CvfA Protein and Polynucleotide Phosphorylase Act in an Opposing Manner to Regulate Staphylococcus aureus Virulence

Background: Production of 3′-phosphorylated RNA by CvfA affects S. aureus virulence gene expression.

Results: Disrupting pnpA-encoding exonuclease suppressed the cvfA-deleted mutant phenotype. Purified PNPase did not degrade 3′-phosphorylated RNA.

Conclusion: CvfA-produced 3′-phosphorylated RNA inhibits PNPase-induced RNA degradation, resulting in hemolysin production by S. aureus.

Significance: Altering the nucleotide structure at the RNA 3′ terminus regulates S. aureus virulence.

Abstract

We previously identified CvfA (SA1129) as a Staphylococcus aureus virulence factor using a silkworm infection model. S. aureus cvfA-deleted mutants exhibit decreased expression of the agr locus encoding a positive regulator of hemolysin genes and decreased hemolysin production. CvfA protein hydrolyzes a 2′,3′-cyclic phosphodiester bond at the RNA 3′ terminus, producing RNA with a 3′-phosphate (3′-phosphorylated RNA, RNA with a 3′-phosphate). Here, we report that the cvfA-deleted mutant phenotype (decreased agr expression and hemolysin production) was suppressed by disrupting pnpA-encoding polynucleotide phosphorylase (PNPase) with 3′- to 5′-exonuclease activity. The suppression was blocked by introducing a pnpA-encoding PNPase with exonuclease activity but not by a pnpA-encoding mutant PNPase without exonuclease activity. Therefore, loss of PNPase exonuclease activity suppressed the cvfA-deleted mutant phenotype. Purified PNPase efficiently degraded RNA with 2′,3′-cyclic phosphate at the 3′ terminus (2′,3′-cyclic RNA), but it inefficiently degraded 3′-phosphorylated RNA. These findings indicate that 3′-phosphorylated RNA production from 2′,3′-cyclic RNA by CvfA prevents RNA degradation by PNPase and contributes to the expression of agr and hemolysin genes. We speculate that in the cvfA-deleted mutant, 2′,3′-cyclic RNA is not converted to the 3′-phosphorylated form and is efficiently degraded by PNPase, resulting in the loss of RNA essential for expressing agr and hemolysin genes, whereas in the cvfA/pnpA double-disrupted mutant, 2′,3′-cyclic RNA is not degraded by PNPase, leading to hemolysin production. These findings suggest that CvfA and PNPase competitively regulate RNA degradation essential for S. aureus virulence.

Introduction

Regulation of RNA stability is important for cells to rapidly adapt to extracellular environmental changes. In bacteria, nuclease complexes called degradosomes degrade mRNA (1). Bacillus subtilis degradosomes contain RNase Y with endonuclease activity (2), PNPase² with 3′- to 5′-exonuclease activity (3), and other nucleases. The rny (ymdA) gene encoding RNase Y is essential for cell growth in B. subtilis (4). The gapA operon mRNA encoding a glycolytic enzyme, S-adenosylmethionine-dependent riboswitch RNA, and rpsO mRNA encoding ribosomal protein S15 are substrates of RNase Y (2, 5, 6). These substrates are thought to be endonucleolytically cleaved by RNase Y and subsequently degraded by other nucleases. PNPase is conserved among bacteria, plant, and metazoa (7). Deletion mutants of pnpA-encoding PNPase in B. subtilis and Escherichia coli can grow at 37 °C, but they have a cold-sensitive phenotype (8–12). Deletion mutants of pnpA in Salmonella enterica and Yersinia spp. show increased expression of virulence genes (13–15), indicating that the pnpA gene product negatively regulates bacterial virulence. The molecular mechanism underlying the effect of pnpA on the expression of specific genes is not known.

We previously identified novel virulence genes of S. aureus using a silkworm infection model (16, 17). cvfA is a virulence gene, and its gene product is a component of S. aureus degradosomes (18, 19). CvfA is a homolog of B. subtilis RNase Y. Unlike the B. subtilis rny deletion mutant, the S. aureus cvfA-deleted mutant is viable and grows normally in nutrient medium (17). The cvfA-deleted mutant of S. aureus exhibits decreased expression of the agr locus encoding virulence regulators and decreased hemolysin production (17). Furthermore, the cvfA-deleted mutant of S. aureus and Streptococcus pyogenes has attenuated virulence in mice and silkworms (17). In S. pyogenes, deletion of cvfA affects the expression of 30% of all genes, including virulence genes and metabolic genes (20, 21). We previously demonstrated that CvfA cleaves the 2′,3′-cyclic phosphodiester linkage of the 3′ terminus of RNA and produces 3′-monophosphorylated RNA (22). It remained unclear, however, how modification of the 3′-terminal structure of RNA by CvfA affects the expression of S. aureus virulence genes.

In this study, we searched for a gene that genetically interacts with cvfA to reveal the molecular mechanism of virulence gene regulation by CvfA. Our findings revealed that disruption of pnpA-encoding PNPase with exonuclease activity suppressed the phenotype of the cvfA-deleted mutant. Furthermore, RNA degradation activity of PNPase was affected by the structure of the 3′-terminal nucleotide of the RNA substrate.

EXPERIMENTAL PROCEDURES

Bacterial Strains and Culture Conditions

The E. coli JM109 strain was used to host pET-11a, pND50, and their derivatives. E. coli strains transformed with the plasmids were aerobically cultured in the presence of 100 μg/ml ampicillin or 25 μg/ml chloramphenicol. S. aureus strains were aerobically cultured in tryptic soy broth at 37 °C. To transform the S. aureus strain with plasmids, 10 μg/ml erythromycin, 20 μg/ml phleomycin, or 12.5 μg/ml chloramphenicol was added to tryptic soy broth. Details of the bacterial strains and plasmids are listed in Table 1.

TABLE 1.

