30 cycles and included an initial 5 min enzyme activation step at 94°C and a final 5 min extension step at 72°C. “No reverse transcriptase” control was included in the assays. PCR products were electrophoresed on a 1.5% agarose gel and visualized by ethidium bromide staining. At least three different GEC cell lines were used for the analysis.

Table 1.

RT-PCR primers for adenosine receptors with optimized annealing temperatures and expected amplified product size.

Subtype Forward (5′-3′) Reverse (3′–5′) Expected size Optimized annealing temperature (C)
A1 CCACAGACCTACTTCCACAC GTAGATGAGGACCATGAGGA 384 56
A2a AACGTCACCACTACTTTGT AGTTGAAGTACACCATGTAG 430 61
A2b GCTCCATCTTCAGCCTTCTG ACCCAGAGGACAGCAATGAC 121 66
A3 CTGCTTGAGTCCTGAGTCAC CCACACCTCAGAGACTGATT 801 61
Open in a new tab

Surface expression analysis of A2a adenosine receptor via immunofluorescence microscopy

Gingival epithelial cells were grown on 4-well chambered glass slides (Nalge-Nunc International), washed with ice-cold PBS, and fixed with 10% neutral buffered formalin for 1 h at room temperature. After washing twice with PBS, the cells were treated with permeabilization solution (0.1% Triton X-100) for 15 min. Samples were then washed twice with PBS and incubated with antibody raised in mice against full length recombinant human A2a receptor (Santa Cruz Biotechnology) and detected with Alexa-Fluor 594 anti-mouse secondary antibody (Invitrogen). Samples with no primary antibody incubation were included as control. Glass coverslips to visualize the samples were mounted using media containing 4,6-diamidino-2-phenylindole (DAPI) 1 μg ml–1 (Vector Labs) to visualize the nuclei. Finally, the samples were washed twice with PBS and analyzed using a Zeiss Axio Imager A1 fluorescence microscope equipped with band pass optical filter sets appropriate for imaging of the dyes and a cooled CCD camera (Qimaging). Single exposure images were captured sequentially and saved by Qcapture software v.1394.

Pharmacological treatment of adenosine receptors in P. gingivalis-infected GECs

Gingival epithelial cells were infected at a multiplicity of infection (moi) of 100 with P. gingivalis for 24 at 37°C in a 5% CO2 incubator. For analysis of effects of adenosine receptors on P. gingivalis infection, the infected GECs were treated at 1 h and 3 h post-infection (pi) with 10 μM A2a-receptor-specific agonist CGS-21680 (Tocris Biosciences), 100μM broad spectrum adenosine receptor agonist 5′-N-Ethylcarboxamidoadenosine (NECA) (Sigma), or 10μM A2a-specific antagonist SCH-58261 (Tocris Biosciences). Pharmacological reagents were chosen based on available literature [Jacobsen et al., 2006]. All time points for the infections were carried backwards, so that all incubations could be stopped and assayed at the same time at the end of 24 h.

Impact of adenosine receptor on P. gingivalis infection via immunofluorescence microscopy analysis

Immunofluorescence labeling and microscopy for determining the level of infection were performed as previously described (Yilmaz et al., 2006). Briefly, GECs cultivated on 4-well chambered cover-glass slides were infected with P. gingivalis at moi of 100 at 37°C for 24 h. The samples were incubated with anti-P. gingivalis 33277 antibody (a gift by Dr. Richard J Lamont) and reacted with Oregon Green 488 secondary antibody (Invitrogen), and glass coverslips were mounted using media with DAPI (Vector Labs). The samples were visualized using the fluorescence microscope system described above. Acquired images were analyzed for the intensity of fluorescence emitted from the infected samples with NIH ImageJ analysis software. An average of 175 fields per sample were studied from at least two separate experiments performed in duplicate.

Antibiotic protection assay

GECs were infected at moi of 100 with P. gingivalis for 24 h at 37°C in a 5% CO2 incubator. A2a receptor-specific agonist CGS-21680 was added to culture at 1 h pi to a final concentration of 10 μM. Following 3 h infection, culture media was replaced with 400 μM metronidazole and 500 μM gentamicin diluted in PBS and cells were incubated for an additional 1 h at 37 °C. Cells were washed three times with PBS and lysed in 1 ml sterile H2O at 37 °C for 30 m. Recovered lysate was then plated on blood agar plates and incubated at 37 °C for 48 h for analysis of colony formation. The average of total CFU/ml−1 of un-stimulated infected GECs were set as 100 percent.

Flavin mononucleotide-based fluorescent protein-expressing P. gingivalis (PgFbFP)

Further analyses to verify immunofluorescence observations reported in this study were determined by using a P. gingivalis ATCC 33277 transformant strain ((PgFbFP)) previously developed in our laboratory (Choi et al., 2011). GECs cultured in 4-well cover-glass slides were infected at moi of 100 with PgFbFP for 24 h at 37°C in a 5% CO2 incubator. GECs were treated with A2a receptor-specific agonist CGS-21680 and A2a receptor-specific antagonist SCH-58261 at 3 h pi, and A2a-knockdown cells were also used. Cells were washed with ice-cold PBS, and fixed with 10% neutral buffered formalin for 1 h at room temperature. Pictures were taken using Zeiss Axio Imager A1 microscope and a cooled-CCD camera (Qimaging). Fluorescence intensity analysis was carried out using NIH ImageJ software. An average of 175 fields per sample were studied from two separate experiments performed in duplicate.

