Genetic Variability of Plasmodium malariae dihydropteroate synthase (dhps) in Four Asian Countries

Abstract

The dihydropteroate synthase (dhps) genes of 44 P. malariae strains from four Asian countries were isolated. Only a limited number of polymorphisms were observed. Comparison with homologous mutations in other Plasmodium species showed that these polymorphisms are unlikely to be associated with sulfadoxine resistance.

Introduction

Molecular characterizations of antifolate resistance in Plasmodium falciparum and P. vivax have revealed stepwise increase in antifolate resistance with additional mutations within the dihydrotheorate synthase (dhps) and dihydrofolate reductase (dhfr) genes [1], [2], [3], [4]. Although patients infected with P. malariae are usually not treated with antifolate drugs, exposure is still likely in endemic areas where sulfadoxine - pyrimethamine is used for treatment of falciparum malaria, because of the high frequency of mixed infections. The previously reported S114N mutation within the dhfr gene of P. malariae supports this [5], [6]. The P. malariae gene for dhps, the target for sulfadoxine, has not been studied to date.

Materials and Methods

In this study, the dhps gene of 44 P. malariae strains from Asian clinical samples (34 from Thailand, 6 from Laos, 3 from Viet Nam, and 1 from Bangladesh) were isolated and analysed. Genomic DNA of P. brasilianum, a New World monkey malaria parasite considered to be genetically indistinguishable from P. malariae, purified from a cloned line maintained in Saimiri monkeys was obtained from MR4 (MR4-349). Samples were obtained from patients enrolled in a variety of previous treatment studies. All patients provided written informed consent. The protocol for this study was reviewed and approved from the Faculty of Tropical Medicine, Mahidol University, Thailand (reference no. MUTM2011-049-03). To design primers for isolation of the dhps gene from P. malariae and P. brasilianum, the nucleotide sequences of dhps gene from other human Plasmodium spp. were aligned, including P. falciparum (accession number XM_001349382), P. vivax (accession number XM_001617159), and P. knowlesi (accession number XM_002262146). A nested and seminested PCR approach was used to increase sensitivity of the amplification product. The sequences of primers, Mg²⁺concentrations, annealing temperatures, numbers of cycles, and sizes of products were individually determined for the different primer pairs shown in Table 1. Amplified PCR products were then cloned into the pCR 2.1 vector (Invitrogen, USA), and the plasmids purified from the bacterial clones were submitted for DNA sequencing.

Table 1. Primer sequences and PCR condition for isolation of pppk-dhps gene from P. malariae and P. brasilianum.

Primer name	Sequences (5′ to 3′)	Annealing temperature(°C)	MgCl2(mM)	No. of PCRcycle		Product size(bp)
				Nest1	Nest2
DHPS_F70	GGAAC(G,A)AATGA(T,C)A(G,A)AA(G,A)(G,A)AAC	50	3	30		ca 800
DHPS_R800	CTGT(G,A)T(G,T)T(C,T)GT(G,A)TACACATGAGG
DHPS_F120	GG(A,C)AAAAT(T,C)AT(T,C)AA(T,C)A(G,C)(T,G)TC(G,C)TAC	50	3		35	ca 700
DHPS_R800	CTGT(G,A)T(G,T)T(C,T)GT(G,A)TACACATGAGG
DHPS_F500	GTTA(G,A)(G,A)AC(T,C)TTTGT(T,A)(G,A)A(T,A)GA(T,C)CC	50	3	30		ca 1,500
DHPS_R22	CTAA(C,A)ACGTC(G,A)TGAACTCT(G,T)AT(A,T)AG
DHPS_F500	GTTA(G,A)(G,A)AC(T,C)TTTGT(T,A)(G,A)A(T,A)GA(T,C)CC	50	3		35	ca 1,000
DHPS_R16	GGATTTCC(C,T)CT(C,T)TT(G,A)TGCATT
DHPS_MF900	GACACATTGAAGCAATTGAAAGA	52	3	30		ca 1,400
DHPS_PSR1	GTTTCTAA(A/C)ACGTC(A/G)TGAACTCT
DHPS_MF17	GACATTAGCGCATGCACAAA	52	3		35	ca 700
DHPS_R22	CTAA(C,A)ACGTC(G,A)TGAACTCT(G,T)AT(A,T)AG
DHPS_MF900	GACACATTGAAGCAATTGAAAGA	52	3		35	ca 700
DHPS_R16	GGATTTCC(C,T)CT(C,T)TT(G,A)TGCATT
DHPS_MF17	GACATTAGCGCATGCACAAA	52	3		35	ca 900
DHPS_R2	AGCTGTAGGAAGCAAT(G,T)GCTA(G,A)(C,T)C

Results and Discussion

The partial pppk-dhps gene was isolated from both P. malariae (1,953 bp) and P. brasilianum (1,914 bp). The partial 1,953 bp Pmpppk-dhps included one intron (167 bp) at the carboxyl terminus coding region, which position and size was established by reverse-transcriptase PCR amplification and sequencing from corresponding mRNA. DNA sequences of pppk-dhps are available from 3 other species infecting humans: P. falciparum, P. vivax and P. knowlesi. In all species the pppk-dhps gene has two introns, one of which is located near the N-terminus coding region of the pppk gene and one near the C-terminal. This study revealed an 167 bp intron within dhps gene of P. malariae. AT content of the pppk-dhps gene from P. malariae, P. brasilianum and P. falciparum was high (72.2–76.5%), whereas this is low in P. vivax and P. knowlesi (56.8% and 62.2% respectively). The pppk-dhps gene of P. falciparum appeared to be located on chromosome 8, whereas in P. vivax and P. knowlesi this is on chromosome 14.