List of bacterial strains and plasmids used

Strain or plasmid	Genotypes or characteristics	Source or Ref.
Strains
E. coli
JM109	Host strain for cloning plasmid DNA	Takara Bio
BL21(DE3)	Host strain for expression of recombinant protein	Takara Bio
S. aureus
RN4220	NCTC8325-4, restriction mutant	50
NCTC8325-4	NCTC8325 cured of ϕ11, ϕ12, and ϕ13	50
CKP1129	NCTC8325-4 cvfA::Phleor	22
DM1NC	NCTC8325-4 cvfA::Phleor, pnpA::Ermr	This study
M1117NC	NCTC8325-4 pnpA::Ermr	This study
CR1 to CR8	MRSA clinical isolates	51
FRP3757	Community-acquired MRSA, USA300	52
MW2	Community-acquired MRSA, USA400	53
Plasmids
pMutinT3	S. aureus integration deletion vector; Ermr	54, 55
pND50	E. coli–S. aureus shuttled vector; Cmr	56
ppnpA	pND50 with pnpA from NCTC8325-4	This study
pD96G	pND50 with mutated pnpA (D96G)	This study
pR402A/R403A	pND50 with mutated pnpA (R402A/R403A)	This study
pH407D	pND50 with mutated pnpA (H407D)	This study
pR413D	pND50 with mutated pnpA (R413D)	This study
pD496G	pND50 with mutated pnpA (D496G)	This study
pΔRBD	pND50 with mutated pnpA (ΔRBD)	This study
pCK5001	pluc with P2 promoter from RN4220	57
pCK5002	pluc with P3 promoter from RN4220	57
pCK5003	pluc with hla promoter from RN4220	57
pET-11a	T7 promoter-based expression vector, Ampr	Novagen
pN-His-pnpA	pET-11a with N-terminal His-tagged pnpA from NCTC8325-4	This study
pN-His-D96G	pET-11a with N-terminal His-tagged mutated pnpA (D96G)	This study
pN-His-R402A/R403A	pET-11a with N-terminal His-tagged mutated pnpA (R402A/R403A)	This study
pN-His-H407D	pET-11a with N-terminal His-tagged mutated pnpA (H407D)	This study
pN-His-R413D	pET-11a with N-terminal His-tagged mutated pnpA (R413D)	This study
pN-His-D496G	pET-11a with N-terminal His-tagged mutated pnpA (D496G)	This study
pN-His-ΔRBD	pET-11a with N-terminal His-tagged mutated pnpA (ΔRBD)	This study

DNA Manipulation

Transformation of E. coli, extraction of plasmid DNA, and polymerase chain reaction (PCR) were performed according to Sambrook et al. (23). S. aureus was transformed using electroporation (24). Introduction of point mutations into plasmid DNA was performed according to Li et al. (25).

Construction of the pnpA-disrupted Mutant and Plasmids Carrying Mutated pnpA Genes

DNA fragments containing the internal region (+84 to +584 bp) of pnpA (+1 as the first nucleotide of the open reading frame) was amplified by PCR using oligonucleotide primers (Table 2) and genome DNA of NCTC8325-4 strain as the template. The amplified fragment was inserted into EcoRI and BamHI sites of pMutinT3, resulting in a targeting plasmid. S. aureus RN4220 strain was electroporated with the targeting plasmid, resulting in a strain resistant to erythromycin. The plasmid that was integrated into the pnpA gene was transferred to the NCTC8325-4 strain using phage 80α, which resulted in the pnpA-disrupted mutant. Disruption of pnpA in NCTC8325-4 strain was confirmed by Southern blot analysis.

TABLE 2.

Primers used in this study

F indicates forward; R indicates reverse; qRT-PCR indicates quantitative RT-PCR.

Target	Primer	Sequence (5′–3′)
pnpA disruption	F-EcoRI-1117	GCGAATTCAAATGGCGCTGTATTGGTTC
	R-EcoRI-1117	ATGGATCCCACTAGCGCCTGCCTCTAC
pnpA complementation	F-BamHI pnpA-c	CGGGATCCTCAACGCAGTAAACGAACACTT
	R-EcoRI pnpA-c	GGAATTCAGGATAATTAACAGTTGCACTCA
Mutated pnpA	F-D96G	ACTGCGCGATTAATTGGTAGACCAATTAGACCTTT
	R-D96G	AAAGGTCTAATTGGTCTACCAATTAATCGCGCAGT
	F-R402A/R403A	ACGTGCGCCAGGTGCAGCAGAAATTGGACATGGTG
	R-R402A/R403A	CACCATGTCCAATTTCTGCTGCACCTGGCGCACGT
	F-H407D	GGTCGTCGTGAAATTGGAGATGGTGCGTTAGGTGA
	R-H407D	TCACCTAACGCACCATCTCCAATTTCACGACGACC
	F-R413D	TGGTGCGTTAGGTGAAGATGCATTAAAATATATTA
	R-R413D	TAATATATTTTAATGCATCTTCACCTAACGCACCA
	F-D496G	GATGCATTAGGTGATATGGGTTTTAAAGTCGCTGG
	R-D496G	CCAGCGACTTTAAAACCCATATCACCTAATGCATC
	F-del-RBD	GCATCACACAGAGCATTAGAAGAATAA
	R-del-RBD	TTCACGTGTAATTTCCTCAATGATTTC
PnpA overproduction	F-N-His-pnpA-op	GCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGCACCACCACCACCACCACTCTCAAGAAAAGAAAGTTTT
	R-N-His-pnpA-op	CGGGATCCTTATTCTTCTAATGCTCTGT
saeP (qRT-PCR)	Frt-saeP	CAAATTGAAGAAATGAGGAGTTA
	Rrt-saeP	ACCTTTTGATGATTTGTAGTTAG
saeQ (qRT-PCR)	Frt-saeQ	GAAAAATTAACGGGCGGATT
	Rrt-saeQ	ATTGCAATCTCTCCGAGTGG
adhE (qRT-PCR)	Frt-adhE	CAAAGAACGGAACAGCCTCAA
	Rrt-adhE	ACCACCACCAAGTGCAATGAT

The DNA fragment containing intact pnpA gene was amplified by PCR using oligonucleotide primers (Table 2) and genome DNA of NCTC8325-4 strain as the template. The amplified DNA fragment was inserted into EcoRI and BamHI sites of pND50, resulting in ppnpA carrying intact pnpA. DNA fragments containing the mutated pnpA gene were amplified by PCR using oligonucleotide primers and ppnpA as the template. The amplified DNA fragments were treated with DpnI to degrade the template ppnpA, and the amplified DNA was self-ligated, resulting in plasmid carrying a mutated pnpA gene (D96G, R402A/R403A, H407D, R413D, D496G, or ΔRBD). The desired pnpA mutation was confirmed by sequencing. The RN4220 strain was transformed with ppnpA and plasmids carrying mutated pnpA genes. The plasmids were transferred to the cvfA/pnpA double-disrupted mutant by phage 80α.