Depletion of A2a by RNA interference

20 μM siRNA solution was diluted in 1X siRNA buffer (Dharmacon) to final concentration of 5 μM. Per culture dish well, 10 μL of 5 μM siRNA solution was added to 190 μL serum-free solution and 2 μL of DharmaFECT transfection reagent was added to 198 μL serum-free media each solution was incubated at room temperature (RT) after mixing for 5 m. The siRNA and transfection reagent solutions were then mixed gently together and incubated at RT for 20 m. GECs were cultured in 6-well dishes at 37 °C for 24 h prior to siRNA transfection. 1.6 mL of antibiotic-free media was added along with 400 μL of prepared siRNA/transfection reagent solution to yield a final concentration of 25 nM siRNA per culture well. Non-target pool siRNA (Dharmacon) and transfection agent alone were used as negative controls. A2a receptor knockdown GECs were verified using quantitative RT-PCR as described previously (Yilmaz et al., 2010), resulting in ~67% depletion of A2a receptor in knockdowns (data not shown).

cAMP level detection

Assessment of intracellular cAMP levels was carried out by using cyclic AMP (Direct) Enzyme Immunometric Assay kit per manufacturer’s instructions (Assay Designs). Un-infected, non-treated GECs were used as baseline controls. Analysis conditions included non-treated P. gingivalis-infected GECs, 10 μM A2a receptor-specific agonist CGS-21680-treated un-infected GECs, P. gingivalis-infected GECs treated with 10 μM CGS-21680 1 h post-infection, un-infected GECs treated with 10 μM A2a receptor-specific antagonist SCH-58261 and subsequently stimulated with 10 μM CGS-21680 1 h after initial treatment, and SCH-58261-treated GECs 1 h prior to infection with P. gingivalis. Samples were prepared per manufacturer specifications in microtiter plates and cAMP signal was detected via absorbance at 405 nm. Time courses of infections and pharmacological treatments were carried out backwards, so all conditions could be assayed at the same time.

RESULTS

Primary GECs express functional adenosine receptors

A2a receptors are expressed in a variety of tissues, and its presence in oral tissues has been reported to occur in gingival fibroblasts (Murakami et al., 2001) and epithelium (Murakami et al., 2002). To confirm the adenosine receptor expression profile of primary GECs, we utilized RT-PCR and immunofluorescence microscopy. RT-PCR analysis reveals that primary GECs express all four adenosine receptor subtypes, as amplicons were detected for A1, A2a, A2b, and A3 receptors (Figure 1A). Immunofluorescence microscopy confirmed the surface expression of the A2a receptor uniformly throughout the primary GEC cell membrane (Figure 1B). Thus, cells of the oral mucosa lining express all members of the adenosine receptor family including the A2a receptor.

Figure 1.

Figure 1

Figure 1

Open in a new tab

Primary GECs express Adenosine receptors. (A) RT-PCR analysis of adenosine receptor expression profile in primary GECs. Amplicons of expected sizes were detected for A1 (384 bp), A2a (430 bp), A2b (121 bp), and A3 (801 bp) receptors. The results are representative of at least three different GEC lineages (B) Detection of A2a receptor expression at the cell membrane of GECs via immunofluorescence microscopy. Cells were fixed and subsequently incubated with A2a receptor primary antibody. Staining of cells with conjugated Alexa-Fluor 594 secondary antibody (red) and DAPI (blue) was used to visualize expression pattern of A2a receptor. The staining revealed a diffuse expression of the A2a receptor throughout the cell membrane.

Stimulation of the A2a receptor promotes enhanced infection by P. gingivalis

A variety of chemical compounds are known to serve as agonists for adenosine receptors. In order to ascertain the effects of the A2a receptor specifically, 10 μM CGS-21680, an A2a receptor-specific agonist, was added to P. gingivalis-infected GEC culture medium at 1 h and 3 h post-infection. NIH software ImageJ was used to analyze captured images and quantify fluorescence corresponding to intracellular P. gingivalis. A2a receptor-specific agonist CGS-21680 treatment of P. gingivalis-infected GECs resulted in twice the amount of intracellular P. gingivalis as compared to untreated controls (significant at P < 0.001) (Figure 2). 100 μM NECA, an established broad-spectrum adenosine receptor agonist was also used to determine the effects of general adenosine receptor stimulation on P. gingivalis infection. Treatment of P. gingivalis-infected GECs at 1 h and 3 h post-infection with broad spectrum adenosine receptor agonist NECA resulted in minimal effects on level of intracellular P. gingivalis compared to untreated control [Supplemental figure 1a–d].

