Abstract Abstract
Re-examination of the holotype of Burmoniscus kitadaitoensis Nunomura, 2009 from Kitadaitojima Island, southern Japan reveals that this species is a junior synonym of B. meeusei (Holthuis, 1947). Partial regions of mitochondrial COI, 12S and 16S rRNA genes, and nuclear 18S and 28S rRNA genes were detected for species identification in the future.
Keywords: Kitadaitojima Island, mitochondrial DNA, nuclear DNA, Philosciidae, terrestrial isopods
Introduction
Burmoniscus Collinge, 1914 can be dominant in terrestrial isopod communities in subtropical forests of East Asia (Ma et al. 1991). Therefore clarifying the taxonomic status of Burmoniscus species is important to understanding species diversity of isopod communities in these habitats. Thirteen species in the genus Burmoniscus were reported from Japan (Nunomura 2011), but their taxonomic status is still confused (Karasawa and Honda 2012).
Burmoniscus meeusei (Holthuis, 1947) was first described as Chaetophiloscia meeusei Holthuis, 1947, based on specimens found from a greenhouse at the Royal Botanic Gardens, Kew, United Kingdom. Later, Taiti and Ferrara (1991) found this species in Hawaii and transferred it to the genus Burmoniscus. Since then this species has been found in Taiwan and Brazil (Kwon and Jeon 1993; Araujo et al. 1996). Burmoniscus meeusei can be distinguished from congeneric species by a small lobe on the inner margin of the apical part of the male pleopod 1 endopodite, a triangular distal part on the male pleopod 1 exopodite, and the round apex of the pleotelson (see Holthuis 1947). Burmoniscus kitadaitoensis Nunomura, 2009 was described from specimens collected on Kitaditojima Island, southern Japan, where it was supposed to be endemic because it was never reported from other areas (Nunomura 2011). In the original description, Nunomura (2009) compared the morphological features of Burmoniscus kitadaitoensis to those of Burmoniscus okinawaensis (Nunomura, 1986) and Burmoniscus daitoensis (Nunomura, 1986), and he concluded that Burmoniscus kitadaitoensis was an undescribed species. The figures of Nunomura (2009), however, show that the male pleopod 1 exopodite of Burmoniscus kitadaitoesis has a similar shape to that of Burmoniscus meeusei (e.g., Holthuis 1947). However, the small lobe of the male pleopod 1 endopodite is not illustrated in the figures.
The aim of this study is to examine the holotype of Burmoniscus kitadaitoensis and clarify its taxonomic status. Moreover, partial sequences of the mitochondrial COI, 12S and 16S rRNA genes, and nuclear 18S and 28S rRNA genes are detected for DNA markers of species identification.
Materials and methods
Sample collection
The holotype of Burmoniscus kitadaitoensis was deposited in Toyama Science Museum (male, TOYA-Cr 14899). We examined the holotype, but the specimen was dissected and in bad condition. However, we were able to observe some parts as follows: male pleopod 1 endo- and exopodites, pleopod 2 endo- and exopodites, male pereiopods 1 and 7, genital papilla, epimera of pereionite 7, and pleotelson. Four specimens were also collected from Kitadaitojima Island (type locality) and Amamioshima Island and were used for measurements of the co-ordinate of the noduli laterales and molecular analysis. The voucher specimens are deposited in the collection of Kitakyushu Museum of Natural History and Human History (KMNH-IvR), Kitakyushu, Fukuoka Prefecture, Japan.
Morphology
The male pleopods 1 and 2, genital papilla, and male pereiopods 1 and 7 of the holotype, and the position of noduli laterales of specimens collected from Kitadaitojima Island were examined using a Nikon Eclipse E400 microscope (magnification of 40–400×). The epimera of pereionite 7 and pleotelson of the holotype were examined using an Olympus SZH-10 microscope (magnification of 7–64×). A color image was produced from multi-focused montage images using a digital microscope VHX-2000 (KEYENCE Corporation).
