Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Jul 1.
Published in final edited form as: Int J Cancer. 2013 Feb 12;133(1):120–129. doi: 10.1002/ijc.28015

Radiation-induced loss of cell surface CD47 enhances immune-mediated clearance of HPV+ cancer

Daniel W Vermeer 1, William C Spanos 1,2, Paola D Vermeer 1, Annie M Bruns 3, Kimberly M Lee 1, John H Lee 1,2,+
PMCID: PMC3972896  NIHMSID: NIHMS435316  PMID: 23292955

Abstract

The increasing incidence of human papillomavirus (HPV) related oropharyngeal squamous cell carcinoma (OSSC) demands development of novel therapies. Despite presenting at a more advanced stage, HPV(+) OSCC’s have a better prognosis than their HPV(−) counterparts. We have previously demonstrated that clearance of HPV(+) OSCC during treatment with radiation and chemotherapy requires an immune response which is likely responsible for the improved clinical outcomes. To further elucidate the mechanism of immune-mediated clearance, we asked whether radiation therapy induces tumor cell changes that allow the body to recognize and aid in tumor clearance. Here, we describe a radiation-induced change in tumor surface protein expression that is critical for immune-mediated clearance. Radiation therapy decreases surface expression of CD47, a self marker. CD47 is frequently over-expressed in HNSCC and radiation induces a decrease of CD47 in a dose dependent manner. We show both in vitro and in vivo that tumor cell CD47 protein levels are restored over time following sub-lethal radiation exposure and that protein levels on adjacent, normal tissues remain unaffected. Furthermore, reduction of tumor cell CD47 increases phagocytosis of these cells by dendritic cells and leads to increased IFNγ and granzyme production from mixed lymphocytes. Finally, decreasing tumor cell CD47 in combination with standard radiation and chemotherapy results in improved immune-mediated tumor clearance in vivo. These findings help define an important mechanism of radiation related immune clearance and suggest that decreasing CD47 specifically on tumor cells may be a good therapeutic target for HPV related disease.

Keywords: HPV, CD47, radiation, immune, HNSCC, OSCC

Introduction

Head and neck squamous cell carcinoma (HNSCC) develops in the oral cavity, oropharynx, larynx or hypopharynx. The most critical risk factors for developing HNSCC are alcohol consumption and tobacco use. However, twenty-five percent of HNSCC’s are not associated with these factors but rather are caused by infection with high-risk human papillomavirus (HPV). In the oropharynx, HPV positive (HPV(+)) oropharyngeal squamous cell carcinoma (OSCC) patients present with more advanced disease, yet, despite this have a better prognosis than their HPV negative (HPV(−)) counterparts. In fact, HPV status is used as a prognosticator of response to therapy and survival.1 HPV(+) and (−) OSCCs are recognized as distinct disease entities. While the incidence of HPV(−) OSCCs is declining, likely a result of increased public awareness regarding smoking and drinking, the incidence of HPV(+) cancers is on the rise.2–4 Although HPV(+) tumors respond better to treatment, the long term effects of therapy severely decrease quality of life. The increased prevalence of HPV(+) OSCC and its associated long-term treatment related morbidity emphasize a need to better understand the molecular mechanisms leading to tumor clearance and to develop new therapies.

Radiation is commonly part of the multi-disciplinary treatment for OSCC. Radiation therapy has multiple recognized molecular mechanisms that induce overwhelming cellular injury and cell killing.5–7 However, several recent studies suggest that for certain tumors the success of radiation therapy depends on an immune-mediated response against the tumor 8–10. This response synergizes with radiation-induced cellular toxicity, mediating tumor clearance. We have recently shown that clearance of HPV(+) head and neck cancer during standard radiation therapy is aided by an immune response 11 and is dependent on an intact CD4+ and CD8+ cellular response.12 Specifically, we have demonstrated that while HPV(+) mouse tonsil epithelial cell (MTEC) tumors in C57Bl/6 mice can be cleared with radiation treatment, these same tumors grow unabated in Rag1 mice despite radiation therapy. These studies demonstrate that the success of standard radiation therapy requires an intact immune system. Furthermore, studies in other cancers show that chemotherapeutics such as oxiplatin and cisplatin induce changes in expression of cell surface proteins, termed alarmins, whose appearance on the cell surface elicits immune activation.13, 14 Further defining the molecular mechanisms of radiation/immune synergy may identify novel targets for therapeutic intervention and improve survival for OSCC patients.

In the context of cancer, immune surveillance cells can often identify and target tumor cells for destruction.15, 16 Emergence and persistence of tumor growth may therefore be a reflection of a deteriorated immune response, or alternatively is related to tumor cell changes that permit evasion from immune surveillance.17, 18 Tumor immune evasion occurs through multiple mechanisms such as loss of MHC class I molecules on the cell surface or increasing expression of immune inhibitory molecules.19–22 Standard therapies may alter these immune evasion mechanisms and contribute to activation of an immune response.23 The present study supports this hypothesis. We show that alteration of a tumor cell signaling molecule improves immune-mediated tumor killing.

While radiation likely alters many components of the tumor microenvironment, we focused on the tumor cell surface because of its direct interaction with antigen presenting cells. We hypothesized that radiation-mediated tumor cell surface changes would lead to enhanced immune dependent tumor clearance. As an initial test, cell surface proteins on HPV(+) mouse OSCC cells were analyzed following radiation treatment using a surface biotinylation approach. The most significant change in cell surface protein expression in this analysis was associated with CD47 (also known as Integrin Associated Protein and OA3). CD47 is a transmembrane protein expressed on the surface of epithelial cells and is a marker of self.24, 25 CD47 binding to integrins in cis augments integrin functions.26 In addition, trans binding of CD47 to SIRP-alpha, expressed on antigen presenting cells, enforces tolerance.25, 27, 28 Thus, CD47 functions in epithelial attachment and immune modulation. Interestingly, gene expression array analysis demonstrates that CD47 message is up-regulated in OSCC,29 and more recently has been shown to be an independent prognosticator of esophageal squamous cell carcinoma.30 This study examines CD47 protein expression during radiation therapy of OSCC both in vitro and in vivo and demonstrates that CD47 surface expression is transiently lost during radiation treatment. To further understand the physiologic significance of CD47 loss and its potential role in tumor immune surveillance, CD47 was stably knocked-down and its impact on immune activation, phagocytosis, and tumor response to treatment analyzed in vivo. The findings suggest that CD47 cell surface expression plays an important role in immune-related HPV(+) tumor clearance during radiation. The results from this study have implications not only for the treatment of HPV related cancers, but may also impact other antigenic solid tumors.

