Abstract
Human adenovirus type-36 (HAdV-36) is a specific pathogen that may lead to increased adiposity and obesity. In order to evaluate the effects of HAdV-36 on gene transcription, a microarray analysis of muscle cells infected with HAdV-36 was performed. Gene expression profile was determined by microarray analysis in cultured human skeletal muscle cells with or without HAdV-36 infection. Quantitative realtime PCR (qPCR) assay was performed in selected 35 genes to verify the results of the microarray analysis. A total of 13,060 unique genes were detected in the HAdV-36 infected muscle cells infected with HAdV-36. Among them, 1,004 genes were significantly altered by using a cut-off point at fold change ≥1.5 and P value <0.05. Most of the principal 100 altered genes were involved in development, immune response, signal transduction, transcriptional regulation as well as carbohydrate, lipid and protein metabolism. Thirty-two genes (91.4%) from the 35 selected genes were confirmed by qPCR assay. In addition, HAdV-36 altered 252 genes that are associated with cancer. The study showed HAdV-36 infection upregulated host cell antiviral defense. HAdV-36 also induces changes in gene expression related to cellular signaling pathways of signal transduction, transcriptional regulation as well as carbohydrate, lipid and protein metabolism. However, it remains to be investigated if HAdV-36 infection could lead to oncogenesis.
Keywords: microarray, gene expression, human skeletal muscle cells, obesity
INTRODUCTION
The etiology of obesity is multifactorial and infection is one cause [Dhurandhar et al., 2000]. Infection with specific pathogens may lead to increased adiposity and obesity [Dhurandhar et al., 2001]. The human adenovirus type 36 (HAdV-36) is a relatively new factor in promoting adipogenesis [Dhurandhar et al., 2000]. HAdV-36 is associated causally with increased adiposity and altered metabolic profile in animals and humans, respectively. Experimental infection of animals with HAdV-36 induces hypolipidemia and obesity without increasing food intake [Dhurandhar et al., 2001, 2002]. HAdV-36 was also observed to increase glucose uptake in cultured cells and lower plasma insulin concentration in animals [Dhurandhar et al., 2002; Pasarica et al., 2006]. HAdV-36 seropositive status appears to be a hallmark of a clinical-metabolic profile possibly preceding obesity and diabetes in non-obese patients [Trovato et al., 2009]. The presence of HAdV-36 antibodies in humans is associated with increased body mass index [Vangipuram et al., 2004; Greenway, 2006]. A recent report showed an association of obesity and higher body weight with the presence of neutralizing antibodies to HAdV-36 in children [Gabbert et al., 2010]. Other studies have also demonstrated that HAdV-36 may play a role in childhood obesity [Atkinson et al., 2010]. Infection of adipocytes with HAdV-36, but not Ad-2 leads to increased production of IL-6 which might contribute to chronic low-grade inflammation [Pasarica et al., 2008]. While down regulation of the cytotoxic immune response may allow HAdV-36-infected cells to survive [Rogers et al., 2008].
The mechanisms responsible for the increased adiposity may contribute to the alterations in gene expression of multiple enzymes and transcription factors by HAdV-36 [Vangipuram et al., 2007; Wang et al., 2008, 2010]. HAdV-36 infections in preadipocytes have been noted to induce cell differentiation in vitro, and remodel metabolically human adipose tissue by lowering glucose and lipid concentrations [Rogers et al., 2008]. The ability of HAdV-36 to infect primary cultured human skeletal muscle (hSKM) cells was confirmed by HAdV-36 E4 orf1 gene expression [Wang et al., 2008]. HAdV-36 infection increases glucose uptake in both diabetic and nondiabetic hSKM cells by activation of the Ras-PI 3K signaling pathway and increased glucose transporter 1 and 4 (GLUT1 and GLUT4) protein expression, but these alterations were independent of the insulin signaling pathway [Wang et al., 2008]. Recently, HAdV-36 was demonstrated to decrease fatty acid oxidation and increase de novo lipogenesis in primary cultured hSKM cells by promoting Cidec/fat specific protein 27 (FSP27) expression [Wang et al., 2010]. Therefore, the hypothesis was that HAdV-36 could infect multiple types of cells and alter host cellular signaling pathways by affecting gene expression. High density DNA microarray technology has been used extensively in gene and drug discovery, disease diagnosis, and toxicological research. Complete genomic sequences of microbial pathogens and their hosts offer sophisticated new strategies for studying host-pathogen interactions. Additionally, DNA microarrays can be used to exploit primary sequence data to measure transcript levels and detect sequence polymorphisms, for every gene, simultaneously [Cummings and Relman, 2000]. Recently, it was reported that HAdV-36, but not Ad-2, induced lipid accumulation and upregulated adipogenesis-related genes, such as PPAR-gamma signaling pathway, and inflammation, in comparison with Ad-2 infection in human mesenchymal stem cells (hMSCs) [Na et al., 2012]. However, there are currently no data available on the effects of HAdV-36 on gene expression in muscle cells. In order to evaluate the effects of HAdV-36 on skeletal muscle gene expression, which may provide evidence linking HAdV-36 induced diseases and the possible mechanisms of pathogenesis, the gene expression profile in HAdV-36 infected hSKM cells was measured using a DNA microarray assay.
MATERIALS AND METHODS
Isolation and Culture of hSKM Cells
Human skeletal muscle cells were isolated from the vastus lateralis muscle biopsy of volunteers and grown as described previously [Wang et al., 2008]. The protocol to obtain muscle biopsies was approved by the human investigations committee of the Pennington Biomedical Research Center, and informed consent was signed by the volunteer individual. Briefly, muscle biopsies were obtained with a needle from the vastus lateralis muscle from three healthy lean men (age 31.8 ± 4.3 years; BMI 23.2 ± 1.04 kg/m2; mean ± SE). Approximately, 50 mg muscle tissue was minced with surgical scissors and digested by a solution containing 0.05% trypsin and 0.045 mmol/L of EDTA with constant shaking at 37°C. After centrifugation to remove fat and debris, myoblasts were grown in monolayer culture in SkGM with 10% (v/v) FBS, 1% (v/v) antibiotics (10,000 units/ml penicillin G and 10 mg/ml streptomycin), 2 mmol/L glutamine, and 25 mmol/L HEPES (pH 7.4).
Infection of hSKM Cells With HAdV-36
HAdV-36 was kindly provided by Dr. Nikhil Dhurandhar (Pennington Biomedical Research Center). Cells were maintained in SkGM medium (Cambrex, MD) with 10% FBS. Antibiotics were removed before HAdV-36 infection. Unless otherwise indicated in the figure legends, 80% confluent hSKM cells were inoculated with HAdV-36 at a dose of 3.8 PFU/cell. After 1 hr, the HAdV-36 virus was removed and following rinsing three times with PBS buffer, complete medium was added. Successful infection was ascertained by determining expressions of respective viral genes (E4 orf-1) by quantitative real-time PCR assay (qPCR).
RNA Extraction
At Day 5 post-infection, total RNA was extracted from the cultured skeletal muscle cells for microarray and qPCR assays as described previously [Wang et al., 2010]. Total RNA was isolated from the tissue powder using TRIZOL reagent (Carlsbad, CA). After DNase I digestion, RNA was further purified with RNeasy Mini Kit (Germantown, MD). RNA concentration and quality were measured by RNA 6000 Nano LabChip kit (Santa Clara, CA).