Figure 2.

Figure 2

Figure 2

Open in a new tab

A2a receptor activation results in elevated number of intracellular P. gingivalis. GECs were infected with P. gingivalis at moi 100 for 24 h total infection time. Samples were fixed and stained with P. gingivalis primary antibody and subsequently stained with Oregon Green 488 secondary antibody (green) and DAPI (blue) to visualize infection. (A) i. Infected untreated GECs, ii. Infected GECs treated 1 h post-infection with A2a receptor selective agonist CGS-21680, iii. Infected GECs treated 3 h post-infection with CGS-21680. Images presented here are representative of at least 175 fields studied in experiments that were performed two separate times in duplicate. (B) Analysis of fluorescent levels using ImageJ software revealed elevated levels of P. gingivalis in both treatment conditions compared to control. At 1 h post-infection P. gingivalis levels were ~2.5 times that of control and were ~3 times higher at 3 h post-infection. Asterisks (*) denote statistical significance (P < 0.001 Student t-test).

To better evaluate the role of A2a receptor in the intracellular proliferation of P. gingivalis, we performed an antibiotic protection assay comparing the amount of live recoverable bacteria in A2a receptor-specific agonist CGS-21680-treated and un-treated infected GECs (Figure 3). The results of this experiment further confirmed our earlier findings, with twice as many live P. gingivalis recovered from GECs that had been treated with A2a receptor-specific agonist CGS-21680, compared to un-treated control. Thus, A2a receptor activation likely plays a key role in promoting elevated levels of intracellular P. gingivalis in primary GECs.

Figure 3.

Figure 3

Open in a new tab

Antibiotic protection assay of P. gingivalis-infected GECs yields more live bacteria recovered after stimulation of A2a receptor. Stimulation of A2a receptor in P. gingivalis-infected GECs resulted in greater amounts of live bacteria recovered after host cell lysis and plating of intracellular contents on Blood agar plates. There was greater than twice the amount of P. gingivalis recovered after A2a activation compared to un-stimulated infected control. Asterisk (*) indicates statistical significance (P < 0.001 Student t-test) between untreated infected controls and A2a receptor activated infected GECs.

Inhibition and depletion of A2a receptor suppresses P. gingivalis infection

While our findings presented above indicate that stimulation of the A2a receptor appears to be important for P. gingivalis infection, our examinations led us to inquire about what effect preventing A2a receptor activation would have on P. gingivalis infection. SCH-58261, an A2a receptor-specific antagonist, was used to assess the impact A2a receptor blockade has on infection. Infected GECs were treated with 25 μM SCH-58261 at 3 h post-infection and P. gingivalis levels were determined at 24 h total infection time using fluorescence microscopy. Quantification of P. gingivalis fluorescence levels revealed a significant (P<0.001) suppression of infection compared to control and CGS-21680 treatment conditions (Figure 4A and B). These findings prompted us to further examine the relationship between A2a receptor and P. gingivalis interaction by using RNA interference. We first determined that A2a siRNA did not induce cell death in uninfected GECs (data not shown). A2a gene silencing significantly (P<0.001) hindered intracellular numbers of P. gingivalis at 24 h, with infection levels ~50% of infected controls (Figure 4A and B). Thus, a functional A2a receptor appears to be important for successful colonization of P. gingivalis in primary GECs.

Figure 4.

Figure 4

Figure 4

Open in a new tab

Suppression of P. gingivalis infection via pharmacological inhibition or RNAi knockdown of A2a receptor. (A) Primary GECs were infected with the PgFbFP strain at moi 100 for 24 h, fixed and stained with DAPI (blue) to visualize nuclei. The relative amount of intracellular bacteria determined by ImageJ software analysis of images detected using fluorescence microscopy. Treatment of infected GECs with A2a receptor specific agonist CGS-21680 resulted in a ~100% increase in levels of metabolically active bacteria compared to untreated infected control. A2a receptor specific antagonist SCH-58261 treated infected GECs yielded ~30% less infection compared to control. A2a receptor knockdown GECs were infected with the PgFbFP strain and the intracellular bacteria levels at 24 h post-infection were quantified and compared to wild-GEC controls. Asterisks (*) indicate statistical significance (P < 0.001 Student t-test) between CGS-21680 and control, SCH-58261 and control, A2a knockdown condition and control (B) The representative images of the conditions described above i. PGFbFP-infected GECs, ii. PgFbFP-infected GECs were treated with A2a receptor-specific agonist CGS-21680, iii. PgFbFP-infected GECs were treated with A2a receptor-specific antagonist SCH-58261, iv. PgFbFP-infected A2a receptor knockdown GECs. Images presented here are representative of at least 175 fields studied in experiments that were performed two separate times in duplicate.