Materials and Methods

Cell Culture

Normal mouse tonsil epithelial cells (MTEC) from male C57Bl/6 mice were harvested. Human tonsil epithelial cells (HTEC) were harvested from tonsillectomies performed for non-cancerous reasons and collected under institutional IRB approval with written consent at the University of Iowa.31 Stable lines of MTEC expressing HPV16 E6, E7 and hRas (HPV(+) MTEC) and HTEC expressing HPV16 E6 and E7 (HPV(+) HTEC) were generated as previously described 31, 32 and maintained in E-media.32, 33 HPV(+) MTEC cells serve as an HPV(+) HNSCC mouse model for in vitro and in vivo studies. The RAWS macrophage cell line (ATTC), HPV(+) human HNSCC line (UMSCC-47) isolated from lateral tongue, and HPV(−) human HNSCC lines (UMSCC-1,-19,-84) floor of mouth, base of tongue and unknown location respectively, were maintained in DMEM with 10% FCS and 1% penicillin-streptomycin. UM-SCC cell lines were a kind gift from Dr. Douglas Trask (University of Iowa). The UM-SCC human cell lines were originally generated at the University of Michigan by the Head and Neck SPORE Translational Research group and have previously been genotyped.34 In addition, we have authenticated these cell lines by short tandem repeat (STR) DNA profiling and verified them with the reference STR profile. Primary HTEC and HPV(+) HTEC cells were similarly authenticated. Bone-marrow derived dendritic cells (BMDC) were isolated as previously described 35 and maintained in IMDM with 10% heat inactivated FCS, 1% penicillin-streptomycin, 0.5mM BME, 1mM sodium pyruvate and 5ng/mL mGMCSF (R&D Systems, Minneapolis, MN).

Mice

Male C57Bl/6 mice or C57Bl/6 Rag 1 mice (The Jackson Laboratory, Bar Harbor, Maine) were maintained at the Sanford Research Laboratory Animal Research Facility (LARF) in accordance with USDA guidelines. All experiments were approved by the Sanford Research IACUC and performed within institutional guidelines. Briefly, using a 23-gauge needle CD47 knockdown HPV(+) MTEC cells, or non-silencing control cells, were implanted subcutaneously in the right hind flank of mice (n=10/group for each experiment). Ten to fourteen days after tumor implantation mice were anesthetized with 87.5mg/kg ketamine and 12.5mg/kg xylazine, and the hind limb treated locally with 8Gy X-ray radiation weekly for three weeks (RS2000 irradiator, RadSource Technologies, Inc. Suwanee, GA). Cisplatin (CalBiochem, San Diego, CA) was dissolved in bacteriostatic 0.9% sodium chloride (Hospira Inc., Lake Forest, IL) at 20mg/m2 and administered intraperitoneally concurrent with radiation therapy. Tumor growth was measured using previously established techniques.32 Animals were euthanized when tumor size was greater than 1.5 cm in any dimension. Mice were considered tumor free when no measurable tumor was detected for a consecutive period of two months. Survival graphs were calculated by standardizing each mouse to an endpoint tumor volume of 2000mm3. Statistical analysis for the survival graphs was performed using the log-rank test.

Microscopy

All human OSCC patient samples were obtained under written consent and approved by Sanford IRB protocol “Improving the Understanding and Treatment of Head and Neck Cancer.” Paraffin embedded blocks were sectioned and stained using standard immunohistochemical techniques. Human CD47 was localized with the mAb B6H12 (sc-12730, Santa Cruz Biotechnology, Santa Cruz, CA). The anti-CD47 pAB H-100 (sc-25773, Santa Cruz Biotechnology) was used for fluorescence staining of mouse tissue and cells (1:100). For in vitro surface staining, cells were seeded on collagen-coated 8 well chamber-slides, placed on ice and anti-CD47 antibody bound; after PBS washes, cells were fixed with 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA), washed, incubated with Alexa Fluor-conjugated secondary antibody (Invitrogen, Carlsbad, CA), washed, and coverslips mounted with Vectashield mounting medium plus DaPi (Vector Labs, Burlingame, CA). Cells were analyzed by confocal microscopy (Olympus FluoView1000). For in vivo staining of mouse tumors, mice were euthanized and tumors with surrounding tissue dissected and flash frozen in TFM (Triangle Biomedical Sciences, Inc., Durham, NC) using a liquid nitrogen 2-methylbutane bath. Sections (7µm) were cut from fresh frozen blocks. For fluorescence microscopy, samples were analyzed on an (Olympus DP71) fluorescent microscope and images quantified with Image J.

Radiation and CD47 Expression

To assess CD47 expression, cells were grown to 40% confluency and treated with the indicated dose of X-ray radiation (RadSource) or cisplatin (CalBiochem). For all biochemical experiments, cells were harvested in 0.5 % Tx-100 (Pierce, Rockford, IL), 17.4µg/mL paramethylsulfonylfluoride, and 1X HALT with EDTA (Pierce). Lysates were spun at 10,000 RPM for 15 min at 4°C. Tx100 soluble cell lysates (40µg /lane) were separated by SDS PAGE and analyzed by western blot with the following antibodies: mCD47 (AF1886, R&D Systems), hCD47 clone B6H12 (sc-12730, Santa Cruz Biotechnology), and GAPDH (Ambion, Austin, TX).

Biotinylation Experiments

Irradiated HPV(+) MTEC cells were biotinylated with NHS biotin (Pierce) on ice as per manufacturer’s instructions. Following cell lysis, 150µg Tx-100 soluble lysate was incubated with neutravidin agarose beads (Pierce) for 2 hrs at 4°C and washed before loading on SDS PAGE gels. Lysate that did not bind neutravidin beads, unbiotinylated proteins, represents the intracellular protein fraction.

Interferon gamma Assay

Lymphocytes were isolated from the draining node of C57Bl/6 mice bearing HPV(+) MTEC tumors and red blood cells (RBC) lysed with ACK buffer.36 Lymphocytes were seeded on top of non-silencing control, CD47 knock-down, or irradiated control cells and IFN-gamma measured 36 hrs later using the R&D Quantikine immunoassay (R&D Systems).

ELISpot: Mouse Granzyme B Assay

Naïve mice were vaccinated with either Ad5 E6/E7 or Ad5 null virus and boosted 7 days post vaccination with the appropriate vaccine as previously described.37 Splenocytes were harvested on day 14 and following incubation with the indicated cells for 4 hrs, granzyme release was assessed from 5×105 splenocytes using ELISpot Mouse Granzyme B kit (R&D Systems), methods were followed as per manufacturer’s instructions.