Gene Expression Profiling
DNA microarray profiling was assessed in HAdV-36 infected and control hSKM cells from three independent experiments. The Illumina Human-6 v2 Expression BeadChips were purchased from Illumina Inc (San Diego, CA) and contained a total of 47,296 oligonucleotide probes (gene-specific 50mer) or extended sequence tag sequences as well as housekeeping genes used for gene expression profiling. Biotin-labeled cRNA was generated and amplified linearly from 1 µg of total RNA from each sample TotalPrep RNA Amplification Kit, Ambion (Austin, TX). After the cRNA was fragmented by heating at 60°C for 30 min, the biotin-labeled targets were hybridized overnight to the Illumina Expression BeadChip. Following hybridization, the BeadChip was washed and streptavidin-Cy3 conjugate staining protocol. Once the BeadChips had been processed, they were scanned by the Genomics Resource Laboratory with an Illumina BeadArray Reader. Then, chemiluminescence detection, image acquisition and analysis were performed according to the manufacturer’s protocol. Signals were quantified, corrected for background, and the final images as well as feature data and gene analysis were processed using Illumina BeadStudio software (San Diego, CA).
Quantitative Real-Time PCR
The primer sequences of candidate genes were designed using Primer Express Software version 3.0 (Foster, CA). Primer sequences of selected genes are shown in Table I. All primers were ordered from Integrated DNA Technologies, Inc. (Coralville, IA). A 1-µg aliquot of total RNA for each sample was reverse transcribed in a 100-µl reaction volume with a commercial High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) according to the manufacturer’s protocol. The quantitative PCR was conducted in 384-well microtiter plates on the ABI Prism Sequence Detector 7900 (Applied Biosystems) with Bio-Rad iTaq SYBR Green Supermix with ROX Kits. For each gene, PCR amplification was performed in duplicate and the results were normalized by β-actin.
TABLE I.
Sequence of Primers From Selected Gene List
| # | Accession | Gene symbol | Forward | Reverse |
|---|---|---|---|---|
| 1 | NM_002462 | MX1 | GGCCAGCAAGCGCATCT | TGGAGCATGAAGAACTGGATGA |
| 2 | NM_001549 | IFIT3 | GGCCCCAACCTGGGATT | AAATGTACCTTAGAGCAACATGCAA |
| 3 | NM_001547 | IFIT2 | AATTGAGGTGGCAACATAGTTTGA | CCCGTCGCTTCTAGCTATGTATC |
| 4 | NM_005101 | G1P2 | TCCTGCTGGTGGTGGACAA | TTGTTATTCCTCACCAGGATGCT |
| 5 | NM_001034 | RRM2 | TCTGGCTTTCTTTGCAGCAA | GCTAAATCGCTCCACCAAGTTT |
| 6 | NM_004091 | E2F2 | GCCTATGTGACTTACCAGGATATCC | CCTTGACGGCAATCACTGTCT |
| 7 | NM_021170 | HES4 | CTCAGCTCAAAACCCTCATCCT | CGCCTTCTCCAGCTTCGA |
| 8 | NM_003516 | HIST2H2AA | CGCCAGGCAGGAGTTTCTC | TTGCCACGACCAGACATGAC |
| 9 | NM_030928 | CDT1 | GGTCAAGAGATCGAGACCATCCT | CCCGGCTAATTTTTTGTATTTTTAGT |
| 10 | NM_005375 | MYB | TCGCCAGCAAGGTGCAT | AGAGGTTCTTAACATTATCCAGAATGG |
| 11 | NM_021244 | RRAGD | GGCACAGAGGAGGGAGTTCTG | GGATTCTCGGCTTCACTTCAGT |
| 12 | NM_004474.2 | FOXD2 | TCATCACCATGGCCATCCT | GAACTCGCAGATCTCGCTCAA |
| 13 | NM_003713.3 | PPAP2B | CCATGCCTCCTTCTCCATGT | AAGCGGGCCTGCAGGTATA |
| 14 | NM_012140.3 | SLC25A10 | GCTGGCATCCGCCTCAT | CGTAGCTGTTCCAGAAACACAAA |
| 15 | NM_001901 | CTGF | TGCACCGCCAAAGATGGT | GACTCTCCGCTGCGGTACAC |
| 16 | NM_001975 | ENO2 | TTGCTCTTGTCCCACGTGTCT | CCCAGCACTATGCACAGTTCA |
| 17 | NM_021979 | HSPA2 | GGGACCCACCATCGAAGAA | GGCAAAGAGGTTTACGCTGACT |
| 18 | NM_001552 | IGFBP4 | TGGACTGAATGTGCCTAATGGA | CCCAGGAAGCCCCTCATC |
| 19 | NM_012211.3 | ITGA11 | AATATCTCGCAGTCAGCAAACCT | ATGCTACCGTCTGAGTCCTCCTT |
| 20 | NM_000602 | SERPINE | CCGCCGCCTCTTCCA | GCCATCATGGGCACAGAGA |
| 21 | NM_003247 | THBS2 | CAATATCACACGCATCCGTCTCT | GCCACTCCCTTTGCAATTCTT |
| 22 | NM_199512 | URB | CAGTGGTCAGGCGTGCAAT | ACGCCTAAAAGCTTCAGAATGG |
| 23 | NM_005281 | GPR3 | CCATTGCCTTCTTCATGGTGTT | CGATGCGGCAGATTTGG |
| 24 | NM_013355 | PKN3 | AAACCCCCTCGGCTTCAG | GTATTTCCCTGTCCCCTTGAACT |
| 25 | NM_014353 | RAB26 | TCGCACTAGCCCAAGCAATA | CGAAGCCGCTGCACAAG |
| 26 | NM_005012 | ROR1 | CAGCCTGGACCACGGAGAT | GTATTCCATGCCAGCTGCAA |
| 27 | NM_003881 | WISP2 | GAAGAGAAGGCACACAGAGATTCTG | GGCTTGTATTCAGGAACAATTTTACA |
| 28 | NM_003475 | RASSF7 | TCGCACTAGCCCAAGCAATA | CGAAGCCGCTGCACAAG |
| 29 | NM_080685 | PTPN13 | TGAGGATGTTATTTACGCTCGAGTT | ATGTGGGCACTGCAAGCA |
| 30 | NM_032512 | PDZD4 | TGGTGGACAGTGGCACTCA | CCCAGCGCCATGATATGC |
| 31 | NM_003954 | MAP3K14 | CGACACCCCAAGCTATTTCAA | GGATGTGCAGGTGTTCACCAT |
| 32 | NM_152331.1 | ACOT4 | GCCGTATGCTACATGCTTCAAC | GAAATGCCCAAAAGCCCAAT |
| 33 | NM_002332 | LRP1 | GGATTGACGCCAGGTCAGA | CCCGAAGCACCTCCATGT |
| 34 | NM_001146.3 | ANGPT1 | CAAGGTTCTTGACCGTGAATCTG | GAGCACTGTCACCCCAAGTAGAG |
| 35 | NM_138440 | SLITL2 | CACTCGCCAACCTCAGCAA | CGGAAGGTCTCATTGGTGATTT |
Statistical Analysis
The effects of HAdV-36 on the muscle gene expression, metabolic parameters, cellular signaling and functional parameters were determined using analysis of covariance. For gene expression, within-array normalization was done based on housekeeping genes on each array. Global normalization among arrays was accomplished using quantile normalization method [Bolstad et al., 2003]. ANOVA analysis with Bonferroni adjustment was used for detecting significantly differentiated genes. Differentially expressed genes between HAdV-36 and control cells were determined based on the following criteria: (1) Bonferroni-adjusted P < 0.05 and (2) fold change of HAdV-36 over control group ≥1.5. All data analyses were carried out on SAS (Cary, NC). Several public databases including David/Ease, GenMAPP, Panther and GOTM, TreeView version 1.6, and Ingenuity system software (Redwood, CA) were used to assess functional gene cluster analysis [Eisen et al., 1998], and details were described in previous studies [Wang et al., 2009].
