Skip to main content
PMC home page
Cell Research logoLink to Cell Research
. 2014 Apr 3;24(4):509. doi: 10.1038/cr.2014.39

IFNβ/TNFα synergism induces a non-canonical STAT2/IRF9-dependent pathway triggering a novel DUOX2 NADPH Oxidase-mediated airway antiviral response

Karin Fink 1,2, Lydie Martin 1, Esperance Mukawera 1, Stéfany Chartier 1, Xavier De Deken 3, Emmanuelle Brochiero 1,4, Françoise Miot 3, Nathalie Grandvaux 1,2
PMCID: PMC3975508

Correction to: Cell Research (2013) 23:673–690; doi:10.1038/cr.2013.47; published online 2 April 2013.

The authors apologized for an error in Supplementary information, Table S1. The sequence of the STAT1(2) siRNA used in the study should read as follows:

CCGCAUGGAAGUCAGGUUCUU

Articles from Cell Research are provided here courtesy of Nature Publishing Group

RESOURCES