Measurement of Hemolysin Production

S. aureus overnight culture (2 μl) was spotted onto tryptic soy agar plates containing 5% sheep erythrocytes and incubated for 12 h at 37 °C. The clear zone around the S. aureus colony was evaluated.

Reporter Assay

S. aureus strains were transformed with reporter plasmids carrying the agr P2, agr P3, and hla promoter. Overnight cultures of the transformed strains were inoculated to 100-fold amounts of fresh tryptic soy broth and aerobically cultured at 37 °C. The cultured cells were collected by centrifugation and lysed in a buffer (20 mm KH₂PO₄ (pH 7.8), 0.04% Triton X-100, 0.1 mm DTT, 10 μg/ml lysostaphin, 1 tablet of protease inhibitor (Roche Applied Science)). Cell lysate supernatant was incubated with luciferase substrate, and luminescence was measured using a luminometer (Berthold Technologies, Bad Wildbad, Germany). The promoter activity was calculated as luminescence units/mg of protein.

Microarray Analysis

Overnight cultures of S. aureus strains were inoculated to 100-fold amounts of fresh tryptic soy broth and aerobically cultured to A₆₀₀ = 4 at 37 °C. The cultured cells were collected by centrifugation and treated with RNAprotect Bacteria Reagent (Qiagen). The cells were washed with phosphate-buffered saline and lysed by lysostaphin. Total RNA was extracted using an RNeasy mini kit according to the manufacturer's protocol (Qiagen), and any remaining DNA was degraded with RQ1 RNase-free DNase (Promega). cDNA was synthesized from the RNA using Superscript II reverse transcriptase. cDNA treated with NaOH was purified using a QIAquick PCR purification kit (Qiagen) and digested by DNase I. Fragmented cDNA was biotinylated using a biotin-ddUTP kit (Affymetrix), and hybridized on Staphylococcus aureus GeneChips (Affymetrix). The GeneChips were washed, and the 570-nm signal was read. Signal intensities were analyzed with GeneChips operating software and normalized with GeneSpring 4.0. Genes with a signal intensity that had a greater than 2-fold difference from the parent strain based on two independent experiments were identified as affected genes.

Quantitative Real Time PCR Analysis

Total RNA was collected from S. aureus cells as described above. cDNA was synthesized from the RNA using Multiscribe Reverse Transcriptase (Applied Biosystems). Quantitative real time PCR was performed using cDNA as a template, SYBR Premix ExTaq (Takara Bio), and primers (Table 2). The signals were detected using an ABI PRISM 7700 sequence detector (Applied Biosystems).

Purification of PNPase

S. aureus pnpA gene fused with His₆ tag was inserted into pET11a, resulting in pN-His-pnpA. E. coli BL21(DE3) harboring pLysS was transformed with pN-His-pnpA. The transformed strain was aerobically cultured in 100 ml of Luria-Bertani broth at 37 °C to A₆₀₀ = 0.5; 1 mm isopropyl β-d-1-thiogalactopyranoside was added, and the mixture was cultured overnight at 16 °C. The cells were collected by centrifugation and lysed by freezing and thawing, followed by sonication. The sample was centrifuged, and ammonium sulfate was added to the supernatant at a final concentration of 100%. The resulting precipitate was dissolved in buffer A (50 mm Tris-HCl (pH 8.0), 500 mm NaCl, 20% glycerol, 1 mm imidazole) and subjected to a Ni-NTA column (ProBond Resin, Invitrogen). The column was washed several times with buffer B (50 mm Tris-HCl (pH 8.0), 500 mm NaCl, 20% glycerol, 67 mm imidazole), and the proteins were eluted with buffer C (50 mm Tris-HCl (pH 8.0), 500 mm NaCl, 20% glycerol, 1 m imidazole). The amount of protein in each fraction was determined by the Bradford assay. To obtain an antibody against PNPase, purified PNPase (0.2 mg) was subcutaneously injected into a Japanese white rabbit five times at 2-week intervals. Blood was collected from the rabbit and used for IgG purification by protein G-Sepharose.

Measurement of Poly(A) Polymerization Activity and Phosphorolytic Activity

To determine poly(A) polymerization activity, PNPase protein was mixed with 5 mm ADP containing 0.3 μm [2,8-³H]ADP in a reaction buffer (50 mm Tris-HCl (pH 8.0), 5 mm MgCl₂, 5 mm ADP) and incubated at 37 °C for 15 min. The reaction was terminated by adding 0.1% perchloric acid, mixed with the same volume of 10% TCA, and incubated on ice for 10 min. The precipitated poly(A) was trapped by a glass filter (Whatman), and the radioactivity on the filter was measured by a scintillation counter (LC 5000TS, Beckman).

To determine the phosphorolytic activity, PNPase protein was mixed with 30 μm poly(A) (Sigma) in a reaction buffer (50 mm Tris-HCl (pH 8.4), 5 mm MgCl₂, 60 mm KCl, 10 mm sodium phosphate) at 37 °C for 10 min. The reaction mixture was mixed with a 2.5 volume of ethanol and centrifuged. The A₂₆₀ of the supernatant was measured to calculate the amount of released ribonucleoside diphosphates.

Phosphorolytic Activity of PNPase against Different RNA Substrates

RNA substrates (5′-AAAAAAAAAAG-3′) with different 3′-terminal nucleotides were synthesized using the phosphoramidite method. The 3′-hydroxylated RNA and 3′-phosphorylated RNA were obtained from Hokkaido System Science, Sapporo, Japan. The 2′,3′-cyclic RNA was obtained from GeneDesign, Osaka, Japan. Structures of RNA substrates were confirmed by electrospray ionization time-of-flight mass spectrometry (microTOF, Bruker Daltonics). PNPase protein was mixed with 30 μm RNA substrate in a reaction buffer (50 mm Tris-HCl (pH 8.4), 5 mm MgCl₂, 60 mm KCl, 10 mm sodium phosphate) at 37 °C for 10 min. The reaction was terminated by the addition of 2× loading buffer (95% formamide, 0.025% SDS, 18 mm EDTA, 0.025% xylencyanol, 0.025% bromphenol blue) and boiling. The RNA sample was electrophoresed in a 7 m urea, 20% polyacrylamide gel and stained with SYBR Green. Images were analyzed using an image analyzer (Typhoon FLA9000, GE Healthcare). To measure the amount of the RNA degradation product, PNPase protein was mixed with different amounts of RNA substrate in the reaction buffer at 37 °C for 10 min. The reaction mixture was then mixed with 2.5 volumes of ethanol and centrifuged. The A₂₆₀ of the supernatant was measured to calculate the amount of released ribonucleoside diphosphates. The K_m and V_max values of PNPase protein against different RNA substrates were determined by nonlinear regression analysis using Graph Pad Prism version 5.0c.