RESULTS
Global Gene Expression in HAdV-36 Infected hSKM Cells
The signals of 13,060 genes were detected in both HAdV-36 infected and control muscle cells in the BeadChips, which contain 47,296 genes (e.g., 27.61% of all the genes were detected). The correlations between control muscle cells as well as between HAdV-36 infected and control cells are shown in the Figure 1A,B. The distribution of fold changes of 13,060 genes in HAdV-36 infected muscle cells is shown in Figure 1C. There were 1,004 genes at fold change ≥1.5. Among them, 441 genes were down-regulated and 563 genes were up-regulated. Using the cut-off point at fold change ≥2.0, 595 genes were altered. Among them, 223 genes were down-regulated and 372 genes were up-regulated in HAdV-36 infected hSKM cells when compared with control cells. The fold changes at >2 to <3, >3 to <4, >4 to <5, and >5 were 371, 111, 56, and 57, respectively. The maximal upregulated gene was human myxovirus (influenza virus) resistance 1 (MX1) with fold change 44.35, and the most down-regulated genes were human gremlin 1, cysteine knot superfamily (GREM1) with fold change −12. Among the 1,004 genes with a fold change ≥1.5, 801 genes were mapped using Ingenuity analysis. The data showed that the 121 biological processes and partial biological process (42 biological processes) were observed (Fig. 2). Fifty-four genes were found to be associated with molecular mechanisms of cancer, hereditary breast cancer signaling, and breast cancer regulation by stathmin 1, pancreatic adenocarcinoma signaling and nonsmall cell lung cancer signaling, as seen in Figure 2. There were 252 oncological genes, which account for one fourth of the 1,004 altered genes (Table II).
Figure 1.
Correlation of microarray data between controls and between HAdV-36 infected cells and control cells as well as gene distribution in HAdV-36 infected muscle cells. Panel A shows correlation of detected genes between control cells, panel B is the correction between HAdV-36 and control cells. Panel C shows gene distribution in HAdV-36 infected muscle cells. [Color figure can be seen in the online version of this article, available at http://wileyonlinelibrary.com/journal/jmv]
Figure 2.
Biological processes of genes in HAdV-36 infected muscle cells.
TABLE II.
Summary of Microarray Analysis in HAdV-36 Infected Muscle Cells
| Top networks | ||
| Associated network functions | Score | |
| Cardiovascular system development and function, organismal development, cancer | 46 | |
| Gene expression, cellular growth and proliferation, RNA post-transcriptional modification | 42 | |
| DNA replication, recombination, and repair, gene expression, carbohydrate metabolism | 38 | |
| Cell cycle, cellular assembly and organization, cancer | 36 | |
| Cellular development, infection mechanism, cancer | 35 | |
| Diseases and disorders | ||
| Name | P value | Number of molecules |
| Cancer | 5.00E−14 to 2.88E−02 | 252 |
| Gastrointestinal disease | 5.00E−14 to 2.62E−02 | 124 |
| Genetic disorder | 5.40E−11 to 2.88E−02 | 161 |
| Dermatological diseases and conditions | 4.48E−06 to 2.51E−02 | 96 |
| Reproductive system disease | 9.30E−05 to 2.88E−02 | 138 |
| Molecular and cellular functions | ||
| Name | P value | Number of molecules |
| Cell cycle | 4.14E−10 to 2.88E−02 | 127 |
| DNA replication, recombination, and repair | 7.05E−07 to 1.98E−02 | 94 |
| Cell death | 1.35E−07 to 2.88E−02 | 185 |
| Cellular growth and proliferation | 1.57E−06 to 2.88E−02 | 223 |
| Cellular movement | 6.96E−05 to 2.35E−02 | 103 |
| Physilogical system development and function | ||
| Name | P value | Number of molecules |
| Connective tissue development and function | 6.03E−05 to 2.88E−02 | 79 |
| Skeletal and muscular system development and function | 1.09E−03 to 2.88E−02 | 46 |
| Cardiovascular system development and function | 1.61E−03 to 2.77E−02 | 58 |
| Embryonic development | 2.18E−03 to 1.98E−02 | 21 |
| Endocrine system development and function | 2.18E−03 to 2.18E−03 | 2 |
| Top canonical pathways | ||
| Name | P value | Ratio |
| Cell cycle control of chromosomal replication | 2.19E−06 | 9/31 (0.29) |
| Role of CHK protein in cell cycle checkpoint control | 1.06E−04 | 8/35 (0.229) |
| Mismatch repair in Eukaryotes | 6.21E−04 | 5/24 (0.208) |
| Cyclins and cell cycle regulation | 2.71E−03 | 10/89 (0.112) |
| Cell cycle: G1/S checkpoint regulation | 2.99E−03 | 8/61 (0.131) |
The Principal Affected Genes in HAdV-36 Infected Cells
The principal 100 genes (about 10% of total 1,004 affected genes) altered by HAdV-36 are listed in Table III. These genes were involved in 10 biological processes that include carbohydrate and lipid metabolism (4 genes), development (20 genes), unknown processes (9 genes), immune response (9 genes), protein metabolism (7 genes), other processes or metabolism (2 genes), signal transduction (13 genes), transcription regulation (23 genes), transportation (8 genes), and unknown genes (2 genes). Interestingly, all of nine genes involved in immune response and most of the genes associated with the transcription regulation process (19/23 genes; 82%) were up-regulated by HAdV-36. In particular, gene expression of MX1, ribonucleotide reductase M2 (RRM2), interferon-induced protein with tetratricopeptide repeats 3 (IFIT3), ISG15 ubiquitin-like modifier (ISG15), chromatin licensing and DNA replication factor 1 (CDT1), MYB and E2F transcription factor 7 (E2F7) were up-regulated significantly in HAdV-36 versus control muscle cells (P < 0.001). However, mRNA levels of KIAA119, integrin alpha 11 (ITGA11), connective tissue growth factor (CTGF), stimulator of chondrogenesis1(SCRG1), thrombospondin 2 (THBS2), serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 (SERPINE1), cartilage oligomeric matrix protein [Maisonpierre et al., 1997], inhibin, beta E (INHBE) and TSC22 domain family, member 3 (TSC22D3) were significantly down-regulated in HAdV-36 infected cells in comparison with control cells (P < 0.001).
TABLE III.