P. gingivalis infection elevates intracellular cAMP levels via A2a receptor

Adenosine receptors, including A2a, are GPCRs that act through adenylyl cyclase to alter the concentration of intracellular cAMP (Jacobson & Gao, 2006). Recent studies of other intracellular organisms indicate an important role for cAMP during infection that contributes to persistence of infection (Macdonald et al., 2013). Cytosolic cAMP levels during infection or CGS-21680, SCH-58261 treatments were measured to verify the effect of adenosine via A2a receptors over a time course ranging from 30 m to 24 h (Figure 5). cAMP levels in GECs showed two-fold increase at 6 h following A2a-selective CGS-21680 treatment and infection with P. gingivalis showed a similar trend. The increase in cAMP level was inhibited when A2a receptor-stimulated GECs were treated with the A2a receptor-specific antagonist SCH-58261. An initial increase was observed in P. gingivalis infected samples, but began receding to normal levels at 8 h post infection in the presence of SCH-58261. This data indicates that during P. gingivalis infection, cAMP levels are elevated in GECs, and the A2a receptor contributes to this observed effect (Figure 5 and 6).

Figure 5.

Figure 5

Open in a new tab

Activation of A2a receptor during P. gingivalis infection increases intracellular cAMP levels. Un-infected and non-treated GECs were used as control (CON). GECs infected with P. gingivalis, A2a receptor-specific agonist CGS-21680 treated GECs (CGS), A2a receptor-specific antagonist SCH-58261-treated GECs (SCH), A2a receptor stimulated and infected GECs (CGS + P.gingivalis), A2a receptor stimulated and subsequently inhibited GECs (CGS + SCH), and A2a receptor antagonist treatment followed by infected GECs (SCH + P. gingivalis) were utilized as experimental conditions. Intracellular cAMP levels were measured using an ELISA-based cAMP detection kit (Assay Designs) at 30 m, 2 h, 6h, 12 h, and 24 h post-infection. Results represent normalized levels of cAMP compared to un-infected non-treated controls and were obtained from experiments performed in triplicate.

Figure 6.

Figure 6

Open in a new tab

Anti-inflammatory adenosine signaling network contributes to persistence of P. gingivalis infection in primary GECs. Exogenous sources of adenosine stimulate A2a receptor, resulting in cAMP formation via adenylyl cyclase activity. cAMP may indirectly serve as a potential energy source to promote proliferation of intracellular P. gingivalis. Additional activation of anti-inflammatory signaling networks such as protein kinase A (PKA), may also downregulate inflammation of infected tissues. Adenosine-mediated reduction in inflammatory state of P. gingivalis infected tissue and inadvertent energy source supplementation may contribute to persistent infections by P. gingivalis in the oral mucosa.

DISCUSSION

Small molecules including ATP and adenosine act as DS in tissues and help prime the innate and adaptive immune arms to respond to tissue insult via purinergic signaling (Sitovsky & Ohta, 2005; Bours et al., 2006; Ishii & Akira, 2008). Purinergic signaling through ATP has been shown to be strongly involved in mediating inflammatory responses, including upregulation of pro-inflammatory cytokines, production of ROS, and cell death. Conversely, adenosine is associated with reduction in inflammation and immunosuppressive actions including inhibition of neutrophil migration through vascular walls and preventing T-cell-mediated tumor destruction (Ohta et al., 2006; Karmouty-Quintana et al., 2013). Thus, the extracellular environment containing potent DS ATP and adenosine can act through their respective receptors (e.g. P2X7 or A2a receptors) to modulate the inflammatory status of tissues infected by opportunistic pathogens.

The complex nature of the relationship between intracellular pathogens and their host cells involves inside-out and outside-in signaling. Adenosine receptor activation appears to be a conserved theme for bacterial pathogens, with several reports highlighting the importance of adenosine receptors in bacterial infections. For example, persistent infections of epithelial cells by Chlamydia trachomatis was found to be dependent upon A2b receptor activation (Pettengill et al., 2009) and A2b receptors were found to be responsible for Clostridium difficile-mediated inflammation and disease in murine gut epithelium models (Warren et al., 2012). Further studies of the A2b receptor reveals enhanced clearance of K. pneumonia in A2b-deficient mice lung tissues, suggesting that this adenosine receptor may provide protection for bacterial infection (Barletta et al., 2012). In addition, Popov et al. (2011) reported stimulation of the A3 receptor contributes to resolution of B. anthracis infections, suggesting a potential role for adenosine receptors in cutaneous infections by this pathogen. The role of A2a receptor in bacterial infections on the other hand, remains yet to be fully characterized, with few studies directly examining the effects of A2a receptor on infected tissues. Despite this, there is a real need to characterize the interaction between A2a receptor and opportunistic persistent bacteria because the anti-inflammatory nature of adenosine signaling makes it a target for chronic pathogens. To date, studies have only examined the A2a receptor-infection relationship in the context of sepsis models (Sullivan et al., 2004; Németh et al., 2006; Warren et al., 2012) and bacterial toxin-challenged macrophages or monocytes (Souza et al., 2009; Sun et al., 2010). Only Alam et al. (2009) directly examined the impact of A2a receptor activation on bacterial survival during infection, with the results showing increased H. pylori present in tissue sections of gut mucosa. Our findings on the interaction between the A2a receptor and the opportunistic infection represent a first direct visualization of colonizing bacteria inside the host cells using the A2a receptor-specific agonist and a stable analog of adenosine, CGS-21680. Additionally, using A2a selective agonist CGS-21680 to stimulate P. gingivalis-infected GECs induced recovery of more live bacteria determined by antibiotic protection assay. This finding indicates that there are more P. gingivalis within the host cell upon stimulation by the agonist treatment and the bacteria are replicating at significantly high rates. The observed increase numbers of intracellular P. gingivalis was abolished when P. gingivalis-infected GECs were treated with A2a receptor-specific antagonist SCH-58261, implicating A2a receptor as the key contributor to observed elevation in bacterial number. The treatment of the P. gingivalis-infected GECs with adenosine, which is unstable in-vitro, at 10 μM also enhanced the intracellular infection by ~50% (data not shown) Furthermore, the use of self-fluorescing P. gingivalis transformant strain (PgFbFP) enabled us to demonstrate that A2a receptor-specific agonist CGS-21680 significantly increased the number of metabolically active P. gingivalis within the host cells and the depletion of A2a receptor by siRNA substantially reduced the metabolically active / live P. gingivalis. These results suggest that not only does intracellular P. gingivalis respond to activation of A2a receptor, but that the bacteria become more active and proliferate at higher rates.