Detection of PNPase and CvfA

S. aureus cells were collected, and the cell walls were lysed in digestion buffer (30% raffinose, 50 mm Tris-HCl (pH 7.5), 145 mm NaCl, 100 μg/ml lysostaphin, 10 units/ml DNase I) at 37 °C for 30 min. The cells were collected by centrifugation and lysed in lysis buffer (50 mm Tris-HCl (pH 8.0), 100 units/ml DNase I). The protein concentration was determined by the Bradford assay. The protein was electrophoresed in 15% SDS-polyacrylamide gels. The proteins were blotted to a PVDF membrane (Immobilon-P, Merck). The membrane was treated with blocking buffer (TBST: 20 mm Tris-HCl (pH 7.6), 150 mm NaCl, 0.1% Tween 20, 5% Easy Blocker (GeneTex, Irvine, CA)) at room temperature for 1 h. The membrane was treated with blocking buffer containing 1:1000 anti-PnpA IgG or anti-CvfA IgY (22) at room temperature for 1 h. After washing with TBST, the membrane was treated with a blocking buffer containing 1:2000 anti-rabbit IgG conjugated with alkaline phosphatase or anti-chicken IgY conjugated with HRP at room temperature for 1 h. After washing with TBST, the membrane for detecting PNPase was reacted with a substrate for alkaline phosphatase (nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate, Roche Applied Science). The membrane for detecting CvfA was reacted with an HRP substrate (Western Lightning Plus ECL, PerkinElmer Life Sciences) and subsequently exposed to film (Hyperfilm ECL, GE Healthcare).

Silkworm Infection Experiment

The infection experiment using silkworms was performed according to the previously described method (26). Fertilized eggs were purchased from Ehime Sansyu (Ehime, Japan). Hatched larvae were raised to fifth instar larvae by feeding an artificial diet. S. aureus overnight cultures were centrifuged, and the cells were suspended in saline. 2-Fold serial diluted bacterial solutions were injected into the hemolymph of silkworms (n = 10). Surviving silkworms were counted at 29 h after the injection. LD₅₀ values were determined from dose-survival curves.

Mouse Infection Experiment

Four-week-old female ICR mice were purchased from CLEA Japan, Inc. (Tokyo, Japan). S. aureus overnight cultures were centrifuged, and the cells were suspended in PBS containing 5% hog gastric mucin. 2-Fold serial dilutions of the bacterial solutions were injected into the peritoneal cavity in mice (n = 5). Surviving mice were counted at 24 h after the injection. LD₅₀ values were determined from the dose-survival curves.

RESULTS

Decreased Hemolysin Production and Agr Expression in the cvfA Deletion Mutant Is Suppressed by the Disruption of pnpA

To investigate the molecular mechanisms underlying the regulation of hemolysin production by CvfA, we searched for gene mutations that suppress the decreased hemolysin production of the cvfA-deleted mutant. Because CvfA has phosphodiesterase activity against 2′,3′-cyclic phosphodiester linkage at the 3′-terminal nucleotide of RNA, we hypothesized that modification of the RNA by CvfA would affect the sensitivity of the RNA against other RNA metabolic enzymes. To examine this possibility, we constructed double-disrupted mutants of cvfA and eight other genes encoding RNases, including RNase III (SA1076), SA0489, RNase HII (SA1087), SA1335, SA0450, PNPase (SA1117), RNase R (SA0735), and YhaM (SA1660), and examined their hemolysin production. Disruption of SA1076, SA1335, or SA1660 in the cvfA-deleted mutant caused slow growth or was not stable and thus not further evaluated. Disruption of SA0449 or SA0735 in the cvfA-deleted mutant was not successful. Disruption of SA0450 or SA1087 in the cvfA-deleted mutant had no effect on hemolysin production. cvfA-deleted mutants with disruption of pnpA-encoding PNPase produced greater amounts of hemolysins than cvfA-deleted mutants without disruption, which normally produce only small amounts of hemolysins (Fig. 1A). Thus, disruption of pnpA suppressed the decreased hemolysin production of cvfA-deleted mutants. The doubling speed of the cvfA/pnpA double-disrupted mutant was indistinguishable from that of the parent strain and the cvfA-deleted mutant (Fig. 1B). In addition, the promoter activity of the hla gene encoding α-hemolysin in the cvfA/pnpA double-disrupted mutant was higher than that in the cvfA-deletion mutant (Fig. 1C). In the cvfA/pnpA double-disrupted mutant, promoter activities of P2 and P3 of the agr locus, which positively regulate hla transcription, were higher than those in the cvfA-deleted mutant (Fig. 1, D and E). Therefore, we concluded that the decreased hemolysin production and agr expression in the cvfA-deleted mutant were suppressed by the disruption of pnpA and that cvfA genetically interacts with pnpA.

FIGURE 1.

