Skip to main content
Molecular & Cellular Proteomics : MCP logoLink to Molecular & Cellular Proteomics : MCP
. 2014 Feb 3;13(4):1020–1033. doi: 10.1074/mcp.M113.033373

Quantitation of Human Metallothionein Isoforms: A Family of Small, Highly Conserved, Cysteine-rich Proteins*

Aaron A Mehus ‡,§,, Wallace W Muhonen ‡, Scott H Garrett §, Seema Somji §, Donald A Sens §, John B Shabb ‡,‖
PMCID: PMC3977181  PMID: 24493013

Abstract

Human metallothioneins (MTs) are important regulators of metal homeostasis and protectors against oxidative damage. Their altered mRNA expression has been correlated with metal toxicity and a variety of cancers. Current immunodetection methods lack the specificity to distinguish all 12 human isoforms. Each, however, can be distinguished by the mass of its acetylated, cysteine-rich, hydrophilic N-terminal tryptic peptides. These properties were exploited to develop a bottom-up MALDI-TOF/TOF-MS-based method for their simultaneous quantitation. Key features included enrichment of N-terminal acetylated peptides by strong cation exchange chromatography, optimization of C18 reversed-phase chromatography, and control of methionine oxidation. Combinations of nine isoforms were identified in seven cell lines and two tissues. Relative quantitation was accomplished by comparing peak intensities of peptides generated from pooled cytosolic proteins alkylated with 14N- or 15N-iodoacetamide. Absolute quantitation was achieved using 15N-iodoacetamide-labeled synthetic peptides as internal standards. The method was applied to the cadmium induction of MTs in human kidney HK-2 epithelial cells expressing recombinant MT-3. Seven isoforms were detected with abundances spanning almost 2 orders of magnitude and inductions up to 12-fold. The protein-to-mRNA ratio for MT-1E was one-tenth that of other MTs, suggesting isoform-specific differences in protein expression efficiency. Differential expression of MT-1G1 and MT-1G2 suggested tissue- and cell-specific alternative splicing for the MT-1G isoform. Protein expression of MT isoforms was also evaluated in human breast epithelial cancer cell lines. Estrogen-receptor-positive cell lines expressed only MT-2 and MT-1X, whereas estrogen-receptor-negative cell lines additionally expressed MT-1E. The combined expression of MT isoforms was 38-fold greater in estrogen-receptor-negative cell lines than in estrogen-receptor-positive cells. These findings demonstrate that individual human MT isoforms can be accurately quantified in cells and tissues at the protein level, complementing and expanding mRNA measurement as a means for evaluating MTs as potential biomarkers for cancers or heavy metal toxicity.


The metallothioneins (MTs)1 are a family of small, highly conserved proteins with the specific capacity to bind metal ions (1–3). Mammalian MTs, typically 61 to 68 amino acid residues in length, contain 20 invariant cysteine residues that form two distinct metal-binding domains. Up to seven or eight metal ions may be coordinated per MT. Many functions have been attributed to this redox-active protein, including zinc homeostasis; heavy metal detoxification; metal exchange; metal transfer; and protection against oxidative damage, inflammatory responses, and other cellular stresses (4–6). Changes in MT expression have been associated with human pathologies including cadmium-induced renal toxicity (7), neurodegeneration (8), and many forms of cancer (9, 10). The understanding of these changes is complicated by the 11 functional MT genes, seven pseudogenes, and four MT-like genes encoded in the genome, most of which contain only small differences in amino acid sequence (11). Seventeen of the 18 genes and pseudogenes are clustered together on chromosome 16, which is known to be enriched for intrachromosomal duplications (12). The various MT gene products differ in their patterns of mRNA and protein expression in human tissues and cell lines. Immunohistochemical detection using antibodies that do not discriminate between MT-1 and MT-2 isoforms indicates wide tissue and cell type distribution of MTs, as illustrated with the MT-1A entry of the Human Protein Atlas (13, 14). Measurements of individual MT mRNA levels, however, clearly demonstrate differential expression of specific MT-1 isoforms in human tissues and cell lines (15–17). The MT-3 (18, 19) and MT-4 (20) mRNAs are expressed in even narrower ranges of cell types.

An abundance of immunohistochemical and mRNA measurements show that alteration of MT isoform expression is correlated with a variety of cancers (9, 10). For example, several studies show that the expression of specific MT isoforms is altered in invasive ductal breast carcinomas. Elevated MT-2A (21) or MT-1F (22) is correlated with increased proliferation or tumor grade, respectively. Expression of MT-3 is associated with poor prognosis (23, 24). The MT-1E isoform is found in estrogen-receptor-negative (ER−), but not estrogen-receptor-positive (ER+), tumors (25) and cell lines (26). Parallel assessment of changes in MT protein expression via immunohistochemistry supports the mRNA data up to a point. Except for antibodies specific for the MT-3 isoform (27), all commercially available MT antibodies are pan-specific for the MT-1, MT-2, and MT-4 protein isoforms (28). This is because epitopes recognized by antibodies raised against MT-1 or MT-2 are limited to the first five residues of the acetylated N terminus, which are invariant among all MT-1, MT-2, and MT-4 isoforms (29–31). This includes the commercially available E9 antibody that has been used to demonstrate the overexpression of MT in a wide variety of human cancers (28, 32, 33). In general, the overexpression of MT in various cancers has been associated with resistance to anticancer therapies and linked to a poor prognosis.

The mounting evidence that specific MT isoforms may be useful prognostic and diagnostic markers for cancers highlights the need for alternative approaches to the assessment of MT isoform expression at the protein level. A few mass-spectrometry-based studies have succeeded in identifying the complement of MT isoforms in human cells (34, 35). Though top-down approaches hold promise for the quantitation of MTs based on the unique masses of intact isoforms (34, 36), this has yet to be exploited. Inductively coupled plasma MS has been used to quantify total metal-bound MTs in cells and tissues, but it cannot assign relative abundance values of MT isoforms because the proteins are reduced to their elemental composition with this technique. Thus far, MALDI-MS has been used in parallel with inductively coupled plasma MS for the qualitative identification of isoforms (35). Bottom-up quantitative approaches specifically targeting MTs have not yet been reported.

The use of mass spectrometry to quantify MT isoforms is not straightforward. The N-terminal tryptic peptide of each human MT isoform encompasses the only sequence that distinguishes all 12 and therefore may be used for their identification and quantitation in complex biological samples from cells and tissues (34). Any attempt at quantitation of this family of small, highly conserved, cysteine-rich proteins therefore requires reproducible detection of these signature peptides.

An optimized bottom-up proteomic method is presented here that is capable of identifying and quantifying all isoforms that constitute the human MT gene family in a single experiment. The approach is comparable in sensitivity and dynamic range to quantitative PCR methods used to measure mRNA levels. Quantitative and qualitative differences between mRNA and protein expression indicate that isoform-specific measurements of protein levels complement and extend our understanding of MT isoform expression in complex biological samples. The method was applied to the characterization of MT isoforms in ER+ and ER− breast cancer cell lines. Protein and mRNA measurements showed the same complement of isoform expression, confirming differential MT expression between ER+ and ER− cell lines. The mass spectrometry assay further showed dramatic differences in the abundance of protein and mRNA in specific isoforms, an observation that has not been previously reported.

EXPERIMENTAL PROCEDURES

Materials and Reagents

15N-iodoacetamide was obtained from Sigma-Aldrich (St. Louis, MO). Isoform-specific N-terminal acetylated MT peptides were synthesized by Elim Biopharmaceuticals (Hayward, CA). All reagents used for protein sample preparation were mass-spectrometry grade when available. Human cerebrum was obtained as an existing biological specimen from the Brain and Tissue Bank for Developmental Tissue Disorders (University of Maryland, Baltimore, MD) and stored at −80 °C. Adult human kidney cortex was obtained as described elsewhere (19, 37) and stored at −80 °C. All procurement protocols were approved by the University of North Dakota Institutional Review Board for Human Research.