Cell Viability and Growth

Cells were seeded at 2×104 cells per well in a 12 well plate. After 24 hrs, floating and adherent cells were harvested for baseline cell counts, duplicate wells were irradiated with 30Gy, or left untreated. Following additional 24 hr incubation, floating and adherent cells from both the radiated and untreated conditions were harvested. All counts were performed using Countess Cell Counter (Invitrogen) and viability was assessed by trypan blue exclusion. Fold increase in cells was calculated by dividing the number of live cells 24 hrs after radiation by the baseline number of live cells present at the time of radiation treatment.

Phagocytosis Assay

HPV(+) MTEC cells were seeded at 1×105 cells per 150mm dish and fluorescently labeled with 5µM CFSE (Invitrogen) 12 hrs before scraping cells off the dish and coculturing with 1×106 BMDC’s for 18 hrs. This low seeding density ensured single cells were plated. For the antibody blocking experiments, HPV(+) MTEC cells were combined with either 7µg/mL anti-CD47 mAb clone MIAP301 (sc-12731, Santa Cruz Biotechnology) or an equal amount of non-specific isotype control for 20 min in suspension before incubation with 1×106 BMDC cells for 18 hrs. Cells with intracellular CFSE were analyzed by fluorescence microscopy (Olympus DP71) as well as by FACS analysis (Accuri C6 cytometer).

Generation of Stable shCD47 Cell Lines

CD47 short hairpin RNA (shRNA) constructs were generated by duplex synthesis (IDT, Coralville, IA), digested with BamHI and XhoI, gel purified and ligated into pCDNA3.1 Zeocin (Invitrogen). shCD47 sequences were the following: AATGACACTGTGGTCATCCCTTGTAGTGAAGCCACAGATGTACAAGGGATGACCACAGTGTCATT. The non-silencing short hairpin RNA TCTCGCTTGGGCGAGAGTAAGTAGTGAAGCCACAGATGTACTTACTCTCGCCCAAGCGAGAG (Control) was purchased from Open Biosystems, (ThermoScientific, Rockford, IL) and cloned into the pCDNA3.1 Zeocin vector. Stable HPV(+) MTEC cell lines were generated via random integration following plasmid transfection using Polyfect Transfection Reagent as per manufacturer’s directions (Qiagen, Valencia, CA) and selection with Zeocin.

Statistics

Data shown as mean +/− standard deviation (SD). P values were calculated by students T test. Kaplan Meyer log rank survival calculated in Sigma Plot for all in vivo survival graphs.

Results

Cell surface changes during cisplatin and radiation therapy: CD47 and other reported alarmins

To better understand the cell surface changes that occur during radiation and cisplatin treatment we used a biotinylation approach as an initial screening technique to identify expression of surface alarmins following treatment with radiation alone, cisplatin alone, or these two agents in combination. Increases in immune-enhancing alarmins or decreases in immune-attenuating molecules were analyzed in previously characterized HPV(+) and HPV(−) MTEC cells. The cytoplasmic protein, GAPDH, served as a control for intracellular leakage of biotinylation reagent and the surface expressed transmembrane protein, EphrinB1, demonstrates equal loading in the biotinylated fraction. SDS PAGE of the nonprecipitated (unbiotinylated) fraction assessed intracellular levels of proteins. Both heat shock protein-90 and protein disulfide isomerase (PDI), previously postulated to move from the ER to the plasma membrane following cellular injury,38, 39 failed to demonstrate surface expression. However, both proteins were present in intracellular, unbiotinylated lysates suggesting that their translocation to the cell surface is not induced by radiation, cisplatin, or their combination in these cells (Fig. 1A). Calreticulin, another ER protein reported to translocate to the cell surface in response to anthracyclines,40, 41 was evident on the surface following irradiation alone and combined cisplatin and radiation treatment (Fig. 1A). Interestingly, the most significant change in surface protein expression was in an immune attenuating marker, CD47. The HPV(+) and HPV(−) murine OSCC cell lines demonstrate a notable decrease in CD47 surface expression following radiation with a smaller decrease in the cisplatin condition (Fig. 1A). Robust CD47 signal in biotinylated samples with almost undetectable intracellular, non-biotinylated, CD47 suggests that the majority of CD47 is expressed at the cell surface in these cells. Since the greatest decrease in CD47 expression occurs with radiation treatment, we further examined this effect using human OSCC cell lines. Importantly, both HPV(+) (SCC47) and HPV(−) (SCC1, 19 and 84) human cell lines demonstrate a slight reduction in CD47 expression following radiation suggesting the phenomenon is not restricted to murine cells but occurs in their human counterparts as well (Fig. 1B). Together, these data suggest that radiation induces a decrease in surface expression of CD47 in OSCC which is irrespective of HPV status.

Figure 1.

Figure 1

Open in a new tab

CD47 expression following radiation treatment in mouse and human cell lines. (A) HPV(+) and HPV(−) MTEC’s were treated with cisplatin, radiation, or combined cisplatin/radiation therapy. Biotinylated (surface) or non-biotinylated (intracellular) lysates were analyzed by western blot for the indicated proteins: heat shock protein 90 (HSP-90), protein disulphide isomerase (PDI), calreticulin, CD47 and GAPDH. EphrinB1 was probed as a loading control for biotinylated surface protein. (B) CD47 expression before and 24 hrs after 30Gy radiation in the HPV(+) human cell line (SCC47) and HPV(−) human cell lines (SCC84, SCC1, SCC19). (C) Immunohistochemical staining of HPV(+) and HPV(−) human tumor samples compared to normal human tonsil shown at 4X and 40X magnification. Scale bar for 4X magnification, 50 µm; for 40X magnification, 20 µm.

To determine CD47’s relevance in the clinical setting, we obtained paraffin-embedded OSCC clinical samples and stained for CD47 expression. CD47 staining in normal tonsil epithelium was differentiation dependent and evident predominantly in the suprabasal layer. HPV(+) and HPV(−) tumors showed very high expression in all tumor cells relative to adjacent normal tissue (Fig. 1C). These findings suggest that OSCC tumors increase expression of CD47 irrespective of HPV status.

