In sub-table S1A of Table S1, the nucleotide sequence of Tcf7l2 (Tcf4) should read: “F: CACAGCTCAAAGCATCAGGA R: CTGCATGTGAAGCTGTCGTT.” The length of the amplicon should be indicated as: “242bp.”
Reference
- 1. Sirakov M, Skah S, Lone IN, Nadjar J, Angelov D, et al. (2012) Multi-Level Interactions between the Nuclear Receptor TRα1 and the WNT Effectors β-Catenin/Tcf4 in the Intestinal Epithelium. PLoS ONE 7(4): e34162 doi:10.1371/journal.pone.0034162 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]