Cell Culture and Harvest

Human kidney epithelial HK-2 (MT-3) cells containing stably transfected human MT-3 were grown as described previously (38, 39). This permanent cell line was selected because it mimics the doming properties of primary cultures of human proximal tubule cells. Upon doming of confluent monolayers, cells were maintained for 3 days in the presence or absence of 9 μm CdCl2 to induce MT expression. The human breast cell lines MCF-10A, MCF-7, T-47D, Hs578T, and MDA-MB-231 were obtained from the American Type Culture Collection. The MCF-10A cells were grown as previously described (40, 41) except media were supplemented with 5% (v/v) fetal calf serum. Cell monolayers from two T-75 flasks were washed twice with phosphate-buffered saline, detached by scraping, and pelleted by centrifugation at 197 × g for 5 min at 4 °C. Harvested cells were aliquoted for mass spectrometry and PCR analysis and either stored at −80 °C or used immediately.

Cytosol Preparation from Cells

Cell pellets were resuspended in 0.5 ml of hypotonic buffer (10 mm Tris pH 8.0, 1.5 mm MgCl2, 10 mm KCl, 1 mm DTT, and 0.5 μl Protease Inhibitor Mixture (Sigma-Aldrich)). The cells were then passed through a 25-gauge, ⅝-in. needle three times to disrupt membranes. The nuclei were pelleted by centrifugation (800 × g for 10 min at 4 °C) and the supernatant was further clarified by centrifugation at 100,000 × g for 30 min at 4 °C. Typical yields of 0.5 ml of cytosol per two T-75 flasks were 3.0 to 3.5 mg/ml as determined by the Bio-Rad Protein Assay (Bio-Rad, Hercules, CA). Cytosols were stored at −80 °C.

Cytosol Preparation from Tissues

Approximately 100 mg of frozen tissue was suspended in three volumes of hypotonic buffer and disrupted on ice with a Dounce homogenizer. All subsequent steps were as described for cell cytosol preparations.

Reduction and Alkylation

300 μg of cytosol (∼100 μl) was incubated with 3.5 mm EDTA. Samples were then denatured with 8 m urea and reduced with 5 mm DTT or tris(2-carboxyethyl)phosphine in 100 mm Tris pH 8.0 for one hour at room temperature in a final volume of ∼190 μl. Proteins were then alkylated at room temperature in the dark for one hour by the addition of ∼27 μl of 200 mm 14N- or 15N-iodoacetamide to a final concentration of 28 mm. Urea and excess alkylating agent were removed by passage through 1 ml of Bio-Gel P-6 in micro-Bio-Spin chromatography columns (Bio-Rad Laboratories, Hercules, CA) equilibrated with 100 mm Tris pH 8.0.

15N-labeled Peptide Standards

Table I shows the sequences for the 12 acetylated N-terminal tryptic peptides from human MTs surveyed in this study. All but MT-1G1 were successfully synthesized. The wide range of peptide purity in samples as received from the manufacturer (supplemental Table S1) was attributed to the difficulty of synthesis related to the high cysteine content and peptide-specific sequences. Peptides with 15N-iodoacetamide-blocked cysteines were not synthesized directly because of the prohibitive cost of doing so. 30 μg (30.0 μl) of each peptide was reduced and alkylated as described above in a final volume of 35.9 μl. The 15N-labeled peptides were then purified via reversed-phase high-pressure liquid chromatography (RP-HPLC) using a narrow-bore 2.1 × 150 mm Zorbax 300SB-C18 5-μm bead-size column (Agilent Technologies, Santa Clara, CA) on a Shimadzu 10-AVP HPLC (Shimadzu, Kyoto, Japan). Peptides were separated with a linear 35-min gradient using 97% buffer A (0.1% formic acid) to 38% buffer B (0.1% formic acid, 90% acetonitrile) at 0.3 ml/min and detected by absorbance at 214 nm. Samples with peaks corresponding to the correct mass and sequence as determined by mass spectrometry (supplemental Fig. S1) were collected, dried, reconstituted in MS-grade water, and stored at −80 °C. At this stage, all 15N-labeled peptides were at least 95% pure as assessed by RP-HPLC. Peptide concentrations were determined by means of area-under-the-curve analysis at 214 nm using the manufacturer's elemental analysis of the MT peptide with the highest initial purity as the reference standard. The fully alkylated peptides were unusually hydrophilic for their sizes, which were between 2220.8 and 2418.8 m/z (Table I). Furthermore, the ionization intensities of these peptides were comparable when analyzed in the same experiment (supplemental Table S1). The stock reference mixtures for absolute quantitation were tailored to match endogenous MTs in a given cell line. For HK-2(MT-3) cells, 145 μm each of 15N-labeled peptides MT-2, MT-3, MT-1E, MT-1G2, MT-1X, MT-1M, and MT-1F were used. For the breast cells, 100 μm each of 15N-labeled peptides MT-2, MT-1E, and MT-1X were used.

Table I. Identification of acetylated N-terminal MT peptides in human cell lines and tissues. Human MT isoforms were identified via mass spectrometry based on their unique N-terminal tryptic peptides. Masses of singly protonated precursor ions (MH1+) include N-terminal acetylation and carbamidomethylation of Cys residues. Experimental masses (not shown) were consistently within 50 ppm of the expected m/z. Retention times are based on optimized RP-HPLC and are given to indicate the relative order of MT peptide elution. Mascot ion scores represent the highest scoring MS/MS spectrum for each peptide from 15N-labeled synthetic peptides and 14N-labeled endogenous peptides (see supplemental Figs. S1 and S2). Breast ER+ cell lines are MCF-7 and T-47D. Breast ER− cell lines are MCF-10A, Hs578T, and MDA-MB-231. The MT-1G1 and MT-1G2 isoforms are splice variants of the MT1G gene. The UniProt database lists the MT-1M sequence shown here as a natural variant that differs by a single Thr-to-Lys transition at position 20. The sequences are aligned to illustrate single amino acid insertions in MT1-G1 and MT-3. Red residues differ from the consensus sequence. Isoform identification was consistent across at least three biological replicates for each cell line or group of cell lines. Tissue identifications were consistent across at least three independent measurements from a single biological specimen.

graphic file with name zjw004144724t001.jpg

Trypsin Digestion

For relative quantitation, which was done only for HK-2 cells, 300 μg each of 14N-labeled control cytosol and 15N-labeled Cd2+-treated cytosol were combined. For absolute quantitation, which was done for HK-2 cells and breast cell lines, 1 μl of 15N-labeled MT peptide reference mix was added to 300 μg of 14N-labeled cytosol. Samples were incubated with modified trypsin (2% w/w; Trypsin Gold, Promega, Madison, WI) overnight at 37 °C. The reaction was stopped by the addition of formic acid to a 0.1% final concentration. Peptides were desalted online via HPLC through a self-packed Magic C18AQ column (200-Å pore size, 5-μm-diameter particles; Michrom Bioresources, Auburn, CA) using 0.15 ml/min 0.1% formic acid for 20 min. The peptides were then eluted onto the strong cation exchange (SCX) column using a 500-μl injection of 75% acetonitrile and 0.1% formic acid.

Chromatography

Peptides were fractionated on a self-packed 2.1 mm by 25 cm poly LC polysulfoethyl A (SCX) analytical column equilibrated with 0.1% formic acid and eluted with a 60-min linear gradient to 25% buffer containing 0.1% formic acid, 1 m NaCl, and 10% acetonitrile at 0.15 ml/min. Fractions were collected every 7 min and screened by mass spectrometry to locate the MT peptides. The MT-peptide-containing fraction was evaporated to dryness and reconstituted in 24 μl of 8 m HCl containing 0.5 m dimethyl sulfide. The reaction was incubated for 30 min at room temperature to reduce methionine sulfoxides (42). The reaction was then quenched by the addition of 12 μl of 5 m NaOH. Precipitated salt was pelleted by centrifugation at 14,000 × g for 2 min at room temperature and the supernatant was collected. The sample was immediately loaded onto a self-packed 100 μm by 10 cm Magic C18AQ column using a Tempo LC-MALDI (AB SCIEX, Framingham, MA) integrated nano-HPLC/spotter. The column was equilibrated with 97% buffer A (0.1% formic acid, 2% acetonitrile) and 3% buffer B (0.1% formic acid, 98% acetonitrile) at a flow rate of 0.8 μl/min, and peptides were fractionated with a 70-min linear gradient of 3% buffer B/97% buffer A to 20% buffer B/80% buffer A. Fractions were spotted every 18 s onto a MALDI target plate with post-column mixing of an equal volume of 10 mg/ml α-cyano-4-hydroxycinnamic acid in 75% acetonitrile, 0.1% formic acid. The column was recycled with 70% buffer B/30% buffer A for 5 min and then re-equilibrated with 3% buffer B for 10 min.