Disruption of pnpA suppresses the cvfA-deleted mutant phenotype. A, overnight cultures of the S. aureus parent strain (NCTC8325-4), the pnpA-disrupted mutant (M1117NC), the cvfA-deleted mutant (CKP1129), and the cvfA/pnpA double-disrupted mutant (DM1NC) were spotted onto nutrient agar plates containing 5% sheep erythrocytes and incubated overnight at 37 °C. The clear zone around the colony reflects hemolysin activity. B, overnight S. aureus cultures were inoculated into 100-fold amounts of fresh tryptic soy broth and cultured at 37 °C. C, S. aureus parent strain, the pnpA-disrupted mutant, the cvfA-deleted mutant, and the cvfA/pnpA double-disrupted mutant were transformed with a reporter plasmid of the hla promoter and cultured to the late exponential phase (A₆₀₀ = 2.5). Luciferase activities of cell lysates were measured. Means ± S.D. from three independent experiments are presented. Asterisks indicate a Student's t test p value of less than 0.05. D and E, S. aureus strains were transformed with reporter plasmids of agr P2 (D) and agr P3 (E) and cultured to late exponential phase (A₆₀₀ = 1.0). Luciferase activities of cell lysates were measured. Means ± S.D. from three independent experiments are presented. Asterisks indicate a Student's t test p value of less than 0.05. F–H, S. aureus strains were cultured to late exponential phase (A₆₀₀ = 2.5). The total RNA was extracted from the cells, and quantitative RT-PCR was performed using saeP, saeQRS, and adhE gene-specific primers. Vertical axis represents the relative amount of mRNA against that in the parent strain. Means ± S.D. from three independent experiments are presented. Asterisks indicate a Student's t test p value of less than 0.05. I, overnight cultures of the S. aureus parent strain (NCTC8325-4), the pnpA-disrupted mutant (M1117NC), and the pnpA-disrupted mutant (M1117NC) transformed with an empty vector (pND50) or plasmid carrying intact pnpA (ppnpA) were spotted onto nutrient agar plates containing 5% sheep erythrocytes and incubated overnight at 37 °C. RLU, relative light units.

The deletion of cvfA affects the expression of various genes in S. aureus (27) and S. pyogenes (20). We examined whether the disruption of pnpA restores the effects of cvfA deletion on gene expression other than agr and hla genes. First, we performed microarray analysis of the cvfA-deleted mutant. The cvfA deletion affected the expression of 20% of S. aureus genes (supplemental Tables S1 and S2), consistent with previous reports (20, 27). Among the genes with altered expression, we focused on the decreased expression of saeP, which is encoded by the sae locus that positively regulates S. aureus hemolysin production (28). The sae locus contains four genes, saeP, saeQ, saeR, and saeS. The saeP and saeQ genes are transcribed as a saeP-saeQ-saeR-saeS polycistron and are required for saeRS function (29). It was recently suggested that the cvfA gene affects the processing of the saePQRS transcript (27). Quantitative reverse transcriptase (RT)-PCR analysis confirmed that the expressions of the saeP and saeQ genes in the cvfA mutant were decreased compared with the parent strain (Fig. 1, F and G). The expression of saeP and saeQ was higher in the cvfA/pnpA double-disrupted mutant than in the cvfA-deleted mutant (Fig. 1, F and G). In addition, in the cvfA-deleted mutant, the expression of various metabolic genes involved in amino acid biosynthesis, acetate metabolism in glycolysis, citric acid cycles, and nutrient transporter genes were altered (supplemental Tables S1 and S2). Quantitative RT-PCR analysis confirmed that expression of the adhE gene, which is a metabolic gene involved in acetate metabolism, was decreased in the cvfA-deleted mutant compared with the parent strain (Fig. 1H). The expression of adhE was higher in the cvfA/pnpA double-disrupted mutant than in the cvfA-deleted mutant. Therefore, the altered expression of saeP, saeQ, and adhE genes in the cvfA-deleted mutant was suppressed by the disruption of pnpA.

We further examined whether the decreased virulence of the cvfA-deleted mutant against animals was blocked by the disruption of pnpA. The LD₅₀ value of the cvfA-deleted mutant against silkworms or mice was larger than that of the parent strain (Table 3). The LD₅₀ value of cvfA/pnpA double-disrupted mutant against silkworms or mice was almost the same as that of the cvfA-deleted mutant. Thus, the decreased virulence of the cvfA-deleted mutant against animals was not attenuated by disrupting pnpA. These findings suggest that the phenotype of the cvfA-deleted mutant was not totally suppressed by the disruption of pnpA.

TABLE 3.

Animal-killing ability of the S. aureus cvfA/pnpA double-disrupted mutant

The animal-killing abilities of S. aureus strains were examined using silkworm and mouse models. Two-fold serial dilutions of bacterial solutions were injected into the animals, and the cfu values causing 50% of the animals to die (LD₅₀) were determined. -Fold is the LD₅₀ of the mutant/LD₅₀ of the parent strain.

Strain	Silkworm LD50		Mouse LD50
	(×107 cfu)	-Fold	(×107 cfu)	-Fold
NCTC8325-4 (Parent)	1.5	1.0	2.2	1.0
CKP1129 (ΔcvfA)	>5.6	>3.7	5.6	2.5
M1117NC (ΔpnpA)	0.58	0.39	1.8	0.81
DM1NC (ΔcvfA/ΔpnpA)	>6.2	>4.1	5.2	2.4

To evaluate the role of pnpA in S. aureus virulence, we examined the virulence property of a single mutant of pnpA. Hemolysin production was increased in the pnpA-disrupted mutant compared with the parent strain (Fig. 1I). The increase in the hemolysin production was blocked by the introduction of a plasmid carrying intact pnpA (ppnpA; Fig. 1I). Thus, pnpA negatively affects hemolysin production. Furthermore, the LD₅₀ value of the pnpA mutant against silkworms was smaller than that of the parent strain (Table 3). The LD₅₀ value of the pnpA mutant against mice was slightly smaller than that of the parent strain (Table 3). Thus, the pnpA gene has a negative role in S. aureus virulence.

Mutated PNPase without RNA Degradation Activity Loses Complementation Activity against the cvfA/pnpA Double-disrupted Mutant