Previous literature demonstrates that adenosine directly enhances growth of pathogenic strains of Entero-Pathogenic Escherichia coli (Crane et al., 2009). Our own data indicates that directly supplying adenosine to P. gingivalis cultures has a detrimental effect on TSB cultured-P. gingivalis growth (supplemental figure 2a), suggesting P. gingivalis perhaps requires a concerted interaction between host cell machinery in order to utilize adenosine signaling for proliferation. However, elevated cAMP production by adenylyl cyclase after A2a receptor activation could explain the observed increase in bacterial number in P. gingivalis-infected GECs by dampening and/or evading innate immune response. A2a engagement has been shown to play a nonredundant role in downregulating inflammation in-vivo, and adenosine was demonstrated to inhibit IL-8 secretion by intestinal epithelial cells through its ability to prevent NF-κB activation. This is consistent with P. gingivalis’ ability to inhibit IL-8 production and supress IL-1 secretion in GECs (Yilmaz et al., 2010, Takeuchi et al., 2013). On the other hand, elevated intracellular cAMP has been shown to promote growth of Mycobacterium species in macrophages (Bai et al., 2009), thus it is plausible that cAMP could serve as an energy source for the replicating P. gingivalis in the A2a receptor-activated GECs (Figure 5 and 6).

Recent studies from our laboratory indicate that P. gingivalis effector enzyme, nucleoside-diphosphate-kinase (Ndk) is secreted extracellularly from P. gingivalis-infected GECs. This nucleotide converting enzyme homologue catalytically depletes extracellular ATP, thereby resulting in inhibition of P2X7 receptor-mediated cellular ROS production and host cell apoptosis (Yilmaz et al., 2008; Choi et al., 2013). The inside-out effect we observed suggests that P. gingivalis has the capacity to reduce extracellular nucleotide concentrations of ATP, thereby acting as a generator of adenosine. It remains to be determined if P. gingivalis Ndk facilitates adenosine receptor activation, however it is tempting to speculate that there could be a connection between inhibiting pro-inflammatory ATP while simultaneously generating anti-inflammatory adenosine. Interestingly, alteration of adenosine concentrations appears to be an important survival mechanism for some opportunistic pathogens. Staphylococcus aureus and B. anthracis were found to possess an enzyme, “Adenosine synthase”, which aids in evasion of host immune defenses (Thammavongsa et al., 2009). The study found that adenosine synthase homologues have 5′ nucleotidase activity, which synthesizes adenosine from ATP, resulting in enhanced survival in blood and reduced phagocytic clearance of these opportunistic pathogens. The same study also found that other important oral cavity bacteria including Enterococcus faecalis and Streptococcus mutans possess uncharacterized homologues of adenosine synthase. This line of inquiry has not been fully explored to date, however preliminary investigations we have carried out in our laboratory agree that P. gingivalis also possesses a putative Adenosine synthase homologue (PGN 0282, 2′,3′-cyclic-nucleotide 2′-phosphodiesterase, P. gingivalis ATCC 33277) that has yet to be characterized.

In summary, this study identified a novel mechanism, specifically the A2a adenosine receptor, which may be utilized by P. gingivalis to sustain successful persistent infections in the oral epithelium. However, subsequent studies are strongly needed to determine the precise mechanisms of A2a ligation on modulation of P. gingivalis infection in GECs. We also recognize that the presence of P. gingivalis in the subgingival crevice is not a monoinfection, but rather a prominent component of a complex and diverse microbial community. Other microbial species might regulate the pathogenic potential of P. gingivalis via differential modulation of a number of purinoreceptors in the gingival epithelium. Taken together, these results indicate an important role for A2a receptor in promoting intracellular infection by P. gingivalis and the adenosine receptors could represent a potential target for therapeutic intervention in chronic periodontitis.