Mass Spectrometry

The samples were analyzed via MS and MS/MS using an AB SCIEX 4800 MALDI-TOF/TOF mass spectrometer. For MS, the laser intensity was 3200 to 3500 and spectra were accumulated over 30 subspectra at 30 shots per subspectrum. The precursor ion mass range was limited to m/z 1800–3000. The resolution was typically 15,000. For MS/MS, the laser intensity was 4000, and spectra were accumulated over 30 subspectra at 30 shots per subspectrum. Unprocessed .t2d files were centroided and converted to .mgf files using the Peaks to Mascot tool in the AB Sciex 4000 Explorer software (version 3.5.28193). MT peptides were identified using Mascot version 2.3.02 (Matrix Science Inc., Boston, MA). Spectra were searched against the human proteome (34,765 sequences) in the UniProt protein database (version 15.15). False discovery rates were not determined, as the objective of the database search was to confirm the identities of a handful of well-characterized peptides. The peptide mass tolerance was 1.2 Da, and the fragment ion tolerance was 0.6 Da. The enzyme was set as trypsin with up to two missed cleavages. Cysteine 15N-carbamidomethylation was allowed as a fixed modification. Variable modifications were acetylation (protein N-term), methionine oxidation, and cysteine 14N-carbamidomethylation. The use of 14N- and 15N-carbamidomethylation in this combination permitted the identification of either 14N-labeled or 15N-labeled MT peptides in a single search. Peptide mass errors were typically less than 100 ppm. Mascot ion scores were routinely between 60 and 150 for MT peptides. Annotated spectra were graphically represented using Scaffold v.3 (Proteome Software, Portland, OR).

Relative and Absolute Quantitation

The mean monoisotopic peak intensity was determined for each 14N- and 15N-labeled MT peptide precursor ion across three to five spots spanning the precursor ion peak. The minimum signal-to-noise ratio accepted for a given peak was 20. The mass difference between pairs of 14N- and 15N-labeled MT precursor ion pairs was 5 Da. Intensities of the 15N-labeled monoisotopic peaks were corrected for the contribution of the overlapping 14N peptide n + 6 isotopic peak using the equation Hcorr = H − L × C − P × (H − L × C), where H and L are the areas of the monoisotopic peaks of the 15N- and 14N-labeled precursor ions, respectively, C is the fractional contribution of the 14N-labeled precursor ion n + 6 isotopic peak calculated using MS-Isotope (Protein Prospector), and P is the fractional atom percent of 14N in 15N iodoacetamide (0.01 according to the manufacturer).

Real-time Analysis of MT Isoform mRNA Expression

Total RNA was purified from cell pellets using the manufacturer's standard TRI Reagent (Molecular Research Center, Cincinnati, OH) protocol. Real time RT-PCR measurement of MT mRNA expression was done according to Ref. 43 utilizing previously described MT isoform-specific primers (37), except for MT-1M. The MT-1M primers were sense GGGCCTAGCAGTCG and antisense TGGCTCAGTATCGTATTG with a product size of 322 base pairs. The primer sequences used for 18S rRNA expression were sense CGCCGCTAGAGGTGAAATTC and antisense TTGGCAAATGCTTTCGCTC with a product size of 62 base pairs. Cycling parameters for 18S rRNA and all MT isoforms except MT-1M consisted of a reverse-transcription step at 50 °C for 10 min, denaturation at 95 °C for 15 s, annealing at 65 °C for 40 s, and extension at 72 °C for 40 s. Parameters for MT-1M were identical, except that 62 °C was used as the annealing temperature.

Statistical Analysis

All results from cell lines are reported as the mean ± S.D. of three biological replicates. The mean coefficient of variance (cv) was 0.19 for all reported mass-spectrometry-based results. The mean cv was 0.26 for all reported real-time PCR measurements. Variation across three technical replicates for each of 19 independent mass-spectrometry-based measurements gave a mean cv of 0.11. Significant differences of p < 0.05 were determined with GraphPad Prism 6 using statistical treatments appropriate for the type of experiment as described in the figure legends.

RESULTS

Identification of Endogenous N-terminal MT Peptides

The purpose of this study was to develop a robust mass-spectrometry-based method for quantifying human MT isoforms to complement mRNA-based studies that implicate MTs as potential biomarkers for specific diseases. One-dimensional RP-HPLC was optimized to reproducibly capture the large, hydrophilic, acetylated N-terminal tryptic peptides of human MT isoforms. This method, as described under “Experimental Procedures,” was applied for the identification of MT isoforms in Cd2+-induced HK-2(MT3) human kidney epithelial cell cytosol. Seven MT isoforms were identified (Table I) and confirmed by MS/MS (supplemental Figs. S2A, S2B, S2D, and S2F–S2I). The heat map shown in Fig. 1A shows that this one-dimensional separation was sufficient to segregate the MT peptides from the typical smaller early-eluting and larger more hydrophobic tryptic peptides. A second chromatography step was introduced to reduce sample complexity and improve sampling depth. SCX chromatography effectively separated the weakly binding MT peptides from the bulk of tryptic peptides (supplemental Fig. S3). This result was consistent with the general SCX fractionation pattern of N-terminally acetylated peptides (44). Fig. 1B shows a heat map of the RP-HPLC of the SCX fraction containing MT peptides. It illustrates the high degree of enrichment of the MT peptides achieved with this orthogonal fractionation strategy (boxed area). This two-dimensional approach was critical to increasing the sensitivity of MT-peptide detection in HK-2(MT3) cells that had not been exposed to heavy metal. Only three isoforms (MT-1E, MT1-X, and MT-2) were detected in these uninduced cells by means of RP-HPLC alone, and their signals were very weak (not shown). Using the two-dimensional approach, six of the seven MT isoforms originally detected in Cd2+-induced cells were also detected in uninduced cells (Table I). Increasing the starting amount of cytosol from 300 μg to 800 μg did not produce additional detections of N-terminal MT peptides (data not shown).

Fig. 1.

Fig. 1.

Metallothionein N-terminal peptides cluster as a distinct group during one- and two-dimensional LC-MS. Heat maps show the retention time and mass-to-charge ratio of precursor ions detected by RP-HPLC followed by MALDI-TOF mass spectrometry as described under “Experimental Procedures.” A, one-dimensional chromatography in which unfractionated tryptic peptides from Cd2+-induced HK-2(MT3) cell cytosol were applied directly to the C18 column. B, two-dimensional chromatography in which N-terminal MT peptides were fractionated by SCX chromatography and then the early-eluting MT peptide-containing fraction was applied to the C18 column. The boxed precursor ions are the MT peptides. The most intense ions in this region are fully alkylated and N-terminally acetylated, and their methionine residues are unoxidized.

The complement of expressed MT isoforms was surveyed in other human cell lines and tissues (Table I). Each tissue or cell type had a unique MT isoform fingerprint. Kidney cortex, cerebrum, and the RWPE prostate cell line each expressed seven isoforms. Notably, both MT-1G splice isoforms, MT-1G1 and MT-1G2, were expressed in kidney, brain, and RWPE cells, whereas only MT-1G2 was detected in HK-2(MT3) cells. The MT-1M isoform was not detected in kidney or brain, compared with HK-2 and RWPE cells. Kidney was the only tissue or cell type that expressed MT-1H, and brain was the only one that expressed endogenous MT-3. The MT profile of breast epithelial cells was more restricted. The ER− breast epithelial cell lines expressed MT-2, MT-1X, and MT-1E, whereas ER+ breast epithelial cell lines expressed only MT-2 and MT-1X. Cumulatively, 9 of the 12 MT isoforms were detected in at least one tissue or cell type. The MS/MS results of these endogenous peptides are shown collectively in supplemental Fig. S2. Isoforms not detected included MT-1A, MT-1B, and MT-1L.

N-terminal Modifications of Endogenous MTs

Nearly all N-terminal peptides from endogenous MTs were N-terminally acetylated. A small amount of unmodified MT-2 (10% or less of total MT-2 signal; not shown) was routinely detected in one-dimensional separation of Cd2+-induced HK-2(MT3) cytosol. A trace amount of unmodified MT-1E was observed once, but not for any of the other MTs. Unacetylated N-terminal MT peptides were separated from the acetylated forms at the SCX step and therefore were not factored into quantitation.