HAdV-36 Regulated Top 100 Gene List (Down or Upregulated)
| Accession | Symbol | Fold change |
Gene name |
|---|---|---|---|
| Carbohydrate and lipid metabolisms | |||
| NM_003713 | PPAP2B | −3.89 | Homo sapiens phosphatidic acid phosphatase type 2B (PPAP2B), transcript variant 1, mRNA |
| NM_198207 | LASS1 | 5.27 | Homo sapiens LAG1 longevity assurance homolog 1 (S. cerevisiae; LASS1), transcript variant 2, mRNA |
| NM_001975 | ENO2 | 7.70 | Homo sapiens enolase 2 (gamma, neuronal; ENO2), mRNA |
| NM_182908 | DHRS2 | 7.06 | Homo sapiens dehydrogenase/reductase (SDR family) member 2 (DHRS2), transcript variant 1, mRNA |
| Development | |||
| NM_004585 | RARRES3 | 8.21 | Homo sapiens retinoic acid receptor responder (tazarotene induced) 3 (RARRES3), mRNA |
| NM_004335 | BST2 | 6.93 | Homo sapiens bone marrow stromal cell antigen 2 (BST2), mRNA |
| NM_021147 | UNG2 | 5.59 | Homo sapiens uracil-DNA glycosylase 2 (UNG2), transcript variant 1, mRNA |
| NM_080668 | CDCA5 | 5.54 | Homo sapiens cell division cycle associated 5 (CDCA5), mRNA |
| NM_021979 | HSPA2 | 5.46 | Homo sapiens heat shock 70kDa protein 2 (HSPA2), mRNA |
| NM_000138 | FBN1 | −3.70 | Homo sapiens fibrillin 1 (Marfan syndrome; FBN1), mRNA |
| NM_002581 | PAPPA | −3.84 | Homo sapiens pregnancy-associated plasma protein A, pappalysin 1 (PAPPA), mRNA |
| NM_003277 | CLDN5 | −3.93 | Homo sapiens claudin 5 (transmembrane protein deleted in velocardiofacial syndrome; CLDN5), mRNA |
| NM_003062 | SLIT3 | −4.30 | Homo sapiens slit homolog 3 (Drosophila; SLIT3), mRNA |
| NM_019035 | PCDH18 | −4.58 | Homo sapiens protocadherin 18 (PCDH18), mRNA |
| NM_003247 | THBS2 | −5.36 | Homo sapiens thrombospondin 2 (THBS2), mRNA |
| NM_000602 | SERPINE1 | −_5.42 | Homo sapiens serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 |
| NM_080645 | COL12A1 | −5.76 | Homo sapiens collagen, type XII, alpha 1 (COL12A1), transcript variant short, mRNA |
| NM_003246 | THBS1 | −5.89 | Homo sapiens thrombospondin 1 (THBS1), mRNA |
| NM_007281 | SCRG1 | −6.55 | Homo sapiens scrapie responsive protein 1 (SCRG1), mRNA |
| NM_012211 | ITGA11 | −9.13 | Homo sapiens integrin, alpha 11 (ITGA11), transcript variant 2, mRNA |
| NM_001901 | CTGF | −9.37 | Homo sapiens connective tissue growth factor (CTGF), mRNA |
| NM_080629 | COL11A1 | −_9.81 | Homo sapiens collagen, type XI, alpha 1 (COL11A1), transcript variant B, mRNA |
| NM_003013 | SFRP2 | −10.61 | Homo sapiens secreted frizzled-related protein 2 (SFRP2), mRNA |
| NM_013372 | GREM1 | −12.21 | Homo sapiens gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis) (GREM1), mRNA |
| Genes with unknown process | |||
| NM_138440 | SLITL2 | −5.83 | Homo sapiens slit-like 2 (Drosophila) (SLITL2), mRNA |
| NM_006207 | PDGFRL | −5.29 | Homo sapiens platelet-derived growth factor receptor-like (PDGFRL), mRNA |
| NM_031479 | INHBE | −4.93 | Homo sapiens inhibin, beta E (INHBE), mRNA |
| NM_031455 | CCDC3 | −4.82 | Homo sapiens coiled-coil domain containing 3 (CCDC3), mRNA |
| NM_024866 | ADM2 | −4.32 | Homo sapiens adrenomedullin 2 (ADM2), mRNA |
| NM_181724 | TMEM119 | −4.00 | Homo sapiens transmembrane protein 119 (TMEM119), mRNA |
| NM_194293 | CMYA1 | −3.64 | Homo sapiens cardiomyopathy associated 1 (CMYA1), mRNA |
| NM_014109 | ATAD2 | 5.32 | Homo sapiens ATP ase family, AAA domain containing 2 (ATAD2), mRNA |
| NM_016448 | DTL | 5.56 | Homo sapiens denticleless homolog (Drosophila; DTL), mRNA |
| Immune response | |||
| NM_001710 | CFB | 5.50 | Homo sapiens complement factor B (CFB), mRNA |
| NM_006417 | IFI44 | 6.85 | Homo sapiens interferon-induced protein 44 (IFI44), mRNA |
| NM_002038 | G1P3 | 8.07 | Homo sapiens interferon, alpha-inducible protein (clone IFI-6-16; G1P3), transcript variant 1, mRNA |
| NM_001549 | IFIT3 | 10.04 | Homo sapiens interferon-induced protein with tetratricopeptide repeats 3 (IFIT3), mRNA |
| NM_001547 | IFIT2 | 10.09 | Homo sapiens interferon-induced protein with tetratricopeptide repeats 2 (IFIT2), mRNA |
| NM_005101 | G1P2 | 10.43 | Homo sapiens interferon, alpha-inducible protein (clone IFI-15K; G1P2), mRNA |
| NM_003733 | OASL | 10.70 | Homo sapiens 2’–5’-oligoadenylate synthetase-like (OASL), transcript variant 1, mRNA |
| NM_005532 | IFI27 | 10.90 | Homo sapiens interferon, alpha-inducible protein 27 (IFI27), mRNA |
| NM_002462 | MX1 | 43.46 | Homo sapiens myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse; MX) |
| Protein metabolism | |||
| NM_014905 | GLS | −4.70 | Homo sapiens glutaminase (GLS), mRNA |
| NM_052947 | HAK | −3.66 | Homo sapiens heart alpha-kinase (HAK), mRNA |
| NM_080685 | PTPN13 | −3.55 | Homo sapiens protein tyrosine phosphatase, nonreceptor type 13 (APO-1/CD95(PTPN13)) |
| NM_001013005 | HERC6 | 7.75 | Homo sapiens hect domain and RLD 6 (HERC6), transcript variant 4, mRNA |
| NM_024625 | ZC3HAV1 | 7.77 | Homo sapiens zinc finger CCCH-type, antiviral 1 (ZC3HAV1), transcript variant 2, mRNA |
| NM_003954 | MAP3K14 | 16.85 | Homo sapiens mitogen-activated protein kinase kinase kinase 14 (MAP3K14), mRNA |
| NM_016323 | HERC5 | 21.66 | Homo sapiens hect domain and RLD 5 (HERC5), mRNA |
| Other process or metabolism | |||
| NM_018689 | KIAA 1199 | −11.71 | Homo sapiens KIAA 1199 (KIAA 1199), mRNA |
| NM_004105 | EFEMP1 | −5.25 | Homo sapiens EGF-containing fibulin-like extracellular matrix protein 1 (EFEMP1), transcript variant 1 |
| Signal transduction | |||
| NM_012242 | DKK1 | −5.35 | Homo sapiens dickkopf homolo 1 (Xenopus laevis; DKK1), mRNA |
| NM_016651 | DACT1 | −5.06 | Homo sapiens dapper, antagonist of beta -catenin, homolog 1 (Xenopus laevis; DACT1), mRNA |
| NM_020311 | CMKOR1 | −4.89 | Homo sapiens chemokine orphan receptor 1 (CMKOR1), mRNA |
| NM_002133 | HMOX1 | −4.72 | Homo sapiens heme oxygenase (decycling) 1 (HMOX1), mRNA |
| NM_006209 | ENPP2 | −4.41 | Homo sapiens ectonucleotide pyrophosphatase/phosphodiesterase 2 (autotaxin; ENPP2), mRNA |
| NM_024767 | DLC1 | −_4.25 | Homo sapiens deleted in liver cancer 1 (DLC1), transcript variant 3, mRNA |
| NM_003714 | STC2 | −3.87 | Homo sapiens stanniocalcin 2 (STC2), mRNA |
| NM_003881 | WISP2 | −3.66 | Homo sapiens WNT1 in ducible signaling pathway protein 2 (WISP2), mRNA |
| NM_001033047 | NPNT | −3.62 | Homo sapiens nephronectin (NPNT), mRNA |
| NM_005458 | GABBR2 | 5.62 | Homo sapiens gamma-aminobutyric acid (GABA) B receptor, 2 (GABBR2), mRNA |
| NM_014736 | KIAA0101 | 5.99 | Homo sapiens KIAA0101 (KIAA0101), transcript variant 1, mRNA |
| XM_938838 | CNIH2 | 6.28 | PREDICTED: Homo sapiens cornichon homolog 2 (Drosophila; CNIH2), mRNA |
| NM_002220 | ITPKA | 7.34 | Homo sapiens inositol 1,4,5-trisphosphate 3-kinase A (ITPKA), mRNA |
| Transcriptional regulation | |||
| NM_181353 | ID1 | −5.42 | Homo sapiens inhibitor of DNA binding 1, dominant negative helix-loop-helix protein (ID1), transcript variant 2 |