Molecular analysis
The partial sequences of mitochondrial cytochrome oxidase subunit I (COI), mitochondrial 12S and 16S ribosomal RNA (rRNA) genes, and nuclear 18S and 28S rRNA genes were determined for identifying this species in the future. DNA extraction and PCR amplification are described in Karasawa and Honda (2012). The primers and the accession numbers are shown in Tables 1 and 2, respectively.
Table 1.
PCR primers used in this study.
| Genes | Primer | Sequences (5' to 3') | Source |
|---|---|---|---|
| Forward | |||
| COI | LCO1490 | GGTCAACAAATCATAAAGATATTGG | Folmer et al. (1994) |
| 12S | 12Sai | AAACTAGGATTAGATACCCTATTAT | Palumbi (1996) |
| 16S | 16Sar-int-sf | GCCGCAGTATHCTRACTGTGCT | Parmakelis et al. (2008) |
| 18S | 18Sforward | TACCTGGTTGATCCTGCCAG | Maraun et al. (2009) |
| 28S | D3A | GACCCGTCTTGAAACACGGA | Litvaitis et al. (1994) |
| Reverse | |||
| COI | HCO2198 | TAAACTTCAGGGTGACCAAAAAATCA | Folmer et al. (1994) |
| 12S | 12Sbi | AAGAGCGACGGGCGATGTGT | Palumbi (1996) |
| 16S | 16Sbr | CCGGTCTGAACTCAGATCACGT | Klossa-Kilia et al. (2006) |
| 18S | 18S614r | TCCAAC TACGAGCTTTTTAACC | Maraun et al. (2009) |
| 28S | D3B | TCGGAAGGAACCAGCTACTA | Litvaitis et al. (1994) |
Table 2.
Locality, DDBJ accession numbers and voucher specimens of Burmoniscus meeusei.
| Locality | DDBJ sccession no. | Voucher specimens | ||||
|---|---|---|---|---|---|---|
| COI | 12S | 16S | 18S | 28S | ||
| Minami, Kitadaito Village, Kitadaitojima Island, Okinawa Prefecture, Japan | AB889795 | AB889798 | AB889801 | AB889804 | AB889807 | KMNH-IvR 500720 |
| Daitogu, Kitadaito Village, Kitadaitojima Island, Okinawa Prefecutre, Japan | AB889794 | AB889797 | AB889800 | AB889803 | AB889806 | KMNH-IvR 500722 |
| Yamato Village, Amamioshima Island, Kagoshima Prefecture, Japan | AB889796 | AB889799 | AB889802 | AB889805 | AB889808 | KMNH-IvR 500723 |
Results
Genus Burmoniscus Collinge, 1914
Burmoniscus meeusei
(Holthuis, 1947)
http://species-id.net/wiki/Burmoniscus_meeusei
Figure 1.
Burmoniscus kitadaitoensis, male, holotype, TOYA-Cr 14899. A, B Pleopod 1 endopodite C pleopod 1 exopodite D pleopod 2 endopodite E pleopod 2 exopodite F genital papilla. Scale bars: A, C–E 200 μm, B 50 μm.
Figure 2.
Burmoniscus kitadaitoensis, male, holotype, TOYA-Cr 14899. A Pereiopod 1 B pereiopod 7. Scale bar: 200 μm.
Figure 3.
Burmoniscus kitadaitoensis, male, holotype, TOYA-Cr 14899. A Left epimeron of pereonite 7 B telson. Scale bars: 300 μm.
Chaetophiloscia meeusei Holthuis, 1947: p.124–130, Figs 1–2.
Brumoniscus meeusei : Taiti and Ferrara 1991, p.212, Figs 7–8; Kwon and Jeon 1993, p.142–143, Fig. 7; Araujo et al. 1996, p.118–120, Figs 15–21.
Brumoniscus kitadaitoensis Nunomura, 2009, p.79–81, Fig. 3; Nunomura 2011, p.60. Syn. n.
Material examined.