Radiation-induced decrease in CD47 is time and dose dependent and occurs in vitro and in an in vivo HPV(+) OSCC mouse model

To further characterize radiation-induced CD47 decrease, we analyzed the dose and time dependency of CD47 loss in HPV(+) versus non-transformed primary oropharyngeal control cell lines. Comparison of both murine and human HPV(+) cell lines was performed to determine similarities and/or differences between species and the potential usefulness of the murine cells as an in vivo model. A radiation dose dependent decrease in CD47 expression was evident in mouse and human HPV(+) cells with protein loss occurring at doses as low as 2Gy and increasing with escalating radiation doses up to 40Gy (Fig. 2A). Less dramatic, but consistent, reduction in CD47 protein occurs following cisplatin treatment at doses ranging from 0.5µg/mL to 8µg/mL (Fig. S1). A time course of CD47 expression after a single radiation dose of 30 Gy in both mouse and human cells is shown in Fig. 2B. Reduction of CD47 protein in the HPV(+) cells begins approximately 12 hrs after irradiation and persists until three days post-radiation being slightly less pronounced in the human cells. Conversely, the decrease in CD47 expression is not seen in the control primary mouse and human oropharyngeal epithelial cells. Supplemental data (Fig. S2A and S2B) demonstrate that this dose of radiation allows for continued cellular growth and division, albeit at a slower rate than non-treated controls. Moreover, at this dose, radiation does not result in cellular membrane disruption as measured by trypan blue exclusion. These data suggest that cell death does not account for the decrease in CD47.

Figure 2.

Figure 2

Open in a new tab

Radiation dose response and time dependent expression of CD47 in vitro and in vivo. (A) HPV(+) MTEC and HPV(+) HTEC cells were treated with increasing doses of radiation and total CD47 protein expression analyzed by western blot. (B) Time course of CD47 expression following 30Gy radiation in mouse empty vector control (MTE LXSN) and human primary tonsil epithelial cells (Human Control) compared to the corresponding HPV(+) MTEC and HPV(+) HTEC stable lines. Time following radiation is shown in hours above each lane on the western blot. (C) En face, stacked Z-series of CD47 staining on HPV(+) HTEC and HPV(+) MTEC cells 24 hrs following 20Gy radiation (or untreated control). Nuclei counterstained with DaPi. Scale bar, 20 µm. (D) Graphical representation of CD47 fluorescence decrease for HPV(+) HTEC and HPV(+) MTEC cells respectively. (E) En face fluorescence images demonstrating in vivo CD47 expression at the indicated times following 20 Gy radiation of HPV(+) MTEC tumors (4X magnification). The white line delineates the boundary between tumor (upper left) and surrounding normal tissue (lower right). All fluorescent images were taken under the same intensity and capture settings. Scale bar, 20µm. (F) Graphical representation of in vivo mouse tumor CD47 at 24 hrs, 48 hrs, and 5 days post radiation time points compared to control.

We attempted to verify that the CD47 change occurred at the membrane using flow cytometry. However, attempts to enzymatically or non-enzymatically remove these adherent cells altered CD47 surface expression preventing the use of flow cytometric analysis. Therefore, we re-verified the radiation mediated change in protein level by confocal microscopy. Figure 2C shows decreases in CD47 protein levels for both HTEC and MTEC HPV(+) cell lines which were significantly reduced compared to untreated cells when quantified (Fig. 2D).

To determine whether CD47 decreases in response to radiation in vivo, HPV(+) MTEC tumors were established in mice, irradiated with a single dose of 20Gy, harvested and analyzed for CD47 expression at sequential time points post-radiation (Fig. 2E). A significant reduction in CD47 expression in vivo paralleled the in vitro results with the largest decrease evident at 24–48 hrs post-radiation and subsequent partial return of protein at later time points (Fig. 2F). Interestingly, and similar to the in vitro control cell lines, the surrounding normal tissue within the radiation field fails to demonstrate a reduction in CD47 expression (Fig. 2B and 2E).

Stable CD47 protein knockdown increases epithelial tumor cell phagocytosis by BMDC’s

CD47 serves as ligand for the transmembrane protein SIRPα. SIRPα expressed on macrophages interacts with CD47 on adjacent cells and this interaction regulates a cell-cell communication system that mediates phagocytosis.42 Previous work has shown that blocking the interaction of leukemic cell CD47 and SIRPα on macrophages increases phagocytosis of the cancer cells.43 Because SIRPα is expressed primarily on cells of monocytic lineage, we asked if the loss of surface CD47 would enhance tumor cell phagocytosis by other antigen presenting cells associated with solid tumors such as dendritic cells. We generated non-silencing HPV(+) MTEC (control) and HPV(+) MTEC cells stably depleted of CD47 (shCD47) (Fig. S3). Following CFSE labeling of shCD47 MTEC cells and subsequent co-culture with murine bone marrow derived dendritic cells (BMDC’s), phagocytosis of MTEC’s was examined by fluorescence microscopy as well as flow cytometry. Fig. 3A shows MHCII positive BMDCs have an 11% increase in phagocytosis of shCD47 MTEC’s versus control. Additionally, a blocking antibody (MIAP) that disrupts the interaction between SIRPα and CD47 44 also increased CFSE labeled control cell uptake by BMDC’s 15.7% compared to an isotype control (Fig. S4). These data suggest that cell surface expression of CD47 regulates tumor cell phagocytosis by dendritic cells, a key antigen presenting cell present in OSCC.

Figure 3.

Figure 3

Open in a new tab

Change in tumor cell phagocytosis by BMDC’s and IFN-gamma secretion or granzyme release by mixed lymphocytes after tumor cell loss of CD47. (A) Phagocytic uptake of CFSE labeled HPV(+) cells was analyzed by incubating BMDC’s and shRNA non-silencing control (Control) or stable shRNA-mediated CD47 knockdown (shCD47) HPV(+) MTEC cells. Following CFSE treatment, HPV(+) MTEC cells were incubated with BMDC’s for 18 hrs and analyzed by fluorescence microscopy and FACS analysis. Percent of dendritic cells with phagocytic CFSE uptake are shown in upper right of graph. Graphs were obtained by FACS analysis for MHC-II and CFSE expression. Representative pictures of dendritic cells are shown with arrows indicating the CFSE uptake in the BMDC’s. Scale bar, 200µm. (B) Mixed lymphocytes were harvested from the draining inguinal node of tumor bearing mice and incubated with the indicated HPV(+) MTEC cells: shRNA nonsilencing control (Control), irradiated control (30Gy) or shRNA mediated CD47 knock-down (shCD47). IFNγ secretion was assayed by commercial ELISA from the supernatant after 18 hrs. (C) ELISpot Granzyme B assay of splenocytes harvested from null vaccinated (Naïve) or HPV 16 E6E7 vaccinated (Activated) mice. Splenocytes were harvested and evaluated for reactivity towards non-silencing control or shCD47 HPV(+) MTEC cells through secretion of granzyme B.