| NM_021158 | TRIB3 | −5.09 | Homo sapiens tribbles homolog 3 (Drosophila; TRIB3), mRNA |
| NM_004089 | TSC22D3 | −4.70 | Homo sapiens TSC22 domain family, member 3 (TSC22D3), transcript variant 2, mRNA |
| NM_022658 | HOXC8 | −4.42 | Homo sapiens homeobox C8 (HOXC8), mRNA |
| NM_004083 | DDIT3 | −4.20 | Homo sapiens DNA-damage-inducible transcript 3 (DDIT3), mRNA |
| NM_006397 | RNA SEH2A | 5.41 | Homo sapiens ribonuclease H2, large subunit (RNA SEH2A), mRNA |
| NM_021030 | ZNF14 | 5.54 | Homo sapiens zinc finger protein 14 (KOX 6; ZNF14), mRNA |
| NM_003504 | CDC45L | 5.72 | Homo sapiens CDC45 cell division cycle 45-like (S. cerevisiae; CDC45L), mRNA |
| NM_006479 | RAD51AP1 | 5.82 | Homo sapiens RAD51 associated protein 1 (RAD51AP1), mRNA. |
| NM_005189 | CBX2 | 6.04 | Homo sapiens chromobox homolog 2 (Pc class homolog, Drosophila) (CBX2), transcript variant 1, mRNA |
| NM_021058 | HIST1H2BJ | 6.09 | Homo sapiens histone 1, H2bj (HIST1H2BJ), mRNA |
| NM_004091 | E2F2 | 6.19 | Homo sapiens E2F transcription factor 2 (E2F2), mRNA. |
| NM_018154 | ASF1B | 7.39 | Homo sapiens ASF1 anti-silencing function 1 homolog B (S. cerevisiae; ASF1B), mRNA |
| NM_003517 | HIST2H2AC | 7.92 | Homo sapiens histone 2, H2ac (HIST2H2AC), mRNA |
| NM_005441 | CHAF1B | 8.01 | Homo sapiens chromatin assembly factor 1, subunit B (p 60; CHAF1B), mRNA |
| NM_021170 | HES4 | 8.28 | Homo sapiens hairy and enhancer of split 4 (Drosophila; HES4), mRNA |
| NM_005319 | HIST1H1C | 8.63 | Homo sapiens histone 1, H1c (HIST1H1C), mRNA |
| NM_003516 | HIST2H2AA | 8.69 | Homo sapiens histone 2, H2aa (HIST2H2AA), mRNA |
| NM_005375 | MYB | 9.00 | Homo sapiens v-myb myeloblastosis viral oncogene homolog (avian; MYB), mRNA |
| NM_030928 | CDT1 | 9.49 | Homo sapiens DNA replication factor (CDT1), mRNA |
| NM_016817 | OAS2 | 10.30 | Homo sapiens 2’–5’-oligo adenylate synthetase 2, 69/71kDa (OAS2), transcript variant 1, mRNA |
| NM_001034 | RRM2 | 12.44 | Homo sapiens ribonucleotide reductase M2 polypeptid (RRM2), mRNA |
| NM_004789 | LHX2 | 27.55 | Homo sapiens LIM homeobox 2 (LHX2), mRNA |
| Transportation | |||
| NM_001856 | COL16A1 | −4.37 | Homo sapiens collagen, type XVI, alpha 1 (COL16A1), mRNA |
| NM_018477 | ACTR10 | −4.22 | Homo sapiens actin-related protein 10 homolog (S. cerevisiae) (ACTR10), mRNA |
| NM_000727 | CACNG1 | −4.13 | Homo sapiens calcium channel, voltage-dependent, gamma subunit 1 (CACNG1), mRNA |
| NM_006934 | SLC6A9 | −3.96 | Homo sapiens solute carrier family 6 (neurotransmitter transporter, glycine), member 9 (SLC6A 9) |
| NM_020351 | COL8A1 | −3.96 | Homo sapiens collagen, type VIII, alpha 1 (COL8A1), transcript variant 2, mRNA |
| NM_021244 | RRAGD | 6.65 | Homo sapiens Ras-related GTP binding D (RRA GD), mRNA |
| NM_000558 | HBA1 | 7.07 | Homo sapiens hemoglobin, alpha 1 (HBA 1), mRNA |
| NM_006688 | C1QL1 | 9.36 | Homo sapiens complement component 1, q subcomponent-like 1 (C1QL1), mRNA |
| Unknown genes | |||
| NM_199511 | URB | −3.77 | Homo sapiens steroid sensitive gene 1 (URB), transcript variant 1, mRNA |
Heat Map Analysis
The heat map generated from the DNA microarray data reflects gene expression values in HAdV-36 infected muscle cells in comparison with control muscle cells. The heat map analysis of 1,004 genes is illustrated in Figure 3. Green color indicates down-regulation and red indicates up-regulation of gene expression in the HAdV-36 infected muscle cells in comparison with control cells. Notably, as indicated by the arrows, KIAA119 was downregulated and HERC6 was upregulated. KIAA119 and hect domain and RLD 6 (HERC6) were down-regulated 11.90-fold and upregulated 7.89-fold in HAdV-36 infection when compared to control cells, respectively.
Figure 3.
Heat map illustrated all altered genes in HAdV-36 infected muscle cells. Dark color stands for up-regulated genes and light one means down-regulated genes in HAdV-36 infected muscle cells.
qPCR Verifications
In order to verify DNA microarray results, qPCR analyses were performed on 35 selected genes as shown in Table IV. Thirty-two of them (91.4%) were confirmed, but not IGFBP4, PEPN13, and LPR1. Linear regression analysis showed there was a significant correlation between the results of the microarray assay and the PCR assay in the selected 35 genes (r ¼ 0.8944, P < 0.001, Fig. 4).
TABLE IV.
qPCR Assay Verified Gene Alterations of Microarray in Human Skeletal Muscle Cells
| Pathway and gene | Microarray | qPCR | HAdV-36 vs. control | ||
|---|---|---|---|---|---|
| # | Immune response | Accession | Fold change | Mean ± SEM | P value |
| 1 | MX1 | NM_002462 | 44.35 | 44.4 ± 3.94 | 0.001 |
| 2 | IFIT3 | NM_001547 | 10.17 | 6.81 ± 0.21 | 0.001 |
| 3 | IFIT2 | NM_001549 | 10.16 | 17.92 ± 0.77 | 0.001 |
| 4 | G1P2 | NM_005101 | 10.09 | 13.39 ± 0.08 | 0.001 |
| DNA replication | |||||
| 5 | RRM2 | NM_001034 | 12.98 | 9.27 ± 0.15 | 0.001 |
| Transcriptional regulation | |||||
| 6 | E2F2 | NM_004091 | 6.19 | 5.36 ± 0.20 | 0.001 |
| 7 | HES4 | NM_021170 | 8.28 | 7.17 ± 0.16 | 0.001 |
| 8 | HIST2H2AA3 | NM_003516 | 8.69 | 4.73 ± 0.11 | 0.01 |
| 9 | CDT1 | NM_030928 | 9.68 | 9.48 ± 0.29 | 0.001 |
| 10 | MYB | NM_005375 | 9.55 | 4.6 ± 0.05 | 0.001 |
| Transportation | |||||
| 11 | RRAGD | NM_021244 | 6.65 | 14.1 ± 0.20 | 0.001 |
| 12 | FOXD2 | NM_004474.2 | 3.67 | 4.5 ± 0.04 | 0.001 |
| 13 | PPAP2B | NM_003713.3 | −3.87 | −2.51 ± 0.04 | 0.01 |
| 14 | SLC25A10 | NM_012140.3 | 4.93 | 5.82 ± 0.13 | 0.001 |
| Development | |||||
| 15 | CTGF | NM_001901 | −9.29 | −3.81 ± 0.11 | |
| 16 | ENO2 | NM_001975 | 7.7 | 9.31 ± 0.26 | 0.001 |
| 17 | HSPA2 | NM_021979 | 5.46 | 7.58 ± 0.38 | 0.001 |
| 18 | IGFBP4 | NM_001552 | −2.54 | 1.2 ± 0.03 | NS |
| 19 | ITGA11 | NM_012211 | −9.74 | −2.61 ± 0.01 | 0.01 |
| 20 | SERPINE1 | NM_000602 | −5.35 | −2.24 ± 0.02 | 0.05 |
| 21 | THBS2 | NM_003247 | −5.36 | −2.07 ± 0.04 | 0.05 |
| 22 | URB | NM_199511 | −3.73 | −2.43 ± 0.03 | 0.01 |
| Signal transduction | |||||
| 23 | GPR3 | NM_005281 | 3.58 | 5.31 ± 0.34 | 0.001 |
| 24 | PKN3 | NM_013355 | 3.93 | 7.56 ± .063 | 0.001 |
| 25 | RAB26 | NM_014353 | 3.15 | 3.25 ± 0.13 | 0.01 |
| 26 | ROR1 | NM_005012 | −3.21 | −3.29 ± 0.02 | 0.01 |
| 27 | WISP2 | NM_003881 | −3.66 | −3.4 ± 0.04 | 0.001 |
| 28 | RASSF7 | NM_003475 | 3.48 | 3.25 ± 0.07 | 0.01 |
| Protein metabolism | |||||
| 29 | PTPN13 | NM_080685 | −3.55 | −1.16 ± 0.09 | NS |
| 30 | PDZD4 | NM_032512 | 2.63 | 1.53 ± 0.11 | 0.05 |
| 31 | MAP3K14 | NM_003954 | 16.85 | 5.62 ± 0.23 | 0.001 |
| Lipid metabolism | |||||
| 32 | ACOT4 | NM_152331 | 3.33 | 9.56 ± 0.16 | 0.001 |
| 33 | LRP1 | NM_002332 | −2.51 | −1.6 ± 0.20 | NS |
| Angiogenesis | |||||
| 34 | ANGPT1 | NM_001146 | −2.83 | −4.51 ± 0.06 | 0.001 |
| Cell migration | |||||
| 35 | SLITL2 | NM_138440 | −5.93 | −3.1 ± 0.03 | 0.001 |
Figure 4.