Holotype of Burmoniscus kitadaitoensis, TOYA-Cr-14899, male, dissected, near Daitogu, Kitadaitojima Island, Okinawa Prefecture, Japan, 25th November 2006, Noboru Nunomura leg; non types, 2 male, KMNH-IvR 500720 and 500721, 25.9314°N, 131.3094°E, Minami, Kitadaito Village, Kitadaitojima Island, Okinawa Prefecture, Japan, 30th June 2012, Takeshi Goto leg.; non type, 1 male, KMNH-IvR 500722, 25.9444°N, 131.3021°E, Daitogu, Kitadaito Village, Kitadaitojima Island, Okinawa Prefecture, Japan, 30th June 2012, Takeshi Goto leg.; non type, 1 male, KMNH-IvR 500723, 28.3560°N, 129.3935°E, Yamato Village, Amamioshima Island, Kagoshima Prefecture, Japan, 12th September 2012, Shigenori Karasawa leg.
Remarks.
Burmoniscus meeusei is characterized by the male pleopod 1 endopodite slender and gradually narrowing to the apex (Fig. 1A) with a small lobe on the inner margin close to the apex (Fig. 1B); the male pleopod 1 exopodite with triangular posterior point bent outward and inner margin evenly convex (Fig. 1C); the male pleopod 2 endopodite slender (Fig. 1D) and exopodite trapezoidal (Fig. 1E); genital papilla elongated and simple (Fig. 1F); male pereiopods 1 and 7 without particular modifications (Fig. 2A, B); the pereonite 7 with postero-lateral corners at obtuse angle (Fig. 3A); and the apex of pleotelson broadly rounded (Fig. 3B).
On the holotype of Burmoniscus kitadaitoensis, a small lobe was found on the inner margin of the male pleopod 1 endopodite, although this character was not shown in the original description (Fig. 3P in Nunomura 2009). Moreover, the other morphological characters including the co-ordinate of the noduli laterales (Fig. 4) are consistent with those of Burmoniscus meeusei (see Figs 1 and 2 in Holthuis 1947; Figs 7 and 8 in Taiti and Ferrara 1991; Fig. 7 in Kwon and Jeon 1993; Figs 15–21 in Araujo et al. 1996). Thus the present study considers Burmoniscus kitadaitoensis as a junior synonym of Burmoniscus meeusei.
Figure 4.

Burmoniscus meeusei, male, collected from Kitadaitojima Island, Japan. A Dorsal view of body, left antenna 2 broken, KMNH-IvR 500720 B co-ordinate of noduli laterales (b/c), KMNH-IvR 500721 C co-ordinate of noduli laterales (d/c), KMNH-IvR 500721. Scale bar: 1 mm.
Distribution.
Burmoniscus meeusei was previously reported from the United Kingdom (greenhouses), Hawaii, Brazil, Taiwan (Schmalfuss 2004) and Japan. In Japan this species has been collected from Kitadaitojima Island only (Nunomura 2009, 2011), but the present study found the species on Amamioshima Island, which is about 300 km from Kitadaitojima Island.
DNA sequences.
The COI, 12S rRNA, 16S rRNA, 18S rRNA and 28S rRNA alignments comprised 653, 354, 453, 675 and 635 bp, respectively. With the exception of the 12S rRNA gene, there is no difference in the four genes among the specimens collected from Kitadaitojima and Amamioshima Islands. Only one 12S rRNA gene base varied between the specimens collected from the two islands.
Supplementary Material
Acknowledgements
We thank Dr. Hisashi Negoro (Toyama Science Museum) and Mr. Noboru Nunomura (Kanazawa University, Institute of Nature and Environmental Technology) for loaning the holotype of Burmoniscus kitadaitoensis.