We constructed mutated PNPase proteins that lack phosphorolytic activity to determine whether the activity is required for the complementation activity of the increased hemolysin production of the cvfA/pnpA double-disrupted mutant. PNPase has two catalytic domains called PH-1 and PH-2 at the N-terminal region (Fig. 2A). Analysis of PNPase of Streptomyces antibioticus revealed that amino acid substitutions in PH-1 and PH-2 lead to the loss of the phosphorolytic activity of PNPase (30). We constructed E. coli strains overproducing mutated PNPase proteins with substitutions in amino acids that are conserved among bacteria (D96G, R402A/R403A, H407D, R413D, and D496G) and examined whether these mutated PNPases lose phosphorolytic activity. First, we purified wild-type recombinant PNPase protein from an E. coli strain expressing His₆-tagged PNPase by ammonium sulfate precipitation and Ni-NTA resin column chromatography (Fig. 2B). The enzyme activity of the wild-type PNPase was measured by poly(A) polymerization, which is a reverse reaction of phosphorolysis (Fig. 2C) (3). The specific activity of the eluted fraction from the Ni-NTA column was 46 μmol/15 min/mg of protein, which was 10 times higher than that of the ammonium sulfate precipitate fraction, and the recovery of activity was 33% (Table 4). Analysis of SDS-PAGE revealed that the purity of the final protein sample was greater than 90% (Fig. 2B). Furthermore, we purified the mutated PNPase by the same method for wild-type PNPase (Fig. 2D). The mutated PNPase R402A/R403A, H407D, and D496G did not show poly(A) polymerization activity, whereas D96G and R413D showed 10% poly(A) polymerization activity compared with wild-type PNPase (Fig. 2E). Amino acid substitution in enzymes may have different effects on forward and reverse reactions (30). We measured phosphorolytic activity of wild-type and mutated PNPases. The mutated PNPase R402A/R403A, H407D, and D496G showed a loss of phosphorolytic activity, whereas D96G and R413D showed 10% phosphorolytic activity compared with wild-type PNPase (Fig. 2F). Thus, R402A/R403A, H407D, and D496G lost both poly(A) polymerization activity and RNA degradation activity, whereas D96G and R413D retained both activities.

FIGURE 2.

Purification of S. aureus wild-type PNPase and mutated PNPases. A, domains of PNPase are schematically presented. PNPase contains two catalytic domains named PH-1 and PH-2 (58) and two RNA binding domains (59, 60). B, S. aureus PNPase fused with His₆ was overproduced in E. coli and purified by ammonium sulfate precipitation and Ni-NTA column chromatography. Fractions of ammonium sulfate precipitation (29 μg) and Ni-NTA column chromatography (5 μg) were analyzed by SDS-PAGE. Proteins were stained with Coomassie Brilliant Blue. Poly(A) polymerization activity of each fraction is presented in Table 4. C, poly(A) polymerization activity of purified PNPase was measured at 37 °C for 15 min using ADP as a substrate. Vertical axis represents the amount of ADP incorporated into poly(A), and horizontal axis represents the amount of added PNPase protein. D, mutated PNPases were purified by the same method for wild-type PNPase. Purified proteins (1 μg) were analyzed by SDS-PAGE stained with Coomassie Brilliant Blue. E, poly(A) polymerization activities of mutated PNPases were measured using the same method as for wild-type PNPase. F, phosphorolytic activities of wild-type PNPase and mutated PNPases were measured at 37 °C using poly(A) as a substrate.

TABLE 4.

Purification of recombinant His-tagged PNPase

Fraction	Protein	Total activity	Specific activity	Yield	Purification
	mg	μmol/15 min	μmol/15 min/mg	%	-fold
Ammonium sulfate	14.3	69	4.8	100	1
Nickel column	0.5	23	46	33	10

We then transformed the cvfA/pnpA double-disrupted mutant with plasmids expressing wild-type PNPase or mutated PNPases. The cvfA/pnpA mutant transformed with plasmid expressing wild-type PNPase (ppnpA) decreased hemolysin production compared with the cvfA/pnpA mutant transformed with an empty vector pND50 (Fig. 3A). In contrast, the cvfA/pnpA mutant transformed with plasmids expressing R402A/R403A, H407D, and D496G, which showed a loss of RNA degradation activity, produced almost the same amount of hemolysins as the cvfA/pnpA mutant transformed with an empty vector pND50 (Fig. 3A). The cvfA/pnpA mutant transformed with plasmids expressing D96G and R413D, which retained RNA degradation activity, produced a smaller amount of hemolysins than the mutant transformed with an empty vector, and the production level was almost same as that of the mutant transformed with ppnpA expressing wild-type PNPase (Fig. 3A). We performed a Western blotting analysis to measure the expression of PNPase in the cvfA/pnpA mutant. Each mutated PNPase other than R413D was expressed at either an equal or greater level as wild-type PNPase in the cvfA/pnpA mutant (Fig. 3B). The R413D mutant PNPase expression was lower than wild-type PNPase in the cvfA/pnpA mutant (Fig. 3B). Thus, loss of complementation activities of R402A/R403A, H407D, and D496G in the cvfA/pnpA mutant is due to the loss of enzymatic activity and not to the expression level of the mutated PNPases. These results suggest that that RNA degradation activity of PNPase protein is necessary for its complementation activity for the phenotype of the cvfA/pnpA mutant.

FIGURE 3.

Complementation activities of mutated PNPases against hemolysin production in the cvfA/pnpA double-disrupted mutant. A, overnight cultures of the S. aureus parent strain (NCTC8325-4), the cvfA-deleted mutant (CKP1129), and the cvfA/pnpA double-disrupted mutants (DM1NC), which were transformed with an empty plasmid (pND50), plasmid carrying wild-type pnpA (ppnpA), and plasmids carrying mutated pnpA (pD96G, pR402A/R403A, pH407D, pR413D, pD496G, and pΔRBD) were spotted onto nutrient agar plates containing 5% sheep erythrocytes and were incubated overnight at 37 °C. The clear zone around the colony reflects hemolysin activity. B, overnight cultures of S. aureus cells used in A were collected. The cell lysates were electrophoresed in SDS-polyacrylamide gel and subjected to Western blot analysis using anti-PNPase antibodies.

Mutated PNPase without the RNA Binding Domain Loses Complementation Activity against the cvfA/pnpA Double-disrupted Mutant

PNPase carries two RNA binding domains (Fig. 2A). E. coli-mutated PNPase proteins without RNA binding domains retained more than half the poly(A) polymerization activity and phosphorolytic activity as wild-type PNPase (30). In contrast, the RNA binding domains were required for E. coli cell growth at low temperature. Crystal structural analysis indicated that the RNA binding domains are involved in the trimer formation of PNPase and accelerate the acquisition of substrate RNA (31, 32). We examined whether the RNA binding domains of PNPase are required for complementation of the phenotype of the cvfA/pnpA mutant. First, we constructed an E. coli strain overproducing mutated PNPase without the RNA binding domain (residues 623–690) and obtained PNPase ΔRBD in greater than 95% purity (Fig. 2D). The PNPase ΔRBD retained poly(A) polymerization activity and phosphorolytic activity (Fig. 2, E and F). We then transformed the cvfA/pnpA mutant with a plasmid expressing PNPase ΔRBD and examined hemolysin production. The transformed strain expressed PNPase ΔRBD and produced the same levels of hemolysins as the cvfA/pnpA mutant transformed with an empty vector (Fig. 3, A and B). Thus, although PNPase ΔRBD retained RNA degradation activity, it lost complementation activity against the phenotype of the cvfA/pnpA mutant. These results suggest that the RNA binding domain of PNPase is required for complementation of the cvfA/pnpA mutant phenotype.