As much as 40% of the total ion signal for a given N-terminal MT peptide was in the methionine sulfoxide form, observed as 16-Da increases in mass and hydrophilic shifts during RP-HPLC (Fig. 2A). This is considered a high degree of oxidation based on a recent quantitative proteomic study of intracellular methionine oxidation in human Jurkat cells (45). Though N-terminal MT peptides were not detected by the authors, the acetyl-Met-Asp-Pro sequence of MT N termini would classify it as highly susceptible to oxidation based on sequence preferences revealed by this study. The susceptibility of these peptides to oxidation was reinforced by the observation that the addition of synthetic MT peptides to cytosol led to a similar degree of oxidation as in the corresponding endogenous peptides (Fig. 2B). This oxidation appeared to occur before the chromatography steps. Further experiments are needed to determine whether methionine oxidation of MTs occurs in vivo or is a sample handling artifact.

Fig. 2.

Fig. 2.

Metallothionein N-terminal peptides are susceptible to methionine oxidation. Cytosol from untreated HK-2(MT3) cells (800 μg) was alkylated with 14N-iodoacetamide. An internal standard of 206 pmol 15N-MT-3 peptide was added. The cytosol was digested with trypsin. The MT peptides were enriched via two-dimensional liquid chromatography followed by MALDI-TOF mass spectrometry as described under “Experimental Procedures,” except without the dimethyl sulfide reduction step. A, extracted ion chromatogram from 2000 to 2800 m/z less the ion intensities of the oxidized and unoxidized MT-3 internal standard. Ion intensities contributed by the N-terminal MT peptides dominate this region. Peaks associated with individual isoforms and their oxidized (ox) forms are annotated accordingly. The maximum peak intensity was 3.1 × 105. B, combined extracted ion chromatograms of the 15N-MT-3 internal standard (2423.63 ± 0.1 m/z) and its oxidized form (2439.78 ± 0.1 m/z). The maximum peak intensity was 3.2 × 105.

For purposes of quantitation, it was important to control for the potential variability of methionine oxidation in MTs. Dimethyl sulfide is effective in reversing this modification (42, 46). Fig. 3 illustrates this with the purified, alkylated MT3 N-terminal peptide. Oxidation of the peptide with hydrogen peroxide caused a hydrophilic shift in RP-HPLC (Fig. 3A). The hydrophilic status reverted to that of the unoxidized form after dimethyl sulfide treatment (Fig. 3B), collapsing the split signal in Fig. 3A to a single precursor ion.

Fig. 3.

Fig. 3.

Reversible oxidation and acid cleavage of acetylated N-terminal MT peptides. Purified, carbamidomethylated, acetylated MT-3 peptide was subjected to the indicated chemical treatment and then separated via RP-HPLC as described for peptide purification under “Experimental Procedures,” except the gradient was for one hour from 0% to 60% acetonitrile, 0.1% formic acid. Under these conditions the native peptide elutes at about 19 min and the oxidized peptide elutes at about 18 min. Peptide truncated at the Asp-Pro bond elutes before the oxidized form. Peptide treatment before chromatography: (A) 30 min at 30 °C in 0.1% hydrogen peroxide, 1% acetic acid; (B) oxidized peptide in A was incubated for 30 min at room temperature in 0.5 m dimethyl sulfide and 8N HCl as described under “Experimental Procedures”; and (C) unoxidized peptide was incubated for 30 min at 100 °C in 0.1% formic acid.

In addition to acetylation and oxidation, early experiments showed some truncations of N-terminal peptides, most notably the loss of acetyl-Met-Asp (not shown). The Asp-Pro peptide bonds at the 2–3 position in MTs (47) and in other proteins (48) are acid labile. This susceptibility to cleavage might explain in part why multiple N-terminal MT truncations are observed in the PeptideAtlas database (49, 50). Stoichiometric Asp-Pro cleavage of equine renal MT is achieved with 70% formic acid for 96 h at 40 °C. In contrast, incubation of rat liver MT in 70% formic acid for as much as 70 h at 23 °C does not cause Asp-Pro cleavage (51). We found that extended incubation at 4 °C in 0.1% formic acid or brief heating in inadequately buffered conditions was sufficient to generate detectable truncated N-terminal MT peptides (see supplemental Fig. S4 for an example). The susceptibility of these peptides to cleavage was confirmed by incubating the purified MT-3 peptide for 30 min at 100 °C in 0.1% formic acid, which was sufficient to convert most of the peptide to the truncated form (Fig. 3C). The acidic conditions required for methionine sulfoxide reduction did not cause perceptible Asp-Pro bond cleavage (Fig. 3B). As a result of these observations, extra precautions were taken to minimize exposure of the samples to low pH and elevated temperature.

Validation of 14N- and 15N-iodoacetamide for Quantitation of N-terminal MT Peptides

The enhanced sensitivity gained with two-dimensional LC and the simplification of precursor ion complexity with dimethyl sulfide treatment were critical for accurate quantitative profiling of MT isoforms. We selected 15N-iodoacetamide as a stable isotope-labeled alkylating agent because it is commercially available, gives a cumulative mass shift of 5 Da for N-terminal MT peptides, and is well characterized for its cysteine-specific reactivity in peptides. This reagent has not been widely used in typical stable isotope labeling experiments because a single Dalton mass shift would complicate quantitation due to the high degree of isotopic envelope overlap. The suitability of 15N-iodoacetamide for the quantitation of MT peptides was evaluated. Extracted ion chromatograms of equimolar mixtures of endogenous 14N- and 15N-labeled N-terminal MT peptides from Cd2+-induced HK-2(MT3) cells (Fig. 4) showed no chromatographic effects due to isotope labeling for any of the peptides. These properties were recapitulated with14N-labeled cytosol containing 15N-labeled reference peptides (not shown). The assay was linear over 2 orders of magnitude (Fig. 5). Combined, these results indicate that the optimized MT peptide quantitation strategy is sensitive and reproducible over a wide dynamic range.

Fig. 4.

Fig. 4.

The 14N- and 15N-labeled N-terminal MT peptides have similar chromatographic and ionization properties. Equal amounts of cytosols from Cd2+-induced HK-2(MT3) cells were alkylated with 14N- or 15N-iodoacetamide, combined, and digested with trypsin. The N-terminal MT peptides were enriched as described under “Experimental Procedures” and analyzed via MALDI-TOF/TOF-MS. Extracted ion chromatograms for each MT peptide were based on the observed MH1+ monoisotopic mass ± 0.1 m/z. Isoforms are color-coded as follows: MT-1E, yellow; MT-1F, green; MT-1G2, gray; MT-1M, magenta; MT-1X, cyan; MT-2, blue; and MT-3, red. The lighter shaded lines are 14N-labeled peptides. The mostly hidden co-elution darker shaded lines are the corresponding 15N-labeled MT peptides. The maximum peak intensity was 1 × 106.

Fig. 5.

Fig. 5.

Sensitivity and dynamic range of MT-2. A 2-fold serial dilution of 14N-labeled HK-2(MT3) cytosol was mixed with a constant amount of 15N-labeled cytosol and the samples were digested, fractionated, and analyzed as described under “Experimental Procedures.” A 1:1 correlation was observed for observed versus calculated 14N/15N MT-2 ratios over 2 orders of magnitude (r2 = 0.996). The signal-to-noise ratio for these samples ranged from 3 to 109.

A representative experiment in which 15N-labeled MT reference peptides were used for quantitation is illustrated in Fig. 6. As in Fig. 2A, the MT peptides dominated the early-eluting portion of the gradient in the mass range above 1910 m/z (Fig. 6A). Peptide mass fingerprints of peak fractions for each MT peptide (Fig. 6B) indicate that with the exception of MT-1G2, non-targeted precursors did not interfere with quantitation. Expanded peptide mass fingerprints (1910 to 2710 m/z) of the peak MT fractions further reinforce the conclusion that MT N-terminal peptides dominate this chromatographic and m/z region (supplemental Fig. S5). The high quality of spectra was consistently maintained throughout all biological replicates for the HK-2 and breast epithelial cell lines that were examined.

Fig. 6.

Fig. 6.