Citation
Karasawa S, Goto K (2014) Burmoniscus kitadaitoensis Nunomura, 2009 (Crustacea, Isopoda, Oniscidea) from southern Japan, a junior synonym of B. meeusei (Holthuis, 1947). ZooKeys 386: 21–28. doi: 10.3897/zookeys.386.6727
References
- Araujo PB, Buckup L, Bond-Buckup G. (1996) Isópodos terrestres (Crustacea, Oniscidea) de Santa Catarina e Rio Grande do Sul, Brazil. Iheringia, Série Zoologia, Porto Alegre: 81: 111-138. [Google Scholar]
- Folmer O, Black M, Hoeh W, Lutz R, Vrigenhoek R. (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294-299. [PubMed] [Google Scholar]
- Holthuis LB. (1947) On a small collction of isopod crustacea from the greenhouses of the Royal Botanic Garden, Kew. Annals and Magazine of Natural History 13: 122-137. [Google Scholar]
- Karasawa S, Honda M. (2012) Taxonomic study of the Burmoniscus ocellatus complex (Crustacea, Isopoda, Oniscidea) in Japan shows genetic diversification in the southern Ryukyus, southwestern Japan. Zoological Science 29: 527-537. doi: 10.2108/zsj.29.527 [DOI] [PubMed] [Google Scholar]
- Klossa-Kilia E, Kilias G, Tryfonopoulos G, Koukou K, Sfenthourakis S, Parmakelis A. (2006) Molecular phylogeny of the Greek populations of the genus Ligidium (Isopoda, Oniscidea) using three mtDNA gene segments. Zoologica Scripta 35: 459-472. doi: 10.1111/j.1463-6409.2006.00243.x [DOI] [Google Scholar]
- Kwon CH, Jeon DS. (1993) Philosciidae (Crustacea, Isopoda, Oniscidea) from Taiwan. Journal of Taiwan Museum 46: 131-158. [Google Scholar]
- Litvaitis MK, Nunn G, Thomas WK, Kocher TD. (1994) A molecular approach for the identification of meiofaunal turbellarians (Platyhelminthes, Tubellaria). Marine Biology 120: 437-442. doi: 10.1007/BF00680218 [DOI] [Google Scholar]
- Ma HHT, Dudgeon D, Lam PKS. (1991) Seasonal changes in populations of three sympatric isopods in a Hong Kong forest. Journal of Zoology 224: 347-365. [Google Scholar]
- Maraun M, Erdmann G, Schulz G, Norton RA, Scheu S, Domes K. (2009) Multiple convergent evolution of arboreal life in oribatid mites indicates the primacy of ecology. Proceedings of the Royal Society B: Biological Sciences 276: 3219-3227. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nunomura N. (2009) Terrestrial isopod crustaceans from Daito Islands, Southern Japan. Bulletin of the Toyama Science Museum 32: 75-87. doi: 10.1098/rspb.2009.0425 [DOI] [Google Scholar]
- Nunomura N. (2011) Crustaceans No.2 (Isopoda). Special Publication of the Toyama Science Museum 24: 1-133. [in Japanese] [Google Scholar]
- Palumbi SR. (1996) Nucleic Acids II: The Polymerase Chain Reaction. In: Hillis DM, Moritz C, Mable BK. (Eds) Molecular Systematics. Sinauer Associates, Inc., Massachusetts, 205-247. [Google Scholar]
- Parmakelis A, Klossa-Kilia E, Kilias G, Triantis KA, Sfenthourakis S. (2008) Increased molecular divergence of two endemic Trachelipus (Isopoda, Oniscidea) species from Greece reveals patterns not congruent with current taxonomy. Biological Journal of the Linnean Society 95: 361-370. doi: 10.1111/j.1095-8312.2008.01054.x [DOI] [Google Scholar]
- Schmalfuss H. (2004) World Catalog of Terrestrial Isopods (Isopoda, Oniscidea). http://www.oniscidea-catalog.naturkundemuseum-bw.de/Cat_terr_isop.pdf
- Taiti S, Ferrara F. (1991) Terrestrial isopods (Crustacea) from the Hawaiian Islands. Bishop Museum Occasional Papers 31: 202-227. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.