3′-Phosphorylated RNA Is Resistant to Degradation by PNPase

Because CvfA cleaves the 2′,3′-cyclic phosphodiester linkage of 2′,3′-cyclic RNA and produces 3′-phosphorylated RNA (22), PNPase degrades RNA from the 3′ terminus in the 5′ direction (3). As revealed above, because the phenotype of the cvfA-deleted mutant was suppressed by the disruption of pnpA-encoding PNPase, we hypothesized that the structural conversion of the RNA 3′ terminus by CvfA prevents its degradation by PNPase. To test this hypothesis, we chemically synthesized 3′-hydroxylated RNA (3′-OH RNA), 2′,3′-cyclic RNA, and 3′-phosphorylated RNA using the phosphoramidite method (Fig. 4, A–C), and examined whether the purified PNPase degrades these RNAs. In the case of 3′-OH RNA and 2′,3′-cyclic RNA, the RNA bands disappeared with increasing amounts of PNPase (Fig. 4D). In contrast, the 3′-phosphorylated RNA band did not disappear, even at the highest concentration of PNPase (Fig. 4D). Furthermore, we determined the K_m and V_max values of PNPase against these RNA substrates by measuring the dose-response curve of the substrate RNA concentration and RNA degradation activity (Fig. 4, E–G). V_max values of PNPase against 3′-OH RNA, 2′,3′-cyclic RNA, and 3′-phosphorylated RNA were 35, 6, and 1 μmol/min/mg protein, respectively (Table 5). In addition, the K_m values against each RNA substrate were 22, 42, and 156 μm, respectively (Table 5). These results suggest that 3′-phosphorylated RNA is resistant to degradation by PNPase.

FIGURE 4.

PNPase does not degrade 3′-phosphorylated RNA. A–C, RNA substrates (5′-AAAAAAAAAAG-3′) with different 3′-terminal nucleotides were synthesized using the phosphoramidite method. Structures of RNA substrates were confirmed by electrospray ionization time-of-flight mass spectrometry. D, PNPase (0, 13, 25, 50, 100, or 200 nm) was added to 30 μm 3′-OH RNA, 2′,3′-cyclic RNA, or 3′-phosphorylated RNA and incubated for 10 min at 37 °C. The reaction product was electrophoresed in 7 m urea, 20% polyacrylamide gel, and the RNA was stained with SYBR Green. E–G, PNPase (50 nm) was added to 3′-OH RNA (0–32 μm) (E), 2′,3′-cyclic RNA (0–500 μm) (F), or 3′-phosphorylated RNA (0–500 μm) (G) and incubated for 10 min at 37 °C. After the reaction, nondigested RNA was precipitated by ethanol, and the amount of ribonucleoside diphosphates in the centrifuged supernatant was calculated by measuring the A₂₆₀.

TABLE 5.

Kinetic parameters of PNPase activity on different kinds of substrate RNAs

Substrate	Vmax	Km
	μmol/min/mg	μm
3′-OH RNA	35	22
3′-Cyclic RNA	6	42
3′-Phosphorylated RNA	1	156

Effect of Growth Phase and Cold Stress on the Expression of CvfA and PNPase

If CvfA and PNPase competitively regulate S. aureus gene expression, the expression ratio of CvfA and PNPase might change under different culture conditions. S. aureus exotoxin expression is stimulated in the stationary phase by the agr quorum-sensing system, whereas it is inhibited in the exponential phase (34). In E. coli, the expression of PNPase is activated at cold temperatures (35, 36). We examined the effects of the growth phase and cold stress on the expression ratio of CvfA and PNPase. Both CvfA and PNPase were constantly expressed from the exponential phase (A₆₀₀ = 0.2–1) to the stationary phase (A₆₀₀ = 6), and the ratio of CvfA and PNPase did not change (Fig. 5A). In contrast, the amount of PNPase was decreased at 16 °C compared with that at 37 °C, whereas the amount of CvfA was increased at 16 °C compared with that at 37 °C (Fig. 5B). These results suggest that the ratio of CvfA and PNPase changes and affects gene expression under certain conditions.

FIGURE 5.

Expression of PNPase and CvfA in different culture conditions. A, S. aureus parent strain (NCTC8325-4) was cultured to A₆₀₀ = 0.2, 1, or 6 (15 h) at 37 °C. Cells were collected and subjected to Western blotting with anti-CvfA IgY or anti-PNPase IgG. Each lane contains 1 μg of cell extract protein. B, S. aureus parent strain (NCTC8325-4) was cultured to A₆₀₀ = 0.8 at 37 °C and transferred to 16 °C for 3 h or maintained at 37 °C for 3 h. Cell extracts were subjected to Western blotting with anti-CvfA IgY or anti-PNPase IgG. Each lane in the upper gel contains 1.2 μg of protein and in the lower gel contains 3 μg of protein. C, S. aureus parent strain (NCTC8325-4), the pnpA-disrupted mutant (M1117NC), and the cvfA-deleted mutant (CKP1129) were cultured to A₆₀₀ = 1 or 6 (15 h) at 37 °C. CvfA and PNPase were detected by Western blotting. Each lane contains 0.2 μg of protein. D, eight strains of hospital-associated MRSA (CR1–8 strains) and two strains of community-acquired MRSA (FRP3757 and MW2) were cultured overnight, and the cell extracts were used for Western blotting with anti-CvfA and anti-PNPase antibodies. Each lane contains 1 μg of protein.

Because the reciprocal expression of CvfA and PNPase was observed in the cold stress condition, we examined whether cvfA affects the expression of pnpA or vice versa. The amount of CvfA was increased in the pnpA-disrupted mutant (Fig. 5C). In contrast, the amount of PNPase was not altered in the cvfA-deleted mutant (Fig. 5C). These findings suggest that pnpA negatively regulates the expression of CvfA.