Absolute quantitation of N-terminal MT peptides in HK-2(MT3) cells using 15N-labeled reference peptides. Confluent domed HK-2(MT3) cells were maintained for 3 days in the absence or presence of 9 μm Cd2+. Cytosols were prepared and analyzed as described under “Experimental Procedures.” Briefly, 300 μg of each were reduced and alkylated with 14N-iodoacetamide and 15N-labeled MT reference peptides were added. Samples were trypsin-digested and MT peptides were enriched via two-dimensional liquid chromatography. Methionine oxidation was reversed by dimethyl sulfide treatment. Peptides were analyzed via MALDI-TOF/TOF-MS. A, extracted ion chromatograms (1910 to 2710 m/z) for samples from untreated and Cd2+-treated cells. Low levels of some oxidized MT peptides (ox) were still detectable even after dimethyl sulfide treatment. Very low levels of MT-3 peptide cleaved at the Asp-Pro bond (Δ) were also observed. Observed oxidized and truncated products are linked to their parent peptides with brackets. The maximum peak intensity was 1.9 × 106 and 3.4 × 105 for untreated and Cd2+-treated cells, respectively. B, peptide mass fingerprints of each MT peptide from A showing a 50 Da region centered on the m/z of the 15N-labeled reference peptide (see Table I for individual masses). See supplemental Fig. S5 for expanded versions for each of these MS spectra. Individual isoforms are designated by colors as in Fig. 4. The isotopic envelope of each 14N-labeled MT peptide is indicated (*).

Commercially available 13C2-iodoacetic acid was also evaluated for its suitability for quantitative analysis of MT peptides. This compound gave a cumulative mass shift of 10 Da, and no isotope effects were observed (not shown). The increased hydrophilicity introduced by the carboxylates weakened their retention during RP-HPLC sufficiently to compromise reproducible quantitation.

Quantitation of MT mRNA and Protein Expression in Cd2+-exposed HK-2(MT3) Cells

MTs in the kidney, in particular in the proximal tubule epithelia, are highly responsive to Cd2+ exposure. Consequently, there has been much effort to evaluate kidney MTs as potential biomarkers for heavy metal toxicity. The immortalized HK-2 human proximal epithelial cell line is a convenient model for studying proximal tubule cell function (52). In contrast to human proximal tubule cells, HK-2 cells have lost expression of MT-3 (53). Restoration of this gene causes the cells to dome and exhibit vectorial active transport similar to human proximal tubule cells grown in culture (38). The MT mRNA expression of human proximal tubule cells has been qualitatively evaluated via RT-PCR (19, 54, 55) and Northern blot analysis (56, 57). Combined, these studies paint a broad picture of MT isoform mRNA expression of MT-3, MT-2A, MT-1A, MT-1E, MT-1F, and MT-1X, and possibly of MT-1G. Of these, at least MT-1A and MT-1E are induced by Cd2+ exposure. In these same studies, protein expression was determined based on immunohistochemistry and dot blot Westerns using the E9 antibody. The MT-1/2 protein expression was induced at least 30-fold upon 3 days of exposure to Cd2+. The quantitation of individual MT isoforms and their induction at the protein level by Cd2+ has not yet been described. Real-time quantitative PCR and the mass-spectrometry-based MT isoform assay were applied to this model system to provide a higher resolution, more quantitative assessment of MT expression in this cell type. The use of the HK-2 cell line stably transfected with MT-3 (HK-2(MT3)) provided further opportunity to compare the cytomegalovirus (CMV) promoter-driven MT-3 gene expression, designed for high-efficiency protein expression, with the endogenous MT-1 and MT-2 counterparts.

The mRNA expression of human MT isoforms in HK-2(MT3) cells was determined via real-time quantitative PCR (Fig. 7A, supplemental Table S2). These results are consistent with previous analyses of human proximal tubule cells with respect to MT-1E and MT-2 being the most abundant species. Unlike in previous studies, MT-1A was not observed. Of the seven isoforms detected in this study, MT-1M was previously unreported for HK-2 cells.

Fig. 7.

Fig. 7.

mRNA and protein expression of MT isoforms in HK-2(MT3) Cells. Confluent, domed HK-2(MT3) cells were maintained for 3 days in the absence (hatched bars) or presence (solid bars) of 9 μm Cd2+. Individual isoforms are designated by colors as in Fig. 4. A, MT isoform mRNA expression was determined via real-time quantitative PCR and normalized to 1 × 106 18S rRNA transcripts. B, MT isoform protein expression was determined from data like those shown in Fig. 6. Absolute quantitation was as described under “Experimental Procedures.” Values were normalized to 1 μg of cytosolic protein. The control and treated values for each isoform in A and B were subjected to a two-tailed unpaired t test followed by Tukey's post-test (*p < 0.05). C, ratios of protein and mRNA were determined from the same biological replicates shown in A and B. One-way analysis of variance followed by Tukey's post-test was done independently for the −Cd2+- and +Cd2+-treated cells. The protein/mRNA ratios of isoforms that were significantly different from MT-1E are indicated with an asterisk (*p < 0.05). All experiments represent the mean and standard deviation of three independent biological replicates.

The absolute protein abundance of individual MT isoforms was determined in HK-2(MT3) cells using the 15N-labeled synthetic MT peptides as internal standards. A mixture containing the seven N-terminal MT peptides observed in HK-2(MT3) cells was added to cytosols that had been alkylated with 14N-iodoacetamide. The spiked cytosols were then trypsin-digested and the N-terminal MT peptides were enriched and analyzed as above. MT isoforms were quantified for both uninduced and Cd2+-induced cells (Fig. 7B, supplemental Table S3). The 300 μg of total cytosolic protein used for each experiment was equivalent to the cytosolic protein content of ∼3.7 × 106 cells. Assuming a volume of 0.1 pl per cell, the intracellular concentration for MT isoforms ranged from 0.03 mm for MT-1F in uninduced cells to 2 mm for MT-2 in Cd2+-induced cells (0.11 to 7.28 ng per μg total protein, or 1.8 to 120 million copies per cell, respectively). The six MTs detected in the uninduced cells accounted for 0.33% of total protein, whereas the seven MTs detected in Cd2+-induced cells accounted for 1.46% of the total cytosolic protein. At 1.8 to 120 million copies per cell, all detected MT isoforms qualify as high-abundance proteins based on criteria described by Beck and colleagues (58).

The fold induction determined by the absolute quantitation method was comparable to values measured by the relative method in which equal parts of cytosol from 14N-labeled uninduced and 15N-labeled Cd2+-induced cells were combined and analyzed (Table II). The MT-1F isoform showed the highest induction at 12-fold. The MT-3 isoform, under the control of the CMV promoter (38) which is not responsive to metals, was induced only 1.7-fold. The lack of detection of MT-1M protein in uninduced HK-2(MT3) cells suggests that MT-1M may be present but at levels below the detection threshold of the mass-spectrometry-based assay.

Table II. Fold-induction of MT isoform mRNA and protein expression in Cd2+-exposed HK-2(MT3) cells. The mRNA values were calculated from quantitative PCR data (see supplemental Table S2 and Fig. 7A). Protein induction was calculated from mass spectrometry data using the absolute (supplemental Table S3 and Fig. 7B) and relative (not shown) quantitation methods. The fold induction of MT-1M could not be calculated because it was not detectable in uninduced cells. Values are the mean of three biological replicates ± standard deviation. Protein values for a given isoform that are significantly different from the corresponding mRNA value are indicated (*p < 0.05) as determined by one-way analysis of variance followed by a Tukey's post-test.
Isoform mRNA Protein
Relative Absolute
MT-1E 3.1 ± 0.4 6.2 ± 1.1* 5.9 ± 0.5*
MT-1F 3.1 ± 0.4 12.0 ± 2.8* 9.9 ± 1.9*
MT-1G2 5.0 ± 0.6 5.2 ± 0.5 5.4 ± 1.3
MT-1M 1.6 ± 0.5 - -
MT-1X 5.2 ± 0.4 5.6 ± 0.9 4.7 ± 1.8
MT-2 3.2 ± 0.9 4.8 ± 1.1 4.3 ± 0.9
MT-3 1.7 ± 0.1 1.7 ± 0.1 1.8 ± 0.2

The quantitative PCR and mass spectrometric analysis described above permitted comparisons of protein-to-mRNA ratios across MT isoforms. The relative order of MT isoform abundance differed between mRNA and protein expression. For example, MT-1E mRNA was the most abundant, whereas MT-2 protein levels were greatest (compare Figs. 7A and 7B). Fig. 7C shows the protein/mRNA ratios of each MT isoform. The protein/mRNA ratio for MT-1E was one-tenth that of MT-2. In contrast, the ratios for MT-1X, MT-1G2, MT-1F, and MT-1M were within 2-fold of each other whether determined from Cd2+-induced or uninduced cells. Recombinant MT-3, which is driven by a promoter designed to maximize protein expression, has a protein/mRNA ratio that is at least 7-fold greater than that of any other isoform. Collectively, these results suggest that MT-1E protein expression is less efficient than that of other endogenous MT isoforms, and that as a class MT isoforms demonstrate protein expression efficiency that is markedly less than that of the protein-expression-optimized recombinant MT-3.