The correlation between q-PCR and microarray results in HAdV-36 infected cells. Thirty five genes were chosen to run qPCR for verifying the results of microarray. Correlation of qPCR and microarray shows there is closely correlationship between qPCR and microarray assay in HAdV-36 infected muscle cells. [Color figure can be seen in the online version of this article, available at http://wileyonlinelibrary.com/journal/jmv]
Cellular Signaling Pathways in HAdV-36 Infected Muscle Cells
Cellular signaling pathway analysis showed HAdV-36 infection resulted in altered E2F, NFκB and minichromosome maintenance complex component 10 (MCM10) signaling pathways in the muscle cells (Fig. 5).
Figure 5.
The relationships between the cellular signal pathways in HAdV-36 infected human muscle cells. NFκB pathway, cross-talking between signaling, E2F and MCM pathways.
stands for indirect interaction, and 
is direct interaction between signaling pathways. Beneath each gene, up number is fold change and bottom number is P value. Dark user input molecule that is upregulated (a positive [+] expression value) and whose expression value meets the user defined cutoff. Light user input molecule that is downregulated (a negative [−] expression value) and whose expression value meets the user defined cut-off.
HAdV-36 Infection-Related Diseases
HAdV-36 infection altered associated network functions, molecular and cellular functions as well as physiological system development and function. Gene expression in HAdV-36 infected hSKM cells links to a number of disorders and diseases such as cancer, gastrointestinal disease, and genetic disorders (Table II). Among the total of 252 oncogenic genes, 115 genes were down-regulated and 137 genes were upregulated by HAdV-36.
DISCUSSION
Previous studies demonstrated that HAdV-36 infects human skeletal muscle cells and results in viral gene expression in muscle cells [Wang et al., 2008, 2010]. HAdV-36 infection causes alterations in the gene expression of multiple enzymes and transcription factors [Cummings and Relman, 2000; Vangipuram et al., 2007; Wang et al., 2008, 2010]. Non-adipogenetic human adenovirus 2 (HAdV-2) was not used as a negative control in this study, because an earlier study showed that only 76 genes (with significantly changed expression ratios at fold change ≥1.5) were identified in Ad-2 infected HeLa cells, suggesting HAdV-2 modulates a limited set of cellular gene expression [Zhao et al., 2003], and it also confirmed that Ad-2 did not alter cellular signaling pathways and gene expression in human mesenchymal stem cells [Wang et al., 2008, 2010; Na et al., 2012]. Another factor in our decision to not include HAdV-2 was the cost/efficiency consideration. This study showed that HAdV-36 profoundly affected gene expression in muscle cells; 1,004 genes met the criteria of fold change ≥1.5 with P value <0.05. It is not surprising that HAdV-36 induced significant changes in the expression of genes that mediate reprogramming of host cellular signaling pathways. This reprogramming allows for virus multiplication, and also results in host cell dysfunction.
HAdV-36 infection also caused up-regulation of the immune response in muscle cells. For example, it significantly up-regulated human myxovirus (influenza virus) resistance1(MX1) gene. MX1 is an interferon - induced GTP-binding protein [Haller et al., 2007]. MxA, the product of the human MX1 gene, inhibits a step of the virus replication cycle that follows primary transcription [Pavlovic et al., 1992]. In mice the interferon-inducible MX protein is responsible for a specific antiviral state against influenza virus infection. MxA protein is localized in the cytoplasm, whereas Mx1 protein accumulates in the nucleus. The protein encoded by the MX1 gene is similar to the mouse protein as determined by its antigenic relatedness, induction conditions, physicochemical properties, and amino acid analysis [Pavlovic et al., 1992]. It was observed that HAdV-36 upregulated MX1 gene expression 44-fold, a finding that was confirmed by qPCR analysis. It was reported that mice carrying a wildtype MX1 gene (MX1+/+) exhibit a greater resistance to infection with common laboratory strains of influenza A virus, when compared with standard laboratory mice (MX1−/−). MX1 also protects mice against the pandemic human 1918 influenza virus and a highly lethal human H5N1 strain from Vietnam. Resistance to H5N1 of MX1+/+, but not MX1−/− mice was enhanced if the animals were treated with a single dose of exogenous alpha interferon before infection [Tumpey et al., 2007]. Thus, HAdV-36 induced robust upregulation of MX1 in human muscle cells, supporting the notion that interferon-induced resistance factor MX1 represents a key component of the murine innate immune system that mediates protection against epidemic and pandemic influenza viruses [Lai et al., 2008]. HAdV-36 significantly upregulated interferon-induced protein with tetratricopeptide repeats 2, 3 (IFIT2, IFIT3), and G1P2 gene expression (fold changes were 10.17, 10.16, and 10.09, respectively). IFIT2 and IFIT3 are members of the IFIT family proteins and contain 6 TPR repeats. These are induced by interferons and significantly upregulated in reprogramming the peripheral blood of children during the acute phase of influenza [Schmeisser et al., 2010]. In mice, IFIT2 protein has been shown to interact with microtubules in vitro, co-localize with beta-tubulin in vivo, and become enriched in the mitotic spindle of nonneuronal cells undergoing mitosis. IFIT2 was also found to have an inverse correlation between IFIT2 expression and cell migration [Schmeisser et al., 2010].