Expression of CvfA and PNPase in Clinical Isolates

We examined whether CvfA and PNPase are expressed in clinical isolates of S. aureus. S. aureus is a problematic pathogen due to its antibiotic-resistant capacity. We examined 10 clinical isolates of methicillin-resistant S. aureus (MRSA). All tested strains expressed both CvfA and PNPase (Fig. 5D). This finding suggests that the regulation by CvfA and PNPase is not specific to a laboratory strain but is conserved in most S. aureus strains.

DISCUSSION

The findings of this study indicated that the decreased hemolysin production and agr expression in the cvfA-deleted mutant was suppressed by disruption of pnpA-encoding PNPase with 3′- to 5′-exonuclease activity. The increased hemolysin production in the cvfA/pnpA mutant was complemented by the expression of wild-type PNPase, whereas it was not complemented by the expression of mutated PNPases without RNA degradation activity or without an RNA binding domain (Table 6). Therefore, both RNA degradation activity and the RNA binding domain of PNPase are required for the genetic interaction between cvfA and pnpA. Because the mutated PNPase without an RNA binding domain (PNPase ΔRBD) retained the RNA degradation activity in vitro, PNPase ΔRBD may be defective in capturing and degrading specific RNA substrates in vivo. Furthermore, we demonstrated that 2′,3′-cyclic RNA, a substrate of CvfA, is sensitive to PNPase-mediated degradation, whereas 3′-phosphorylated RNA, a product of CvfA, is resistant to PNPase-mediated degradation (Fig. 4). These results suggest that an RNA essential for expression of the agr and hemolysin genes is modified to 3′-phosphorylated RNA by CvfA and escapes degradation by PNPase (Fig. 6). If the RNA is not modified by CvfA, the RNA will be degraded by PNPase. This model can explain why the cvfA-deleted mutant exhibits decreased hemolysin production as well as why the cvfA/pnpA-disrupted mutant restores hemolysin production.

TABLE 6.

Characteristics of the mutated PNPases

Complementation + indicates that PNPase expression decreased the hemolysin production of the cvfA/pnpA double mutant. Phosphorolysis and Polymerization refer to the biochemical activities of PNPase in vitro.

	Phosphorolysis	Polymerization	Complementation
Wild-type PNPase	+	+	+
D96G	+	+	+
R402A/R403A	−	−	−
H407D	−	−	−
R413D	+	+	+
D496G	−	−	−
ΔRBD	+	+	−

FIGURE 6.

S. aureus hemolysin production via control of RNA stability by CvfA and PNPase. A specific RNA (3′-OH RNA) that is required for hemolysin production is cleaved by endonuclease activity of CvfA or other endonucleases and results in the production of 2′,3′-cyclic RNA. Next, the 2′,3′-cyclic RNA is converted to 3′-phosphorylated RNA by CvfA. 3′-OH RNA and 2′,3′-cyclic RNA are degraded by PNPase, whereas 3′-phosphorylated RNA is resistant to PNPase degradation.

Based on microarray and quantitative RT-PCR analysis, we found that the decreased expression of the sae locus in the cvfA-deleted mutant was suppressed by the disruption of the pnpA gene. Based on the report that the cvfA gene affects the processing of the saePQRS transcript (27), saePQRS mRNA might be a target of CvfA and PNPase. In addition, because expression of the sae locus is positively regulated by the agr locus (34) and cvfA and pnpA regulate the expression of the agr locus in an opposing manner, the effect of cvfA and pnpA on sae expression might be due in part to the altered expression of the agr locus. It is also possible that CvfA and PNPase directly target mRNAs encoding hemolysins and other virulence factors, whose expression is regulated by sae and agr. We also found that the decreased expression of the adhE gene encoding alcohol dehydrogenase, which is involved in acetate metabolism, was suppressed by the disruption of the pnpA gene. The expression of adhE was not affected by either agr (37) or saeRS (38). Thus, CvfA and PNPase target RNA genes other than agr and saeRS to control the expression of adhE, and those genes remain to be identified. As a whole, CvfA and PNPase regulate energy metabolism and virulence in S. aureus. We further demonstrated that the decreased killing abilities of the cvfA-deleted mutant against silkworms and mice were not attenuated by the disruption of pnpA (Table 3). The finding that agr expression, which is required for virulence in both silkworms (26) and mice (39), was restored in the cvfA/pnpA double-disrupted mutant (Fig. 1) suggests the presence of other factors that were not restored in the double mutant. These findings suggest that the target RNAs of CvfA are not totally same as those of PNPase. Further studies are needed to reveal the characteristics of the target RNAs of CvfA and PNPase and the mechanism of target recognition by each enzyme.

B. subtilis RNase Y, a homolog of CvfA, has endonuclease activity against mRNA (2, 5, 6). At present, it is unclear whether S. aureus CvfA has endonuclease activity. 2′,3′-Cyclic RNA is known to be produced by either endonucleolytic cleavage (40) or by RNA terminal cyclase (41). Bacterial tRNA ligase cleaves immature tRNA to produce 2′,3′-cyclic tRNA and further cleaves it to produce 2′-phosphorylated tRNA (42). Based on these reports, CvfA may be a phosphodiesterase against 2′,3′-cyclic RNA that is produced by RNA cleavage by CvfA or some other endonuclease or by an RNA terminal cyclase (Fig. 6).

RNA stability can be controlled by modifying the RNA structure by the addition of a 3′-poly(A) tail (43, 44) and the formation of hairpin loop structures (45). To our knowledge, this study is the first to suggest that modification of the 3′-terminal nucleotide structure of RNA controls RNA stability and regulates bacterial virulence. Controlling RNA stability allows a faster response of gene expression to environmental changes than control of RNA transcription. S. aureus hemolysins function in various infectious stages, including lysis of host cells, escape from cellular immunity, and biofilm formation (46–49). The regulation of RNA stability by CvfA and PNPase might be important for bacteria to quickly regulate the expression of hemolysin genes according to host environmental changes. Control of RNA stability by modification of the 3′-terminal nucleotide structure of RNA requires little energy consumption and has little effect on the whole RNA secondary structure. Future studies are needed to develop methods to determine the 3′-terminal nucleotide structure of endogenous mRNA and to elucidate the biological significance of the control of RNA stability by altering the 3′-terminal nucleotide structure.