Depletion of CD47 enhances IFN-gamma production and granzyme release in a mixed lymphocyte reaction

IFN-gamma secretion occurs from many immune cells, such as dendritic cells, and indicates immune activation. Thus, to determine whether reduction of CD47 on tumor cells activates immune cells, we analyzed release of IFN-gamma in vitro as follows. Mixed lymphocytes were isolated from the draining lymph node of HPV(+) MTEC tumor bearing mice. These lymphocytes were incubated with either HPV(+) MTEC control cells, control cells with decreased CD47 due to radiation or cells depleted of CD47 via shRNA (shCD47) and IFN-gamma production measured. As shown in Fig. 3B, mixed lymphocytes increased IFN-gamma production when co-cultured with irradiated or shCD47 cells as compared to control cells, suggesting an additional role for decreased tumor cell CD47 expression in mediating IFN-gamma tumor responses.

Granzyme B release has been shown to accurately reflect tumor cell mediated immunity (CMI) and serves as an indication of cytotoxic T lymphocyte activation.45 Thus, to assess the possible role of decreased tumor cell CD47 in modulating cell mediated immune killing we completed a granzyme release elispot assay on the HPV(+) MTEC cells. Splenocytes from mice vaccinated with an empty adenovirus (naïve splenocytes) versus splenocytes from mice vaccinated with an adenovirus expressing HPV16 E6/E7 antigens (activated splenocytes) were evaluated. Fig. 3C shows that depletion of CD47 on HPV(+) MTEC cells significantly increased granzyme B release from both naïve and activated splenocytes. The activated splenocytes from E6/E7 vaccinated mice had the highest release of granzyme B, suggesting that depletion of CD47 further enhances HPV specific CMI. Taken together, these studies demonstrate that decrease of surface CD47 on epithelial tumor cells likely enhances activation of several immune cells, possibly modulating the immune response at multiple levels.

Epithelial tumor cell specific knockdown of CD47 leads to increased survival in vivo when combined with standard chemo/radiation therapy

To test whether reduction of surface CD47 on tumor cells in vivo correlates with improved tumor therapeutic response, we utilized a previously characterized immune competent syngeneic mouse model of OSCC 12. HPV(+) MTEC cells with CD47 stably knocked-down were implanted into mice and tumor growth and survival analyzed. In the absence of radiation or chemotherapy stable knockdown of CD47 alone had no significant effect on tumor growth or survival in C57Bl/6 mice relative to control (Fig. 4A). Because immune-mediated clearance of OSCC occurs following radiation and chemotherapy, 11 we tested whether combining CD47 knockdown with these standard therapies improves tumor clearance. When combined with radiation and chemotherapy, stable knockdown of CD47 led to a 50% increase in long term survival. To validate that the increase in survival was immune-mediated, we repeated the experiment in Rag 1 mice that lack functional T and B cells. In the Rag background, standard chemo/radiation therapy combined with tumor cell specific CD47 knockdown resulted in increased tumor growth and significantly shorter survival relative to controls (Fig. 4C). Thus, in the context of a competent immune system and standard cisplatin/radiation therapy, tumor cell specific reduction of CD47 not only decreases tumor volumes, but improves long term clearance.

Figure 4.

Figure 4

Open in a new tab

Loss of CD47 enhances immune-related clearance of HPV+ tumors only in immune competent animals. Tumor growth curves (for individual mice) and group Kaplan-Meyer survival curves are shown for shRNA non-silencing control (Control) or shRNA mediated CD47 knock-down (shCD47) HPV(+) MTEC tumors. (A) Growth and survival in immune competent mice receiving no treatment. (B) Growth and survival in immune competent mice receiving three doses of radiation and cisplatin (8Gy radiation and 20mg/kg cisplatin) on days indicated by bold arrows. (C) Part B repeated in immune incompetent RAG-1 mice.

Discussion

It is becoming increasingly evident that radiation therapy induces many cellular and tumor microenvironment changes in addition to its direct cytotoxic effects. Because clearance of HPV(+) OSCC is mediated in part through an immune mechanism, we investigated tumor specific cell surface changes induced by radiotherapy. We identified a radiation-dependent surface decrease of CD47 on transformed HPV(+) and (−) human epithelial tumor cells. When tested in an HPV(+) immune competent mouse model, reduction of tumor cell CD47 improved the immune mediated response to standard chemo/radiation therapy.

We demonstrate that the decrease in CD47 is dependent on radiation dose and that protein expression is restored by tumor cells in a time dependent manner following cessation of treatment in vivo as well as in vitro. We postulate that the radiation-dependent decrease in epithelial CD47 surface expression constitutes one of the initial signals alerting antigen presenting cells of the immune system to the presence of altered self cells after radiation injury. We noted that blocking CD47 on HPV(+) MTEC cells with a monoclonal antibody increased phagocytosis by BMDC’s, consistent with what has been shown for leukemic cell phagocytosis by macrophages,43 and we were able to see the same effect when CD47 was selectively reduced from the tumor cell surface. Tumor cell reduction of CD47 also resulted in enhanced IFN-gamma secretion in a mixed lymphocyte assay. Furthermore, granzyme release, which accurately reflects cell mediated immunity,45 was enhanced from naïve splenoytes subsequent to CD47 depletion on tumor cells; and intriguingly, the most significant response was seen in splenocytes from HPV vaccinated mice suggesting CD47 loss further enables an HPV specific immune response. These findings support previous studies demonstrating a role for CD47 in phagocytosis but also suggest that the overexpression of CD47 on tumor cells attenuates cell mediated immune responses.

Immunostaining of patient tumor samples shows that CD47 is present in both HPV(+) and HPV(−) tumors and its expression is increased in cancerous tissues; results that are consistent with previous studies showing increased transcript.29, 46 Additionally, we show that the radiation dependent decrease in CD47 occurs in both HPV(+) and HPV(−) OSCC cell lines, thus, while reduced CD47 expression may affect the immune response, additional factors likely contribute to the differences in outcomes noted between the HPV(+) and (−) OSCC patient populations. These data point to a possible selective advantage for tumor cells over-expressing CD47. Our current findings suggest that such an up-regulation of surface CD47 aids tumor cells in immune evasion. Additionally, other roles such as tissue invasion of B-Cell lymphomas are also strongly associated with CD47 expression,47 suggesting that radiation-induced changes in CD47 expression may affect the metastatic potential of tumors. One interesting observation we noted during radiation therapy was the absence of CD47 loss in adjacent normal tissue within the radiation field. It is possible that the cellular mechanism leading to increased CD47 expression on tumor cells is attenuated by radiation, thus CD47 over-expressing tumor cells demonstrate a robust change in surface CD47 expression following radiation compared to non-tumor cells. The finding that non-transformed cells did not reduce CD47 compared to cancer cell lines (HPV(+) and HPV(−)) and our transformed HPV(+) and HPV(−) mouse oropharyngeal cells suggests that a currently undefined mechanism of transformation makes cells susceptible to loss of CD47 during radiation. It is possible that this mechanism is important for radiation responsiveness of HPV(+) and HPV(−) cancers. However, it is clear that loss of CD47 alone is not sufficient to cause immune clearance because HPV+ tumors depleted of CD47 grew equally as well in mice as controls. Our data would suggest that CD47 loss is part of a multifactoral response which likely includes additional alarmins as well as presentation of viral antigens resulting in immune clearance. Ongoing studies examining the regulation of CD47 expression will further elucidate these mechanisms and may provide a therapeutic target to selectively reduce CD47 on tumor cells.