The effects of HAdV-36 on DNA replication and transcript regulation in muscle cells were observed. Ribonucleotide reductase M2 (RRM2) subunit is one of two subunits that constitute ribonucleotide reductase, the enzyme that catalyzes the conversion of ribonucleotide 5′-diphosphates into 2′-deoxyribonucleotides, which are required for DNA synthesis. It has been reported that RRM2 is associated with gastric cancer [Morikawa et al., 2010]. siRNA-mediated RRM2 knockdown inhibits significantly proliferation of melanoma cell lines with different oncogenic mutations, with synergistic enhancement when in combination with temozolomide [Zuckerman et al., 2011]. To date, there is no evidence indicating HAdV-36 infection can result in cancer. However, this study showed HAdV-36 significantly increased RRM2 gene expression. Thus, the relationship between HAdV-36 infection and cancer needs to be further investigated. Interestingly, most of the genes involved in transcriptional regulation were upregulated in HAdV-36 infected muscle cells (80.2% of 91 genes at fold change ≥2.5). A qPCR assay verified that HAdV-36 significantly upregulated selected genes such as E2F2, hairy and enhancer of split 4 (HES4), histone cluster 2, H2aa3 (HIST2H2AA3), chromatin licensing and DNA replication factor 1 (CDT1), and v-myb myeloblastosis viral oncogene homolog (MYB) genes. E2F family transcription activator binds DNA cooperatively with DP proteins through the E2 recognition site, 5′-TTTC[CG]CGC-3′, found in the promoter region of a number of genes whose products are involved in cell cycle regulation or in DNA replication. The Homo sapiens transcription factor Dp-1 (DRTF1)/E2F complex functions in the control of cell-cycle progression from the G1 to S phase [Girling et al., 1993]. E2F-2 binds specifically to RB1 protein, in a cell-cycle dependent manner. For genomic integrity to be maintained, the cell cycle and DNA damage responses must be linked. CDT1 (upregulated over ninefold by HAdV-36), a G1-specific cell-cycle factor, is targeted for proteolysis by the Cul4-Ddb1(Cdt2) ubiquitin ligase following DNA damage [Roukos et al., 2011]. HAdV-36 significantly down regulated CTGF, IGFBP4, ITGA11, SERPINE1, THBS2 and steroid sensitive gene 1 (URB) in muscle cells, but increased gene expression of enolase2 (ENO2) and heat shock 70 kDa protein 2 (HSPA2).
Using microarray analysis, Na and coworkers [Na et al., 2012] recently reported that there was no difference in viral growth between HAdV-36 infection and Ad-2 infection in human mesenchymal stem cells (hMSCs) and demonstrated that HAdV-36 infection is associated more frequently with activation of peroxisomer proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α, 8.33-fold), Uncoupling protein 1 (UCP1, 116.88-fold), SORB1 and SH3 domain containing 1 (SORBS1, 19.58-fold), CCAAT/enhancer binding protein alpha (C/EBPa) and inflammatory pathways compared with Ad-2 infection [Bolstad et al., 2003; Na et al., 2012]. However, this study found PPAR γ (−1.78-fold, P < 0.01) and SORBS1 (−1.81, P < 0.01) were significantly downregulated, PGC-1α (1.64-fold, P < 0.05) and C/EBPα (4.18-fold, P < 0.001) were significantly upregulated, but UCP 3 was only slightly upregulated (1.37-fold, P ¼ NS) in HAdV-36 infection in comparison with control hSKM cells. These differences between studies may be due to different cell types (hMSCs cells vs. hSKM cells) and various time points of HAdV-36 infection (1–2 days vs. 6 days) [Bolstad et al., 2003; Na et al., 2012]. On the other hand, it showed that 252 oncologic genes were regulated by HAdV-36. Thus, it may be worth-while to further investigate if there is a potential risk of developing cancer in HAdV-36 infection conditions.
Cross-talk between signal transduction pathways in HAdV-36 infected muscle cells is also a possibility. Based on the Ingenuity pathway analysis, it was observed that HAdV-36 altered NFκB signaling which indirectly interacts with metallothionein 3 (MT3), mitogen-activated protein kinase kinase kinase kinase 2 (MAP4K2), solute carrier family 2 (facilitated glucose transporter), member 6 (SLC2A6), pentraxin 3 (PTX3), and WD40 domain repeat protein 34 (WDR34) [Gao et al., 2009]. NFκB also indirectly and directly upregulated expression of the target genes of the E2F family of transcription factors (E2F7 and E2F2). This in turn affected minichromosome maintenance signaling in the muscle cells [Wu et al., 2009; Kothandaraman et al., 2010] (Fig. 5). Recently, it was reported that MCM6 may become a target for identification of novel anticancer drugs [Zhang et al., 2010].
CONCLUSION
This study showed that HAdV-36 targets the genes involved in immune response, regulation of cell development, transcription, signaling transduction, as well as transport and protein metabolism. This viral infection upregulated the skeletal muscle cell antiviral defense response, and induced changes in the expression of genes that mediate the reprogramming of multiple cellular signaling pathways, allowing virus survival and multiplication as well as impairing host cell function. Since HAdV-36 infection altered many ontological genes, further investigation to evaluate the relationship between HAdV-36 infection and oncogenesis is warranted.
ACKNOWLEDGMENTS
We thank Dr. Nikhil Dhurandhar for kindly providing adenovirus 36. We also thank Mr. Russell Tipton (Pennington Biomedical Research Center) for the help of preparing this manuscript.
Grant sponsor: COBRE center; Grant number: (NIH P20-RR021945); Grant sponsor: NORC center; Grant number: (NIH 1P30-DK072476).
Abbreviations
- hSKM
human skeletal muscle
- PGC-1α
peroxisomer proliferator-activated receptor gamma coactivator 1-alpha
- UCP1
Uncoupling protein 1
Footnotes
The authors declare that they have no conflicts of interest.
Authorship: Z.Q.W. designed the study, Z.Q.W. wrote the manuscript. Y.Y. and X.H.Z. researched data. J.Q. performed statistic analysis for all data. E.F. reviewed manuscript. All authors read and approved the final version of the manuscript. Z.Q.W had primary responsibility for the final content.
REFERENCES
- Atkinson RL, Lee I, Shin HJ, He J. Human adenovirus- 36 antibody status is associated with obesity in children. Int J Pediatr Obes. 2010;5:157–160. doi: 10.3109/17477160903111789. [DOI] [PubMed] [Google Scholar]
- Bolstad BM, Irizarry RA, Astrand M, Speed TP. A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics. 2003;19:185–193. doi: 10.1093/bioinformatics/19.2.185. [DOI] [PubMed] [Google Scholar]
- Cummings CA, Relman DA. Using DNA microarrays to study host-microbe interactions. Emerg Infect Dis. 2000;6:513–525. doi: 10.3201/eid0605.000511. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dhurandhar NV, Israel BA, Kolesar JM, Mayhew GF, Cook ME, Atkinson RL. Increased adiposity in animals due to a human virus. Int J Obes Relat Metab Disord. 2000;24:989–996. doi: 10.1038/sj.ijo.0801319. [DOI] [PubMed] [Google Scholar]
- Dhurandhar NV, Israel BA, Kolesar JM, Mayhew G, Cook ME, Atkinson RL. Transmissibility of adenovirus-induced adiposity in a chicken model. Int J Obes Relat Metab Disord. 2001;25:990–996. doi: 10.1038/sj.ijo.0801668. [DOI] [PubMed] [Google Scholar]
- Dhurandhar NV, Whigham LD, Abbott DH, Schultz-Darken NJ, Israel BA, Bradley SM, Kemnitz JW, Allison DB, Atkinson RL. Human adenovirus Ad-36 promotes weight gain in male rhesus and marmoset monkeys. J Nutr. 2002;132:3155–3160. doi: 10.1093/jn/131.10.3155. [DOI] [PubMed] [Google Scholar]