Quantitation of MT Isoforms in Human Breast Epithelial Cancer Cells

Previous studies demonstrated that the expression of MT mRNA was limited to MT-2, MT-1E, and MT-1X in human breast ductal epithelia and spontaneously immortalized and cancer cell lines derived from human breast epithelia (26, 41). Cancer cell lines were further distinguished by the much higher expression of these isoforms in ER− cells than in ER+ cells (26). Antibody-based methods showed a similar increase in general MT-1/2 protein expression. The mRNA and protein measurements in these studies were semi-quantitative. This model system was selected as a test case to quantitatively compare MT isoform-specific mRNA and protein expression.

Quantitative real-time PCR showed that mRNA expression was limited to MT-2, MT-1E, and MT-1X in the ER− Hs578T and MDA-MB-231 cancer cell lines and in the spontaneously immortalized nontumorigenic MCF-10A cell line, whereas only MT-2 and MT-1X were detected in the ER+ MCF-7 and T47D cell lines (Fig. 8, left-hand panels; supplemental Table S4). The ER− cell lines had characteristically more MT mRNA expression than their ER+ counterparts. These general observations are consistent with the previously published qualitative data on the same cell lines (26, 41). Transcript levels in the current study spanned a 400-fold dynamic range.

Fig. 8.

Fig. 8.

mRNA and protein expression of MT isoforms in human breast epithelial cell lines. MT isoform mRNA (left-hand panels) and protein (right-hand panels) expression was determined as described for Fig. 7. The ER+ (MCF-7 and T-47D) and ER− (MCF-10A, MDA-MB-231, and Hs578T) cell lines were cultured and harvested as described under “Experimental Procedures.” All experiments represent the mean and standard deviation of three independent biological replicates. Statistical significance (*p < 0.05) between either MCF-7 or T-47D cells and any of the ER− cell lines was determined via one-way analysis of variance followed by a Tukey's post-test. Asterisks in parentheses indicate that the significance applies only to comparison with the T-47D cell line.

Preliminary screening for N-terminal MT peptides via mass spectrometry revealed the same complement of MT isoforms identified at the mRNA level, including the restriction of MT-1E expression to ER− cell lines. These isoforms were quantified using 15N-labeled MT-2, MT-1E, and MT-1X peptides as internal standards (Fig. 8, right-hand panels; supplemental Table S5). The dynamic range of individual MT isoform expression was 38-fold. The dynamic range of total MT isoform expression was 13-fold. This is seven times greater than the 1.8-fold dynamic range in MT-1/2 expression observed earlier with antibody-based methods (26).

The MT-1E isoform represents 30% to 50% of all MT transcripts but only 10% to 18% of all MT protein in ER− cell lines. This appears to be due primarily to an MT-1E protein/mRNA ratio 4- to 6-fold less than that of either MT-1X or to MT-2 (not shown). In conclusion, MT-1E is not detectable in ER+ cells at either the mRNA or the protein level, but it is actively transcribed and translated in ER− cells. The expression efficiency of MT-1E protein relative to mRNA, however, is reduced relative to the two other MT isoforms that are expressed in all breast cancer cell lines tested.

DISCUSSION

The special properties of human MT isoforms present challenges that until now have prevented their accurate characterization at the protein level in complex biological samples. This includes their small size, high cysteine content, highly conserved structure, and large number of isoforms. Antibody-based methods have been routinely used to quantify MT expression in tissues, but the limited specificity of reagents and the potential influence of post-translational modifications upon antigen recognition, physiological or otherwise, compromise the effectiveness of this approach. There is sufficient divergence of the 5′ and 3′ untranslated regions of the MT mRNAs to quantify isoform-specific transcripts, and many PCR-based studies have demonstrated their differential expression in a variety of normal, diseased, or environmentally insulted tissues and cell lines. These changes, however, might not always reflect a one-to-one correlation with protein expression. The mass-spectrometry-based method described in this study addresses many of these challenges.

Detection of MT peptides, especially the critical N-terminal peptides, appears to be sporadic in global proteomic profiling studies. A survey of the Human 2012–10-11 build of the PeptideAtlas database (47, 48) reveals that N-terminal MT peptides are identified in only 10 of 467 samples in the repository. Seven of these datasets have been published (58–62). Combined, these studies identified only three MT N-terminal peptides (MT-2, MT-1E, and MT-1X). Only one study detected the acetylated forms of MT-1X and MT-1E (62). The rest detected only unacetylated forms because N-terminal protein acetylation was not selected as a variable modification for database searches.

Even when N-terminal acetylated proteins are specifically targeted for profiling, the detection of MT peptides is still limited to the abundant MT-2 and MT-1X (63). The COFRADIC approach, which has been successfully applied to the mass spectrometric characterization of many blocked N termini (64, 65), excludes acetylated N-terminal MT peptides because the method requires cleavage at arginine residues, which are absent from all human MTs except MT-4.

Because human MT isoforms are distinguished by only one to three tryptic peptides, the label-free methods utilized in the two PeptideAtlas-referenced studies that reported MT abundance (58, 62) are not sufficiently robust for their accurate quantitation even if N-terminal acetylated peptides are measured. Accurate quantitation is further compromised in global studies that do not incorporate N-terminal acetylation into their search parameters. One can conclude from this survey that most global proteomic profiling strategies are not optimized for MT quantitation and might even yield misleading results.

As reported previously (34) and described in detail here, the only MT peptide that distinguishes all isoforms is the N-terminal tryptic peptide. Because of this, the question of N-terminal acetylation is a critical one for MT quantitation. Edman sequencing of several mammalian MTs in the 1970s and 1980s demonstrated that the N-terminal methionine was acetylated (46, 65–67). This conclusion is consistent with more recent general studies of N termini that show that proteins beginning with Met-Asp, such as human MTs, are almost completely acetylated (63, 65, 68). Other studies utilizing capillary electrophoresis and mass spectrometry detected trace amounts of unacetylated MTs (69–72). The fraction of unacetylated MT-2 reached 20% in livers of zinc-treated rats (70). Unacetylated MT might have physiological relevance, as its metal-binding properties are distinct from those of the acetylated form (71). MTs are likely stoichiometrically N-acetylated except under metal-stressed conditions, when a minor degree of under-acetylation may be observed. Our results are consistent with near-stoichiometric acetylation of all MT isoforms, even in metal-induced cells.

Until this study, the extent of the problem of N-terminal methionine oxidation was not appreciated for MTs. This has serious implications for the quantitation of MT isoforms. Structural studies of MTs based on Edman sequencing or amino acid analysis (46, 51, 66, 67) were not designed to detect the oxidation state of this residue. In all cases the acetylated methionine was removed to unblock the N terminus by means of either cyanogen bromide cleavage (51, 66, 67) or acid cleavage of the Asp-Pro bond at the 2–3 position (46). These methods utilized acidic conditions that favor the reversion of methionine sulfoxide to methionine (73, 74). It is unknown whether oxidized methionine compromises quantitation utilizing anti-MT antibodies that recognize the five most N-terminal residues, including the acetylated methionine, in MT isoforms (29–31). The dimethyl sulfide treatment used in this study eliminated this problem by converting methionine sulfoxides back to methionine.

Reliance on a single distinguishing peptide to identify and quantify the complement of human MT isoforms required the development of a chemical labeling strategy that targeted this peptide. We exploited the unusually high cysteine content of the N-terminal MT peptides to introduce mass tags via isotopically labeled alkylating agents for quantitative profiling, an approach first described in 1998 using deuterated acrylamide (75) and later popularized with the iodoacetamide-based isotopic-coded affinity tag (ICAT) method of quantitative analysis (76). Very few tryptic peptides contain five cysteines. Labeling of MT peptides with 15N iodoacetamide created a distinctive 5-Da mass shift relative to 14N labeling, making them readily distinguishable from the bulk of peptides. Amplification of isotope effects is a potential disadvantage for high-density labeling. This phenomenon has been observed for some isotopically labeled alkylating agents (77–79). We observed no isotope effect on MT peptides with 15N- versus 14N-carbamidomethylation. Chromatographically silent peptide labeling ensures the most accurate quantitation using reference peptides. This might be a particular concern caused by spot-to-spot variability in signal intensity that can occur with MALDI. This labeling and quantitation strategy is not limited to MALDI-TOF/TOF instruments as described here and should be applicable to any LC-MS/MS system, including electrospray ionization platforms.