Supplementary Material

Supp Fig S1-S2

Supplemental Figure 1. GECs were infected with P. gingivalis at moi 100 for 24 h total infection time. Samples were fixed and stained with P. gingivalis primary antibody and subsequently stained with Oregon Green 488 secondary antibody (green) and DAPI (blue) to visualize infection. (A) Infected un-treated GECs. (B) Infected GECs treated 1 h post-infection with broad spectrum adenosine receptor agonist NECA. (C) Infected GECs treated 3 h post-infection with NECA. Images presented here are representative of at least 175 fields studied in experiments that were performed two separate times in duplicate. (D) Analysis of fluorescence levels using ImageJ software revealed minimally elevated levels of P. gingivalis in both treatment conditions compared to control.

Supplemental Figure 2. Direct effect of adenosine on bacterial culture. (A) P. gingivalis cultured as described in Methods were supplied with 0 μM, 10 μM, 50 μM or 100 μM adenosine and growth curves were determined via UV spectrophotometer. 10 μM adenosine was supplied at each time point in final experimental condition to assess effects of continued supply of adenosine on P. gingivalis growth. (B) E. coli strain DH5-α growth curves in Luria Broth cultures were also determined via UV spectrophotometer after culture supplementation with 0 μM, 10 μM, or 100 μM adenosine.

Acknowledgments

We would like to thank to Dr. David M Ojcius (UC Merced) for helpful discussions during preparation of this study. This study was supported by NIDCR (NIH) grant R01DE016593.