- Eisen MB, Spellman PT, Brown PO, Botstein D. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci USA. 1998;95:14863–14868. doi: 10.1073/pnas.95.25.14863. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gabbert C, Donohue M, Arnold J, Schwimmer JB. Adenovirus 36 and obesity in children and adolescents. Pediatrics. 2010;126:721–726. doi: 10.1542/peds.2009-3362. [DOI] [PubMed] [Google Scholar]
- Gao D, Wang R, Li B, Yang Y, Zhai Z, Chen DY. WDR34 is a novel TAK1- associated suppressor of the IL-1R/TLR3/TLR4-induced NF-kappaB activation pathway. Cell Mol Life Sci. 2009;66:2573–2584. doi: 10.1007/s00018-009-0059-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Girling R, Partridge JF, Bandara LR, Burden N, Totty NF, Hsuan JJ, La Thangue NB. A new component of the transcription factor DRTF1/E2F. Nature. 1993;365:468. doi: 10.1038/365468d0. [DOI] [PubMed] [Google Scholar]
- Greenway F. Virus-induced obesity. Am J Physiol Regul Integr Compirat Physiol. 2006;290:R188–R189. doi: 10.1152/ajpregu.00607.2005. [DOI] [PubMed] [Google Scholar]
- Haller O, Staeheli P, Kochs G. Interferon-induced Mx proteins in antiviral host defense. Biochimie. 2007;89:812–818. doi: 10.1016/j.biochi.2007.04.015. [DOI] [PubMed] [Google Scholar]
- Kothandaraman N, Bajic VB, Brendan PN, Huak CY, Keow PB, Razvi K, Salto-Tellez M, Choolani M. E2F5 status significantly improves malignancy diagnosis of epithelial ovarian cancer. BMC Cancer. 2010;10:64. doi: 10.1186/1471-2407-10-64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lai KC, Chang KW, Liu CJ, Kao SY, Lee TC. IFN-induced protein with tetratricopeptide repeats 2 inhibits migration activity and increases survival of oral squamous cell carcinoma. Mol Cancer Res. 2008;6:1431–1439. doi: 10.1158/1541-7786.MCR-08-0141. [DOI] [PubMed] [Google Scholar]
- Maisonpierre PC, Suri C, Jones PF, Bartunkova S, Wiegand SJ, Radziejewski C, Compton D, McClain J, Aldrich TH, Papadopoulos N, Daly TJ, Davis S, Sato TN, Yancopoulos GD. Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis. Science. 1997;277:55–60. doi: 10.1126/science.277.5322.55. [DOI] [PubMed] [Google Scholar]
- Morikawa T, Hino R, Uozaki H, Maeda D, Ushiku T, Shinozaki A, Sakatani T, Fukayama M. Expression of ribonucleotide reductase M2 subunit in gastric cancer and effects of RRM2 inhibition in vitro. Hum Pathol J. 2010;41:1742–1748. doi: 10.1016/j.humpath.2010.06.001. [DOI] [PubMed] [Google Scholar]
- Na HN, Kim H, Nam JH. Novel genes and cellular pathways related to infection with adenovirus-36 as an obesity agent in human mesenchymal stem cells. Int J Obes. 2012;36:195–200. doi: 10.1038/ijo.2011.89. [DOI] [PubMed] [Google Scholar]
- Pasarica M, Shin AC, Yu M, Ou Yang HM, Rathod M, Jen KL, MohanKumar S, MohanKumar PS, Markward N, Dhurandhar NV. Human adenovirus 36 induces adiposity increases insulin sensitivity, and alters hypothalamic monoamines in rats. Obesity. 2006;14:1905–1913. doi: 10.1038/oby.2006.222. [DOI] [PubMed] [Google Scholar]
- Pasarica M, Loiler S, Dhurandhar NV. Acute effect of infection by adipogenic human adenovirus Ad36. Arch Virol. 2008;153:2097–2102. doi: 10.1007/s00705-008-0219-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pavlovic J, Haller O, Staeheli P. Human and mouse Mx proteins inhibit different steps of the influenza virus multiplication cycle. J Virol. 1992;66:2564–2569. doi: 10.1128/jvi.66.4.2564-2569.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rogers PM, Mashtalir N, Rathod MA, Dubuisson O, Wang Z, Dasuri K, Babin S, Gupta A, Markward N, Cefalu WT, Dhurandhar NV. Metabolically favorable remodeling of human adipose tissue by human adenovirus type 36. Diabetes. 2008;57:2321–2331. doi: 10.2337/db07-1311. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Roukos V, Kinkhabwala A, Colombelli J, Kotsantis P, Taraviras S, Nishitani H, Stelzer E, Bastiaens P, Lygerou Z. Dynamic recruitment of licensing factor Cdt1 to sites of DNA damage. J Cell Sci. 2011;124:422–434. doi: 10.1242/jcs.074229. [DOI] [PubMed] [Google Scholar]
- Schmeisser H, Mejido J, Balinsky CA, Morrow AN, Clark CR, Zhao T, Zoon KC. Identification of alpha interferon-induced genes associated with antiviral activity in Daudi cells and characterization of IFIT3 as a novel antiviral gene. J Virol. 2010;84:10671–10680. doi: 10.1128/JVI.00818-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Trovato GM, Castro A, Tonzuso A, Garozzo A, Martines GF, Pirri C, Trovato F, Catalano D. Human obesity relationship with Ad36 adenovirus and insulin resistance. Int J Obes. 2009;33:1402–1409. doi: 10.1038/ijo.2009.196. [DOI] [PubMed] [Google Scholar]
- Tumpey TM, Szretter KJ, Van Hoeven N, Katz JM, Kochs G, Haller O, Garcia-Sastre A, Staeheli P. The Mx1 gene protects mice against the pandemic 1918 and highly lethal human H5N1 influenza viruses. J Virol. 2007;81:10818–10821. doi: 10.1128/JVI.01116-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vangipuram SD, Sheele J, Atkinson RL, Holland TC, Dhurandhar NV. A human adenovirus enhances preadipocyte differentiation. Obes Res J. 2004;12:770–777. doi: 10.1038/oby.2004.93. [DOI] [PubMed] [Google Scholar]
- Vangipuram SD, Yu M, Tian J, Stanhope KL, Pasarica M, Havel PJ, Heydari AR, Dhurandhar NV. Adipogenic human adenovirus-36 reduces leptin expression and secretion and increases glucose uptake by fat cells. Int J Obes. 2007;31:87–96. doi: 10.1038/sj.ijo.0803366. [DOI] [PubMed] [Google Scholar]
- Wang ZQ, Cefalu WT, Zhang XH, Yu Y, Qin J, Son L, Rogers PM, Mashtalir N, Bordelon JR, Ye J, Dhurandhar NV. Human adenovirus type 36 enhances glucose uptake in diabetic and non-diabetic human skeletal muscle cells independent of insulin signaling. Diabetes. 2008;57:1805–1813. doi: 10.2337/db07-1313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang ZQ, Floyd ZE, Qin J, Liu X, Yu Y, Zhang XH, Wagner JD, Cefalu WT. Modulation of skeletal muscle insulin signaling with chronic caloric restriction in cynomolgus monkeys. Diabetes. 2009;58:1488–1498. doi: 10.2337/db08-0977. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang ZQ, Yu Y, Zhang XH, Floyd EZ, Cefalu WT. Human adenovirus 36 decreases fatty acid oxidation and increases de novo lipogenesis in primary cultured human skeletal muscle cells by promoting Cidec/FSP27 expression. Int J Obes. 2010;34:1355–1364. doi: 10.1038/ijo.2010.77. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu J, Peng L, McMahon GA, Lawrence DA, Fay WP. Recombinant plasminogen activator inhibitor-1 inhibits intimal hyperplasia. Arterioscler Thromb Vasc Biol. 2009;29:1565–1570. doi: 10.1161/ATVBAHA.109.189514. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang J, Yu L, Wu X, Zou L, Sou KK, Wei Z, Cheng X, Zhu G, Liang C. The interacting domains of hCdt1 and hMcm6 involved in the chromatin loading of the MCM complex in human cells. Cell Cycle. 2010;9:4848–4857. doi: 10.4161/cc.9.24.14136. [DOI] [PubMed] [Google Scholar]
- Zhao H, Granberg F, Elfineh L, Pettersson U, Svensson C. Strategic attack on host cell gene expression during adenovirus infection. J Virol. 2003;77:11006–11015. doi: 10.1128/JVI.77.20.11006-11015.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zuckerman JE, Hsueh T, Koya RC, Davis ME, Ribas A. siRNA knockdown of ribonucleotide reductase inhibits melanoma cell line proliferation alone or synergistically with temozolomide. J Invest Dermatol. 2011;131:453–460. doi: 10.1038/jid.2010.310. [DOI] [PubMed] [Google Scholar]