Human MT isoforms may be amenable to quantitation via selected reaction monitoring. MS/MS of N-terminal MT peptides indicates that each contains appropriate diagnostic fragment ion transitions, and we demonstrate the feasibility of making peptide standards for quantitation. One caveat is that selected reaction monitoring relies on multiple proteotypic peptides in order for each protein to be quantified, which is not possible for the MT family of proteins. Secondly, one rarely sees N-terminal acetylated peptides as proteotypic peptides, probably because this class of peptides tends to be less strongly ionized than internal tryptic peptides. Any selected reaction monitoring approach would likely need to utilize optimized enrichment conditions and the labeled peptide standards described here in order to have adequate sensitivity and reproducibility for quantitation of this class of proteins.

An important finding of this study is that MT mRNA and protein expression levels are not concordant. It is possible that this could be due to the differential stability of mRNAs relative to protein, though half-life measurements of human MT isoform mRNAs have not been done. Alternatively, each MT isoform may have a distinct protein half-life. The influence of metal binding on MT stabilization and proteolytic susceptibility must also be considered because it has been shown that MTs bound to Cd2+ are significantly more protected from degradation (29, 31) and proteolytic cleavage (30, 80, 81). This latter phenomenon is unlikely to explain the results seen here because the protein/mRNA ratios do not change appreciably between Cd2+-treated and untreated cells. One last possibility is that technical limitations associated with the quantitation of peptide standards might be partly responsible for these differences. We attempted to minimize this possibility, but the limiting amounts of 15N-labeled peptide standards prevented independent elemental analysis.

Reduced translational efficiency of MT-1E mRNA is a plausible biological explanation for its low protein/mRNA ratio relative to other MT isoforms. The 5′-untranslated region of MT-1E mRNA is unique among human MT isoforms in that it contains a stable 12-bp GC-rich stem-loop structure positioned 26 bases from its 5′ cap. The stability of the stem loop and its location are consistent with reduced translation efficiency (82). No other MT mRNA has a similar predicted stem-loop as stable as that of MT-1E. Further experiments will be needed to test this hypothesis.

This study also highlights the power of mass spectrometry to detect less abundant forms of MT in human cells. Thus, this study reveals that MT-1M, MT-1F, and MT-1G2 are significant players in metal metabolism along with the more abundant MT-2, MT-1X, and MT-1E in human HK-2 kidney cells.

The discriminating power of mass spectrometry further extends our understanding of MT alternative splice isoforms. Even with the limited number of cell lines and tissues surveyed in this study, it is apparent that the splicing pattern of MT-1G is non-random. MT-1G1 differs from MT-1G2 by the insertion of a single Ala residue at the 3′ splice junction of its first intron. This conditional codon insertion is driven by a NAGNAG alternative splice site (83, 84). Deep RNA sequencing analysis classifies the NAGNAG alternative splicing of MT-1G1/MT-1G2 as highly regulated (84). This single codon differentiation of splice isoforms has not been previously reported in MT expression studies that rely on standard quantitative PCR measurements. Of particular interest is the absence of MT-1G1 in immortalized HK-2 proximal tubule cells, whereas kidney cortex expresses both forms. This suggests that MT-1G1/MT-1G2 ratios may serve as a specific indicator of changes in splicing factors that may be associated with disease states.

In conclusion, this study demonstrates the feasibility of quantifying individual MT isoforms in human cells and tissues at the protein level. The findings are generally consistent with previous studies using human breast and kidney cell lines. The proteomic analysis complements that of mRNA expression by taking into account post-translational modifications, differences in protein expression efficiency, and alternative splicing. This lays the groundwork for the evaluation of MT isoforms as prognostic protein biomarkers in breast cancers and other pathologies. The methodology has potential for application in prospective analyses of tissue biopsies, plasma, or urine and retrospective analysis of formalin-fixed paraffin-embedded tissues.

Supplementary Material

Supplemental Data

Acknowledgments

We thank William M. Old, University of Colorado at Boulder, for constructive feedback and critical reading of the manuscript.

Footnotes

Author contributions: A.A.M., S.H.G., S.S., D.A.S., and J.B.S. designed research; A.A.M. and W.W.M. performed research; W.W.M., S.H.G., S.S., and D.A.S. contributed new reagents or analytic tools; A.A.M. and J.B.S. analyzed data; A.A.M. and J.B.S. wrote the paper.

* This project was supported by INBRE grants to D.A.S. from the National Center for Research Resources (P20 RR016471) and NIGMS (P20 GM103442), National Institutes of Health. A.A.M. was supported with a North Dakota EPSCoR predoctoral fellowship through a grant from the National Science Foundation (EPS-0814442).

Inline graphic This article contains supplemental material.

1 The abbreviations used are:

MT
metallothionein
ER+
estrogen-receptor positive
ER−
estrogen-receptor negative
RP-HPLC
reversed-phase high-pressure liquid chromatography
SCX
strong cation exchange.