Specific primers were designed to isolate the Pmdhps gene from all 44 P. malariae isolates. In the amplified product 1,140 bp (corresponding to 379 amino acids) of Pmdhps were analyzed, which revealed 2 and 3 positions of synonymous and nonsynonymous mutations which were predicted to change amino acids located outside the binding pocket of the enzyme for sulfadoxine. This was assessed through amino acid alignment with DHPS of P. falciparum and P. vivax (Figure 1), showing that equivalent variation in these other species are not associated with changes in the binding pocket for sulfadoxine, nor with sulfadoxine resistance. The 44 Pmdhps sequences could be categorized into 4 haplotypes; the wild type haplotype 1 was most prevalent (41/44 isolates; Table 2).

Figure 1. Deduced partial PPPK-DHPS amino acid sequences alignment.

Table 2. Nonsynonymous mutations observed in P. malariae dhps.

DHPS amino acid residues*
Organisms																No. of isolate
P. falciparum	S436A/F	A437G	K540E	A581G	A613S/T	P438	F580	R608	K609	Y663	N666	H688	T573	L516	E339
P. vivax	S382	A383	K512	A553	V585	P384	F552	R580	K581	Y688	N691	H713	T509	L488	E285
P. knowlesi	S382	A383	K514	A555	V587	P384	F554	R582	K583	Y711	N714	H737	T511	L490	E285
P. brasilianum	S	A	K	A	A	P	F	R	K	Y	N	-	T	L	N
P. malariae haplotype 1	S	A	K	A	A	P	F	R	K	Y	N	-	T	L	N	41#
P. malariae haplotype 2	S	A	K	A	A	P	F	R	K	Y	N	-	A	L	N	1 Thai
P. malariae haplotype 3	S	A	K	A	A	P	F	R	K	Y	N	-	T	F	N	1 Thai
P. malariae haplotype 4	S	A	K	A	A	P	F	R	K	Y	N	-	T	L	Y	1 Viet Nam

*Ten residues including 436,437,438,580,608,609,613,663,666,688 were predicted to contact with sulfadoxine in Pf with equivalent to Pv and other spp. while the first five residue were associated with sulfadoxine resistance. The last 3 residues were nonsynonymous mutation found in P. malariae.

^#32 Thai, 6 Lao PDR, 2 Viet Nam, 1 Bangladesh.

The current study investigated 27 isolates from which we have previously reported details on dhfr gene polymorphisms [6]. Two of these isolates contained the S114N-mutation within dhfr, which are predicted to confer antifolate resistant, and thus suggest antifolate drug pressure on the parasite populations. However, these dhfr mutations were not accompanied by mutations in the dhps gene thought to confer sulfadoxine resistance: one of these two samples contained wild type dhps gene, while the other strain showed 2 SNPs (one synonymous and one nonsynonymous). The nonsysnonymous mutation was located at the equivalent position 516 in P. falciparum and 488 in P. vivax, which does not code for the enzyme binding pocket. The dhfr gene sequences were then assessed in the 17 P. malariae isolates from Thailand, none of which showed mutations, and all were classified as haplotype 4 [6]. Thus far all available published and unpublished Pmdhfr sequences [5], [6] show a high prevalence of the wild type gene. Homology with other Plasmodium species suggest that the initial mutation associated with drug pressure may be at position S114N. In order to assess this point mutation more efficiently (analogous to S108N and S117N in P. falciparum and P. vivax), a PCR-RFLP method was developed and investigated. Patterns of wild type S114 contain two bands of 401 bp and 172 bp+168 bp product, and mutant type 114N showed two bands of 569 bp and 172 bp product. Forty-four samples of P. malariae were tested and PCR-RFLP results were in accordance with the sequence data. Using PCR-RFLP, we analysed 17 isolates recently collected in Thailand which revealed no mutations, with all strains classified as the common haplotype 4 [6].

Comparing homology of dhps genes isolated from P. falciparum, P. vivax, P. knowlesi and P. malariae has some limitations. Amino acid alignment of DHPS in each Plasmodium spp. determined equivalent position of nonsynonnymous mutations in association to sulfadoxine resistance in P. falciparum and P. vivax (Table 2). All 44 isolates of P. malariae showed wild type amino acids at these equivalent positions, whereas the three nonsynonymous mutations present in three P. malariae isolates have not been described in these other species. They are equivalent to T537, L516 and E339 in P. falciparum (Table 2). Amino acids found in P. vivax and P. knowlesi at these three residues are the same as in P. falciparum, suggesting that these three residues are conserved among Plasmodium spp. It is therefore interesting to construct an in silico comparative structure model to further explore whether the nonsynonymous mutations found in P. malariae at these positions have an effect on molecular docking of sulfadoxine.

Our findings suggest that drug pressure of sulphadoxine-pyrimethamine on P. malariae in the region has been lower than on P. falciparum or P. vivax. Mutations in the PmDHPS and PmDHFR genes are rare in Thailand, suggesting absence of selection of SP resistant parasite populations. We plan to extend our observations to P. malariae isolates collected from African countries where SP drug pressure is more prominent and where prevalence of P. malariae is higher compared to Southeast Asia. The nonsynonymous mutations identified in PmDHPS and PmDHFR require further in vivo and in vitro studies to elucidate their significance in SP resistance in P. malariae.

Funding Statement

This study was supported by Thailand Research Fund (TRF) grant code MRG5480066, Mahidol University and was part of the Wellcome Trust Mahidol University-Oxford Tropical Medicine Research Programme supported by the Wellcome Trust of Great Britain. NT is the TRF research grantee. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.