One caveat with regards to radiation delivery in the reported studies is that they differ in respect to radiation delivery in humans with OSCC. Radiation delivery to humans is administered in 2Gy daily fractions with a total dose between 60–72Gy. Although our cumulative doses are within this range, the fractionated delivery may affect outcome. Future work with serial biopsies are planned to examine how daily fractionated radiation impacts CD47 expression in human OSCC.

Finally, we show that selectively decreasing CD47 expression on HPV(+) tumor cells in combination with standard chemo/radiation therapy increases tumor clearance in immune competent, but not in immune incompetent RAG1 mice. These in vivo data further support our in vitro observations suggesting that HPV(+) MTEC cells with reduced CD47 are not intrinsically more sensitive to radiation. In a different model examined by Maxhimer et al.,48 which used systemic delivery of siRNA to reduce CD47 in vivo, decreased tumor volumes with radiation therapy were also noted in immune competent mice. Our results indicate that the mechanism likely responsible for these in vivo observations is immune dependent killing of tumor cells.

The failure to reduce tumor growth or increase survival by stable knockdown of CD47 without chemotherapy/radiation in immune competent mice is not surprising as immune recognition and activation require multiple co-stimulatory signals.49, 50 Alternatively, because the shCD47 cells we generated are not entirely devoid of CD47, it is possible that the absolute amount of tumor cell CD47 present is less important than the change in CD47 levels induced by radiation therapy. It is however clear that tumor specific reduction of CD47 when combined with cytotoxic or other alarmin effects induced by chemotherapy and radiation, does enhance tumor clearance. Thus, a targeted approach to reduce the availability of CD47 specifically on tumor cells may prove advantageous for the treatment of solid tumors. Future studies are needed to determine which immune cells are involved in vivo and whether decreasing tumor cell CD47 enhances recruitment of immune cells or improves antigen presentation in the peripheral lymphatic system. With the continued identification, understanding, and targeting of alarmin signals such as CD47, it is hopeful that future OSCC therapeutic regimens will achieve improved survival rates while decreasing the morbidity associated with traditional therapies.

Supplementary Material

Supp Fig S1-S4
02

Acknowledgements

We thank Cathy Christopherson for administrative assistance, Andrew Hoover for critical review of the manuscript, and Bryant Wieking, Phillip Snyder, Denise Schwabauer and Nichole Haag for technical assistance. Sanford Research/USD Flow Cytometry Core Facility (supported by grant NIH 1P20RR024219-01A2). Sanford Research/USD Imaging Core Facility (supported by NIH grants 5P20RR017662-08 and 1P20RR024219-01A2).

Sources of Support: JHL supported by NIDCR 7R01DE018386-03 grant and subaward 3SB161 State of South Dakota-2010 Initiative. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Abbreviations Used