References

  1. Alam MS, Kurtz CC, Wilson JM, Burnette BR, Wiznerowicz EB, Ross WG, Rieger JM, Figler RA, Linden J, Crowe SE, Ernst PB. A2A adenosine receptor (AR) activation inhibits pro-inflammatory cytokine production by human CD4+ helper T cells and regulates Helicobacter-induced gastritis and bacterial persistence. Mucosal Immunol. 2009;2:232–242. doi: 10.1038/mi.2009.4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bai G, Schaak DD, McDonough KA. cAMP levels within Mycobacterium tuberculosis and Mycobacterium bovis BCG increase upon infection of macrophages. FEMS Immunol Med Microbiol. 2009;55:68–73. doi: 10.1111/j.1574-695X.2008.00500.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Barletta KE, Cagnina RE, Burdick MD, Linden J, Mehrad B. Adenosine A(2B) receptor deficiency promotes host defenses against gram-negative bacterial pneumonia. Am J Respir Crit Care Med. 2012;186:1044–1050. doi: 10.1164/rccm.201204-0622OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bitto A, Oteri G, Pisano M, Polito F, Irrera N, Minutoli L, Squadrito F, Altavilla D. Adenosine receptor stimulation by polynucleotides (PDRN) reduces inflammation in experimental periodontitis. J Clin Periodontol. 2013;40 (1):26–32. doi: 10.1111/jcpe.12010. [DOI] [PubMed] [Google Scholar]
  5. Bours MJ, Swennen EL, Di Virgilio F, Cronstein BN, Dagnelie PC. Adenosine 5′-triphosphate and adenosine as endogenous signaling molecules in immunity and inflammation. Pharmacol Ther. 2006;112:358–404. doi: 10.1016/j.pharmthera.2005.04.013. [DOI] [PubMed] [Google Scholar]
  6. Choi CH, Spooner R, DeGuzman J, Koutouzis T, Ojcius DM, Yilmaz Ö. Porphyromonas gingivalis-nucleoside-diphosphate-kinase inhibits ATP-induced reactive-oxygen-species via P2X7 receptor/NADPH-oxidase signalling and contributes to persistence. Cell Microbiol. 2013;15:961–976. doi: 10.1111/cmi.12089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Choi CH, DeGuzman JV, Lamont RJ, Yilmaz Ö. Genetic transformation of an obligate anaerobe, P. gingivalis for FMN-green fluorescent protein expression in studying host-microbe interaction. PLoS One. 2011;15:6(4):e18499. doi: 10.1371/journal.pone.0018499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Coutinho-Silva R, Ojcius DM. Role of extracellular nucleotides in the immune response against intracellular bacteria and protozoan parasites. Microbes Infect. 2012;14:1271–1277. doi: 10.1016/j.micinf.2012.05.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Crane JK, Shulgina I. Feedback effects of host-derived adenosine on enteropathogenic Escherichia coli. FEMS Immunol Med Microbiol. 2009;57:214–228. doi: 10.1111/j.1574-695X.2009.00598.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Himer L, Csóka B, Selmeczy Z, Koscsó B, Pócza T, Pacher P, Németh ZH, Deitch EA, Vizi ES, Cronstein BN, Haskó G. Adenosine A2A receptor activation protects CD4+ T lymphocytes against activation-induced cell death. FASEB. 2010;24:2631–2640. doi: 10.1096/fj.10-155192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Impellizzeri D, Di Paola R, Esposito E, Mazzon E, Paterniti I, Melani A, Bramanti P, Pedata F, Cuzzocrea S. CGS 21680, an agonist of the adenosine (A2A) receptor, decreases acute lung inflammation. Eur J Pharmacol. 2011;668:305–316. doi: 10.1016/j.ejphar.2011.06.049. [DOI] [PubMed] [Google Scholar]
  12. Ishii KJ, Akira S. Potential link between the immune system and metabolism of nucleic acids. Curr Opin Immunol. 2008;20:524–529. doi: 10.1016/j.coi.2008.07.002. [DOI] [PubMed] [Google Scholar]
  13. Jacobson KA, Gao ZG. Adenosine receptors as therapeutic targets. Nat Rev Drug Discov. 2006;5:247–264. doi: 10.1038/nrd1983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Karmouty-Quintana H, Xia Y, Blackburn MR. Adenosine signaling during acute and chronic disease states. J Mol Med (Berl) 2013;91:173–181. doi: 10.1007/s00109-013-0997-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Li Y, Figler RA, Kolling G, Bracken TC, Rieger J, Stevenson RW, Linden J, Guerrant RL, Warren CA. Adenosine A2A receptor activation reduces recurrence and mortality from Clostridium difficile infection in mice following vancomycin treatment. BMC Infect Dis. 2012;10:342. doi: 10.1186/1471-2334-12-342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Macdonald LJ, Graham JG, Kurten RC, Voth DE. Coxiella burnetii exploits host cAMP-dependent protein kinase signalling to promote macrophage survival. Cell Microbiol. 2013 doi: 10.1111/cmi.12213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Miller CM, Boulter NR, Fuller SJ, Zakrzewski AM, Lees MP, Saunders BM, Wiley JS, Smith NC. The role of the P2X7 receptor in infectious diseases. PLoS Pathogens. 2011:7. [Google Scholar]
  18. Murakami S, Hashikawa T, Saho T, Takedachi M, Nozaki T, Shimabukuro Y, Okada H. Adenosine regulates the IL-1 beta-induced cellular functions of human gingival fibroblasts. Int Immunol. 2001;13:1533–1540. doi: 10.1093/intimm/13.12.1533. [DOI] [PubMed] [Google Scholar]
  19. Murakami S, Yoshimura N, Koide H, Watanabe J, Takedachi M, Terakura M, Yanagita M, Hashikawa T, Saho T, Shimabukuro Y, Okada H. Activation of adenosine-receptor-enhanced iNOS mRNA expression by gingival epithelial cells. J Dent Res. 2002;81:236–240. doi: 10.1177/154405910208100403. [DOI] [PubMed] [Google Scholar]
  20. Németh ZH, Csóka B, Wilmanski J, Xu D, Lu Q, Ledent C, Deitch EA, Pacher P, Spolarics Z, Haskó G. Adenosine A2A receptor inactivation increases survival in polymicrobial sepsis. J Immunol. 2006;176:5616–5626. doi: 10.4049/jimmunol.176.9.5616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Ohta A, Gorelik E, Prasad SJ, Ronchese F, Lukashev D, Wong MK, Huang X, Caldwell S, Liu K, Smith P, Chen JF, Jackson EK, Apasov S, Abrams S, Sitkovsky M. A2A adenosine receptor protects tumors from antitumor T cells. Proc Natl Acad Sci U S A. 2006;29:13132–13137. doi: 10.1073/pnas.0605251103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Pettengill MA, Lam VW, Ojcius DM. The danger signal adenosine induces persistence of chlamydial infection through stimulation of A2b receptors. PLoS One. 2009:14. doi: 10.1371/journal.pone.0008299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Popov SG, Popova TG, Kashanchi F, Bailey C. Targeting the inflammasome and adenosine type-3 receptors improves outcome of antibiotic therapy in murine anthrax. World J Biol Chem. 2011;26:98–104. doi: 10.4331/wjbc.v2.i5.98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Sitkovsky MV, Ohta A. The ‘danger’ sensors that STOP the immune response: the A2 adenosine receptors? Trends Immunol. 2005;26:299–304. doi: 10.1016/j.it.2005.04.004. [DOI] [PubMed] [Google Scholar]
  25. Souza LF, Jardim FR, Sauter IP, Souza MM, Barreto F, Margis R, Bernard EA. Lipoteichoic acid from Staphylococcus aureus increases matrix metalloproteinase 9 expression in RAW 264.7 macrophages: modulation by A2A and A2B adenosine receptors. Mol Immunol. 2009;46:937–942. doi: 10.1016/j.molimm.2008.09.012. [DOI] [PubMed] [Google Scholar]
  26. Streitová D, Hofer M, Holá J, Vacek A, Pospísil M. Adenosine A(1), A(2a), A(2b), and A(3) receptors in hematopoiesis. 2. Expression of receptor mRNA in resting and lipopolysaccharide-activated mouse RAW 264.7 macrophages. Physiol Res. 2009;59:139–144. doi: 10.33549/physiolres.931724. [DOI] [PubMed] [Google Scholar]
  27. Sullivan GW, Fang G, Linden J, Scheld WM. A2A adenosine receptor activation improves survival in mouse models of endotoxemia and sepsis. J Infect Dis. 2004;15:1897–1904. doi: 10.1086/386311. [DOI] [PubMed] [Google Scholar]
  28. Sun CX, Wall NR, Angelov N, Ririe C, Chen JW, Boskovic DS, Henkin JM. Changes in mRNA expression of adenosine receptors in human chronic periodontitis. Chin J Dental Res. 2011;14:113–120. [PubMed] [Google Scholar]
  29. Sun WC, Berghaus LJ, Moore JN, Hurley DJ, Vandenplas ML, Thompson R, Linden J. Lipopolysaccharide and TNF-alpha modify adenosine A(2A) receptor expression and function in equine monocytes. Vet Immunol Immunopathol. 2010;135:289–95. doi: 10.1016/j.vetimm.2009.12.001. [DOI] [PubMed] [Google Scholar]
  30. Takeuchi H, Hirano T, Whitmore SE, Morisaki I, Amano A, Lamont RJ. The serine phosphatase SerB of Porphyromonas gingivalis suppresses IL-8 production by dephosphorylation of NF-κB RelA/p65. PLoS Pathog. 2013:9. doi: 10.1371/journal.ppat.1003326. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Thammavongsa V, Kern JW, Missiakas DM, Schneewind O. Staphylococcus aureus synthesizes adenosine to escape host immune responses. J Exp Med. 2009;206:2417–2127. doi: 10.1084/jem.20090097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Yao L, Jermanus C, Barbetta B, Choi C, Verbeke P, Ojcius DM, Yilmaz O. Porphyromonas gingivalis infection sequesters pro-apoptotic Bad through Akt in primary gingival epithelial cells. Mol Oral Microbiol. 2010;25:89–101. doi: 10.1111/j.2041-1014.2010.00569.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Yegutkin GG. Nucleotide- and nucleoside-converting ectoenzymes: Important modulators of purinergic signalling cascade. Biochim Biophys Acta. 2008;1783:673–694. doi: 10.1016/j.bbamcr.2008.01.024. [DOI] [PubMed] [Google Scholar]
  34. Yilmaz Ô, Yao L, Maeda K, Rose TM, Lewis EL, Duman M, Lamont RJ, Ojcius DM. ATP scavenging by the intracellular pathogen Porphyromonas gingivalis inhibits P2X7-mediated host-cell apoptosis. Cell Microbiol. 2008;10:863–875. doi: 10.1111/j.1462-5822.2007.01089.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Yilmaz Ö. The chronicles of Porphyromonas gingivalis: the microbium, the human oral epithelium and their interplay. Microbiology. 2008;154:2897–2903. doi: 10.1099/mic.0.2008/021220-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Yilmaz O, Sater AA, Yao L, Koutouzis T, Pettengill M, Ojcius DM. ATP-dependent activation of an inflammasome in primary gingival epithelial cells infected by Porphyromonas gingivalis. Cell Microbiol. 2010;12:188–198. doi: 10.1111/j.1462-5822.2009.01390.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Yilmaz O, Verbeke P, Lamont RJ, Ojcius DM. Intercellular spreading of Porphyromonas gingivalis infection in primary gingival epithelial cells. Infect Immun. 2006;74:703–710. doi: 10.1128/IAI.74.1.703-710.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Yilmaz O, Watanabe K, Lamont RJ. Involvement of integrins in fimbriae-mediated binding and invasion by Porphyromonas gingivalis. Cell Microbiol. 2002;4:305–314. doi: 10.1046/j.1462-5822.2002.00192.x. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp Fig S1-S2