BMDC

bone marrow derived dendritic cell

IFNγ

interferon gamma

HNSCC

head and neck squamous cell carcinoma

HPV−

human papillomavirus negative

HPV+

human papillomavirus positive

HTEC

human tonsil epithelial cells

MTEC

mousem tonsil epithelial cells

OSCC

oropharyngeal squamous cell carcinoma

References

  • 1.Prince A, Aguirre-Ghizo J, Genden E, Posner M, Sikora A. Head and neck squamous cell carcinoma: new translational therapies. Mt Sinai J Med. 2010;77:684–699. doi: 10.1002/msj.20216. [DOI] [PubMed] [Google Scholar]
  • 2.Leemans CR, Braakhuis BJ, Brakenhoff RH. The molecular biology of head and neck cancer. Nat Rev Cancer. 2011;11:9–22. doi: 10.1038/nrc2982. [DOI] [PubMed] [Google Scholar]
  • 3.Kamangar F, Dores GM, Anderson WF. Patterns of cancer incidence, mortality, and prevalence across five continents: defining priorities to reduce cancer disparities in different geographic regions of the world. J Clin Oncol. 2006;24:2137–2150. doi: 10.1200/JCO.2005.05.2308. [DOI] [PubMed] [Google Scholar]
  • 4.Kim L, King T, Agulnik M. Head and neck cancer: changing epidemiology and public health implications. Oncology (Williston Park) 2010;24:915–919. 24. [PubMed] [Google Scholar]
  • 5.Mendonca MS, Chin-Sinex H, Dhaemers R, Mead LE, Yoder MC, Ingram DA. Differential mechanisms of x-ray-induced cell death in human endothelial progenitor cells isolated from cord blood and adults. Radiat Res. 2011;176:208–216. doi: 10.1667/rr2427.1. [DOI] [PubMed] [Google Scholar]
  • 6.Karar J, Maity A. Modulating the tumor microenvironment to increase radiation responsiveness. Cancer Biol Ther. 2009;8:1994–2001. doi: 10.4161/cbt.8.21.9988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Williams JR, Zhang Y, Zhou H, Gridley DS, Koch CJ, Dicello JF, Slater JM, Little JB. Tumor response to radiotherapy is dependent on genotype-associated mechanisms in vitro and in vivo. Radiat Oncol. 2010;5:71. doi: 10.1186/1748-717X-5-71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Demaria S, Formenti SC. Sensors of ionizing radiation effects on the immunological microenvironment of cancer. Int J Radiat Biol. 2007;83:819–825. doi: 10.1080/09553000701481816. [DOI] [PubMed] [Google Scholar]
  • 9.Formenti SC, Demaria S. Local control by radiotherapy: is that all there is? Breast Cancer Res. 2008;10:215. doi: 10.1186/bcr2160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ferrara TA, Hodge JW, Gulley JL. Combining radiation and immunotherapy for synergistic antitumor therapy. Curr Opin Mol Ther. 2009;11:37–42. [PMC free article] [PubMed] [Google Scholar]
  • 11.Spanos WC, Nowicki P, Lee DW, Hoover A, Hostager B, Gupta A, Anderson ME, Lee JH. Immune response during therapy with cisplatin or radiation for human papillomavirus-related head and neck cancer. Arch Otolaryngol Head Neck Surg. 2009;135:1137–1146. doi: 10.1001/archoto.2009.159. [DOI] [PubMed] [Google Scholar]
  • 12.Williams R, Lee DW, Elzey BD, Anderson ME, Hostager BS, Lee JH. Preclinical models of HPV+ and HPV− HNSCC in mice: an immune clearance of HPV+ HNSCC. Head Neck. 2009;31:911–918. doi: 10.1002/hed.21040. [DOI] [PubMed] [Google Scholar]
  • 13.Martins I, Kepp O, Schlemmer F, Adjemian S, Tailler M, Shen S, Michaud M, Menger L, Gdoura A, Tajeddine N, Tesniere A, Zitvogel L, et al. Restoration of the immunogenicity of cisplatin-induced cancer cell death by endoplasmic reticulum stress. Oncogene. 2011;30:1147–1158. doi: 10.1038/onc.2010.500. [DOI] [PubMed] [Google Scholar]
  • 14.Apetoh L, Ghiringhelli F, Tesniere A, Obeid M, Ortiz C, Criollo A, Mignot G, Maiuri MC, Ullrich E, Saulnier P, Yang H, Amigorena S, et al. Toll-like receptor 4-dependent contribution of the immune system to anticancer chemotherapy and radiotherapy. Nat Med. 2007;13:1050–1059. doi: 10.1038/nm1622. [DOI] [PubMed] [Google Scholar]
  • 15.Vesely MD, Kershaw MH, Schreiber RD, Smyth MJ. Natural innate and adaptive immunity to cancer. Annu Rev Immunol. 2011;29:235–271. doi: 10.1146/annurev-immunol-031210-101324. [DOI] [PubMed] [Google Scholar]
  • 16.Schreiber RD, Old LJ, Smyth MJ. Cancer immunoediting: integrating immunity's roles in cancer suppression and promotion. Science. 2011;331:1565–1570. doi: 10.1126/science.1203486. [DOI] [PubMed] [Google Scholar]
  • 17.Yaguchi T, Sumimoto H, Kudo-Saito C, Tsukamoto N, Ueda R, Iwata-Kajihara T, Nishio H, Kawamura N, Kawakami Y. The mechanisms of cancer immunoescape and development of overcoming strategies. Int J Hematol. 2011;93:294–300. doi: 10.1007/s12185-011-0799-6. [DOI] [PubMed] [Google Scholar]
  • 18.Seliger B. Strategies of tumor immune evasion. BioDrugs. 2005;19:347–354. doi: 10.2165/00063030-200519060-00002. [DOI] [PubMed] [Google Scholar]
  • 19.Garrido F, Algarra I, Garcia-Lora AM. The escape of cancer from T lymphocytes: immunoselection of MHC class I loss variants harboring structural-irreversible "hard" lesions. Cancer Immunol Immunother. 2010;59:1601–1606. doi: 10.1007/s00262-010-0893-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Algarra I, Garcia-Lora A, Cabrera T, Ruiz-Cabello F, Garrido F. The selection of tumor variants with altered expression of classical and nonclassical MHC class I molecules: implications for tumor immune escape. Cancer Immunol Immunother. 2004;53:904–910. doi: 10.1007/s00262-004-0517-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Garrido F, Algarra I. MHC antigens and tumor escape from immune surveillance. Adv Cancer Res. 2001;83:117–158. doi: 10.1016/s0065-230x(01)83005-0. [DOI] [PubMed] [Google Scholar]
  • 22.Hamai A, Benlalam H, Meslin F, Hasmim M, Carre T, Akalay I, Janji B, Berchem G, Noman MZ, Chouaib S. Immune surveillance of human cancer: if the cytotoxic Tlymphocytes play the music, does the tumoral system call the tune? Tissue Antigens. 2010;75:1–8. doi: 10.1111/j.1399-0039.2009.01401.x. [DOI] [PubMed] [Google Scholar]
  • 23.Shiao SL, Coussens LM. The tumor-immune microenvironment and response to radiation therapy. J Mammary Gland Biol Neoplasia. 2010;15:411–421. doi: 10.1007/s10911-010-9194-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.van den Berg TK. On the origin and function of immune 'self' recognition. Immunol Lett. 2010;128:24–25. doi: 10.1016/j.imlet.2009.09.013. [DOI] [PubMed] [Google Scholar]
  • 25.Sarfati M, Fortin G, Raymond M, Susin S. CD47 in the immune response: role of thrombospondin and SIRP-alpha reverse signaling. Curr Drug Targets. 2008;9:842–850. doi: 10.2174/138945008785909310. [DOI] [PubMed] [Google Scholar]
  • 26.Brown EJ, Frazier WA. Integrin-associated protein (CD47) and its ligands. Trends Cell Biol. 2001;11:130–135. doi: 10.1016/s0962-8924(00)01906-1. [DOI] [PubMed] [Google Scholar]