Supplemental Figure 1. GECs were infected with P. gingivalis at moi 100 for 24 h total infection time. Samples were fixed and stained with P. gingivalis primary antibody and subsequently stained with Oregon Green 488 secondary antibody (green) and DAPI (blue) to visualize infection. (A) Infected un-treated GECs. (B) Infected GECs treated 1 h post-infection with broad spectrum adenosine receptor agonist NECA. (C) Infected GECs treated 3 h post-infection with NECA. Images presented here are representative of at least 175 fields studied in experiments that were performed two separate times in duplicate. (D) Analysis of fluorescence levels using ImageJ software revealed minimally elevated levels of P. gingivalis in both treatment conditions compared to control.

Supplemental Figure 2. Direct effect of adenosine on bacterial culture. (A) P. gingivalis cultured as described in Methods were supplied with 0 μM, 10 μM, 50 μM or 100 μM adenosine and growth curves were determined via UV spectrophotometer. 10 μM adenosine was supplied at each time point in final experimental condition to assess effects of continued supply of adenosine on P. gingivalis growth. (B) E. coli strain DH5-α growth curves in Luria Broth cultures were also determined via UV spectrophotometer after culture supplementation with 0 μM, 10 μM, or 100 μM adenosine.

NIHMS551445-supplement-Supp_Fig_S1-S2.pdf (100.1KB, pdf)

RESOURCES