  • 27.Latour S, Tanaka H, Demeure C, Mateo V, Rubio M, Brown EJ, Maliszewski C, Lindberg FP, Oldenborg A, Ullrich A, Delespesse G, Sarfati M. Bidirectional negative regulation of human T and dendritic cells by CD47 and its cognate receptor signal-regulator protein-alpha: down-regulation of IL-12 responsiveness and inhibition of dendritic cell activation. J Immunol. 2001;167:2547–2554. doi: 10.4049/jimmunol.167.5.2547. [DOI] [PubMed] [Google Scholar]
  • 28.Matozaki T, Murata Y, Okazawa H, Ohnishi H. Functions and molecular mechanisms of the CD47-SIRPalpha signalling pathway. Trends Cell Biol. 2009;19:72–80. doi: 10.1016/j.tcb.2008.12.001. [DOI] [PubMed] [Google Scholar]
  • 29.Suhr ML, Dysvik B, Bruland O, Warnakulasuriya S, Amaratunga AN, Jonassen I, Vasstrand EN, Ibrahim SO. Gene expression profile of oral squamous cell carcinomas from Sri Lankan betel quid users. Oncol Rep. 2007;18:1061–1075. [PubMed] [Google Scholar]
  • 30.Suzuki S, Yokobori T, Tanaka N, Sakai M, Sano A, Inose T, Sohda M, Nakajima M, Miyazaki T, Kato H, Kuwano H. CD47 expression regulated by the miR-133a tumor suppressor is a novel prognostic marker in esophageal squamous cell carcinoma. Oncol Rep. 2012;28:465–472. doi: 10.3892/or.2012.1831. [DOI] [PubMed] [Google Scholar]
  • 31.Spanos WC, Geiger J, Anderson ME, Harris GF, Bossler AD, Smith RB, Klingelhutz AJ, Lee JH. Deletion of the PDZ motif of HPV16 E6 preventing immortalization and anchorage-independent growth in human tonsil epithelial cells. Head Neck. 2008;30:139–147. doi: 10.1002/hed.20673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Hoover AC, Spanos WC, Harris GF, Anderson ME, Klingelhutz AJ, Lee JH. The role of human papillomavirus 16 E6 in anchorage-independent and invasive growth of mouse tonsil epithelium. Arch Otolaryngol Head Neck Surg. 2007;133:495–502. doi: 10.1001/archotol.133.5.495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Spanos WC, Hoover A, Harris GF, Wu S, Strand GL, Anderson ME, Klingelhutz AJ, Hendriks W, Bossler AD, Lee JH. The PDZ binding motif of human papillomavirus type 16 E6 induces PTPN13 loss, which allows anchorage-independent growth and synergizes with ras for invasive growth. J Virol. 2008;82:2493–2500. doi: 10.1128/JVI.02188-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Brenner JC, Graham MP, Kumar B, Saunders LM, Kupfer R, Lyons RH, Bradford CR, Carey TE. Genotyping of 73 UM-SCC head and neck squamous cell carcinoma cell lines. Head Neck. 2010;32:417–426. doi: 10.1002/hed.21198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Matheu MP, Sen D, Cahalan MD, Parker I. Generation of bone marrow derived murine dendritic cells for use in 2-photon imaging. J Vis Exp. 2008;17:773. doi: 10.3791/773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Yamamoto Y, Usui F, Nakamura Y, Ito Y, Tagami T, Nirasawa K, Matsubara Y, Ono T, Kagami H. A novel method to isolate primordial germ cells and its use for the generation of germline chimeras in chicken. Biol Reprod. 2007;77:115–119. doi: 10.1095/biolreprod.107.061200. [DOI] [PubMed] [Google Scholar]
  • 37.Lee DW, Anderson ME, Wu S, Lee JH. Development of an adenoviral vaccine against E6 and E7 oncoproteins to prevent growth of human papillomavirus-positive cancer. Arch Otolaryngol Head Neck Surg. 2008;134:1316–1323. doi: 10.1001/archoto.2008.507. [DOI] [PubMed] [Google Scholar]
  • 38.Fucikova J, Kralikova P, Fialova A, Brtnicky T, Rob L, Bartunkova J, Spisek R. Human tumor cells killed by anthracyclines induce a tumor-specific immune response. Cancer Res. 2011;71:4821–4833. doi: 10.1158/0008-5472.CAN-11-0950. [DOI] [PubMed] [Google Scholar]
  • 39.Spisek R, Dhodapkar MV. Towards a better way to die with chemotherapy: role of heat shock protein exposure on dying tumor cells. Cell Cycle. 2007;6:1962–1965. doi: 10.4161/cc.6.16.4601. [DOI] [PubMed] [Google Scholar]
  • 40.Obeid M, Tesniere A, Ghiringhelli F, Fimia GM, Apetoh L, Perfettini JL, Castedo M, Mignot G, Panaretakis T, Casares N, Metivier D, Larochette N, et al. Calreticulin exposure dictates the immunogenicity of cancer cell death. Nat Med. 2007;13:54–61. doi: 10.1038/nm1523. [DOI] [PubMed] [Google Scholar]
  • 41.Gardai SJ, McPhillips KA, Frasch SC, Janssen WJ, Starefeldt A, Murphy-Ullrich JE, Bratton DL, Oldenborg PA, Michalak M, Henson PM. Cell-surface calreticulin initiates clearance of viable or apoptotic cells through trans-activation of LRP on the phagocyte. Cell. 2005;123:321–334. doi: 10.1016/j.cell.2005.08.032. [DOI] [PubMed] [Google Scholar]
  • 42.Tsai RK, Discher DE. Inhibition of "self" engulfment through deactivation of myosin-II at the phagocytic synapse between human cells. J Cell Biol. 2008;180:989–1003. doi: 10.1083/jcb.200708043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Jaiswal S, Jamieson CH, Pang WW, Park CY, Chao MP, Majeti R, Traver D, van Rooijen N, Weissman IL. CD47 is upregulated on circulating hematopoietic stem cells and leukemia cells to avoid phagocytosis. Cell. 2009;138:271–285. doi: 10.1016/j.cell.2009.05.046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Jiang P, Lagenaur CF, Narayanan V. Integrin-associated protein is a ligand for the P84 neural adhesion molecule. J Biol Chem. 1999;274:559–562. doi: 10.1074/jbc.274.2.559. [DOI] [PubMed] [Google Scholar]
  • 45.Shafer-Weaver K, Sayers T, Strobl S, Derby E, Ulderich T, Baseler M, Malyguine A. The Granzyme B ELISPOT assay: an alternative to the 51Cr-release assay for monitoring cell-mediated cytotoxicity. J Transl Med. 2003;1:14. doi: 10.1186/1479-5876-1-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Kim MJ, Lee JC, Lee JJ, Kim S, Lee SG, Park SW, Sung MW, Heo DS. Association of CD47 with natural killer cell-mediated cytotoxicity of head-and-neck squamous cell carcinoma lines. Tumour Biol. 2008;29:28–34. doi: 10.1159/000132568. [DOI] [PubMed] [Google Scholar]
  • 47.Chao MP, Tang C, Pachynski RK, Chin R, Majeti R, Weissman IL. Extranodal dissemination of non-Hodgkin lymphoma requires CD47 and is inhibited by anti-CD47 antibody therapy. Blood. 2011;118:4890–4901. doi: 10.1182/blood-2011-02-338020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Maxhimer JB, Soto-Pantoja DR, Ridnour LA, Shih HB, Degraff WG, Tsokos M, Wink DA, Isenberg JS, Roberts DD. Radioprotection in normal tissue and delayed tumor growth by blockade of CD47 signaling. Sci Transl Med. 2009;1:3ra7. doi: 10.1126/scitranslmed.3000139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Fontana MF, Vance RE. Two signal models in innate immunity. Immunol Rev. 2011;243:26–39. doi: 10.1111/j.1600-065X.2011.01037.x. [DOI] [PubMed] [Google Scholar]
  • 50.Nair P, Amsen D, Blander JM. Co-ordination of incoming and outgoing traffic in antigen-presenting cells by pattern recognition receptors and T cells. Traffic. 2011;12:1669–1676. doi: 10.1111/j.1600-0854.2011.01251.x. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp Fig S1-S4
NIHMS435316-supplement-Supp_Fig_S1-S4.tif (169.1KB, tif)
02
NIHMS435316-supplement-02.pdf (100KB, pdf)

RESOURCES