REFERENCES

  • 1. Hamer D. H. (1986) Metallothionein. Annu. Rev. Biochem. 55, 913–951 [DOI] [PubMed] [Google Scholar]
  • 2. Vallee B. L. (1995) The function of metallothionein. Neurochem. Int. 27, 23–33 [DOI] [PubMed] [Google Scholar]
  • 3. Vašák M., Meloni G. (2011) Chemistry and biology of mammalian metallothioneins. J. Biol. Inorg. Chem. 16, 1067–1078 [DOI] [PubMed] [Google Scholar]
  • 4. Penkowa M. (2006) Metallothioneins are multipurpose neuroprotectants during brain pathology. FEBS J. 273, 1857–1870 [DOI] [PubMed] [Google Scholar]
  • 5. Bell S. G., Vallee B. L. (2009) The metallothionein/thionein system, an oxidoreductive metabolic zinc link. ChemBioChem 10, 55–62 [DOI] [PubMed] [Google Scholar]
  • 6. Manso Y., Adkard P. A., Carrasco J., Vašák M., Hidalgo J. (2011) Metallothionein and brain inflammation. J. Biol. Inorg. Chem. 16, 1103–1113 [DOI] [PubMed] [Google Scholar]
  • 7. Nordberg G. F. (2009) Historical perspectives on cadmium toxicology. Toxicol. Appl. Pharmacol. 238, 192–200 [DOI] [PubMed] [Google Scholar]
  • 8. Mocchegiani E., Bertoni-Freddari C., Marcellini F., Malavolta M. (2005) Brain, aging and neurodegeneration: role of zinc ion availability. Prog. Neurobiol. 75, 367–390 [DOI] [PubMed] [Google Scholar]
  • 9. Cherian M. G., Jayasurya A., Bay B. H. (2003) Metallothioneins in human tumors and potential roles in carcinogenesis. Mutat. Res. 533, 201–209 [DOI] [PubMed] [Google Scholar]
  • 10. Pedersen M. O., Larsen A., Stoltenberg M., Penkowa M. (2009) The role of metallothionein in oncogenesis and cancer prognosis. Prog. Histochem. Cytochem. 44, 29–64 [DOI] [PubMed] [Google Scholar]
  • 11. Laukens D., Waeytens A., De Bleser P., Cuvelier C., De Vos M. (2009) Human metallothionein expression under normal and pathological conditions: mechanisms of gene regulation based on in silico promoter analysis. Crit. Rev. Eukaryot. Gene Expr. 19, 301–317 [DOI] [PubMed] [Google Scholar]
  • 12. Martin J., Han C., Gordon L. A., Terry A., Prabhakar S., She X., Xie G., Hellsten U., Chan Y. M., Altherr M., Couronne O., Aerts A., Bajorek E., Black S., Blumer H., Branscomb E., Brown N. C., Bruno W. J., Buckingham J. M., Callen D. F., Campbell C. S., Campbell M. L., Campbell E. W., Caoile C., Challacombe J. F., Chasteen L. A., Chertkov O., Chi H. C., Christensen M., Clark L. M., Cohn J. D., Denys M., Detter J. C., Dickson M., Dimitrijevic-Bussod M., Escobar J., Fawcett J. J., Flowers D., Fotopulos D., Glavina T., Gomez M., Gonzales E., Goodstein D., Goodwin L. A., Grady D. L., Grigoriev I., Groza M., Hammon N., Hawkins T., Haydu L., Hildebrand C. E., Huang W., Israni S., Jett J., Jewett P. B., Kadner K., Kimball H., Kobayashi A., Krawczyk M. C., Leyba T., Longmire J. L., Lopez F., Lou Y., Lowry S., Ludeman T., Manohar C. F., Mark G. A., McMurray K. L., Meincke L. J., Morgan J., Moyzis R. K., Mundt M. O., Munk A. C., Nandkeshwar R. D., Pitluck S., Pollard M., Predki P., Parson-Quintana B., Ramirez L., Rash S., Retterer J., Ricke D. O., Robinson D. L., Rodriguez A., Salamov A., Saunders E. H., Scott D., Shough T., Stallings R. L., Stalvey M., Sutherland R. D., Tapia R., Tesmer J. G., Thayer N., Thompson L. S., Tice H., Torney D. C., Tran-Gyamfi M., Tsai M., Ulanovsky L. E., Ustaszewska A., Vo N., White P. S., Williams A. L., Wills P. L., Wu J. R., Wu K., Yang J., Dejong P., Bruce D., Doggett N. A., Deaven L., Schmutz J., Grimwood J., Richardson P., Rokhsar D. S., Eichler E. E., Gilna P., Lucas S. M., Myers R. M., Rubin E. M., Pennacchio L. A. (2004) The sequence and analysis of duplication-rich human chromosome 16. Nature 432, 988–994 [DOI] [PubMed] [Google Scholar]
  • 13. Uhlen M., Oksvold P., Fagerberg L., Lundberg E., Jonasson K., Forsberg M., Zwahlen M., Kampf C., Wester K., Hober S., Wernerus H., Björling L., Ponten F. (2010) Towards a knowledge-based Human Protein Atlas. Nat. Biotechnol. 28, 1248–1250 [DOI] [PubMed] [Google Scholar]
  • 14. Uhlén M., Björling E., Agaton C., Szigyarto C. A., Amini B., Andersen E., Andersson A. C., Angelidou P., Asplund A., Asplund C., Berglund L., Bergström K., Brumer H., Cerjan D., Ekström M., Elobeid A., Eriksson C., Fagerberg L., Falk R., Fall J., Forsberg M., Björklund M. G., Gumbel K., Halimi A., Hallin I., Hamsten C., Hansson M., Hedhammar M., Hercules G., Kampf C., Larsson K., Lindskog M., Lodewyckx W., Lund J., Lundeberg J., Magnusson K., Malm E., Nilsson P., Odling J., Oksvold P., Olsson I., Oster E., Ottosson J., Paavilainen L., Persson A., Rimini R., Rockberg J., Runeson M., Sivertsson A., Sköllermo A., Steen J., Stenvall M., Sterky F., Strömberg S., Sundberg M., Tegel H., Tourle S., Wahlund E., Waldén A., Wan J., Wernérus H., Westberg J., Wester K., Wrethagen U., Xu L. L., Hober S., Pontén F. (2005) A human protein atlas for normal and cancer tissues based on antibody proteomics. Mol. Cell. Proteomics 4, 1920–1932 [DOI] [PubMed] [Google Scholar]
  • 15. Schmidt C. J., Hamer D. H. (1986) Cell specificity and effect of ras on human MT gene expression. Proc. Natl. Acad. Sci. U.S.A. 83, 3346–3350 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Heguy A., West A., Richards R. I., Karin M. (1986) Structure and tissue-specific expression of the human metallothionein IB gene. Mol. Cell. Biol. 6, 2149–2157 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Foster R., Jahroudi N., Varshney U., Gedamu L. (1988) Structure and expression of the human metallothionein-IG gene. J. Biol. Chem. 263, 11528–11535 [PubMed] [Google Scholar]
  • 18. Tsuji S., Kobayashi H., Uchida Y., Ihara Y., Miyatake T. (1992) Molecular cloning of human growth inhibitory factor cDNA and its down-regulation in Alzheimer's disease. EMBO J. 11, 4843–4850 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Hoey J. G., Garrett S. H., Sens M. A., Todd J. H., Sens D. A. (1997) Expression of MT-3 mRNA in human kidney, proximal tubule cell cultures, and renal cell carcinoma. Toxicol. Lett. 92, 149–160 [DOI] [PubMed] [Google Scholar]
  • 20. Quaife C. J., Findley S. D., Erickson J. C., Froelick G. J., Kelly E. J., Zambrowicz B. P., Palmiter R. D. (1994) Induction of a new metallothionein isoform (MT-IV) occurs during differentiation of stratified squamous epithelia. Biochemistry 33, 7250–7259 [DOI] [PubMed] [Google Scholar]
  • 21. Jin R., Chow V. T.-K., Tan P.-H., Dheen S. T., Duan W., Bay B.-H. (2002) Metallothionein 2A expression is associated with cell proliferation in breast cancer. Carcinogenesis 23, 81–86 [DOI] [PubMed] [Google Scholar]
  • 22. Jin R., Bay B. H., Chow V. T. K., Tan P. H. (2001) Metallothionein 1F mRNA expression correlates with histological grade in breast carcinoma. Breast Cancer Res. Treat. 66, 265–272 [DOI] [PubMed] [Google Scholar]
  • 23. Sens M. A., Somji S., Garrett S. H., Beall C. L., Sens D. A. (2001) Metallothionein isoform 3 overexpression is associated with breast cancers having a poor prognosis. Am. J. Pathol. 159, 21–26 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Somji S., Garrett S. H., Zhou X. D., Zheng Y., Sens D. A., Sens M. A. (2010) Absence of metallothionein 3 expression in breast cancer is a rare, but favorable marker of outcome that is under epigenetic control. Toxicol. Environ. Chem. 92, 1673–1695 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Jin R., Bay B. H., Chow V. T. K., Tan P. H., Lin V. C. L. (2000) Metallothionein 1E mRNA is highly expressed in oestrogen receptor-negative human invasive ductal breast cancer. Br. J. Cancer 83, 319–323 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Friedline J. A., Garrett S. H., Somji S., Todd J. H., Sens D. A. (1998) Differential expression of the MT-1E gene in estrogen-receptor-positive and -negative human breast cancer cell lines. Am. J. Pathol. 152, 23–27 [PMC free article] [PubMed] [Google Scholar]
  • 27. Garrett S. H., Sens M. A., Todd J. H., Somji S., Sens D. A. (1999) Expression of MT-3 protein in the human kidney. Toxicol. Lett. 105, 207–214 [DOI] [PubMed] [Google Scholar]
  • 28. Jasani B., Schmid K. W. (1997) Significance of metallothionein overexpression in human tumours. Histopathology 31, 211–214 [DOI] [PubMed] [Google Scholar]
  • 29. Cousins R. J. (1979) Metallothionein synthesis and degradation: relationship to cadmium metabolism. Environ. Health Perspect. 28, 131–136 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Winge D. R., Miklossy K. A. (1982) Domain nature of metallothionein. J. Biol. Chem. 257, 3471–3476 [PubMed] [Google Scholar]
  • 31. Monia B. P., Butt T. R., Ecker D. J., Mirabelli C. K., Crooke S. T. (1986) Metallothionein turnover in mammalian cells. J. Biol. Chem. 261, 10957–10959 [PubMed] [Google Scholar]
  • 32. Theocharis S. E., Margeli A. P., Klijanienko J. T., Kouraklis G. P. (2004) Metallothionein expression in human neoplasia. Histopathology 45, 103–118 [DOI] [PubMed] [Google Scholar]
  • 33. Namdarghanbari M., Wobig W., Krezoski S., Tabatabai N. M., Petering D. H. (2011) Mammalian metallothionein in toxicology, cancer, and cancer chemotherapy. J. Biol. Inorg. Chem. 16, 1087–1101 [DOI] [PubMed] [Google Scholar]
  • 34. Wang R., Sens D. A., Albrecht A., Garrett S., Somji S., Sens M. A., Lu X. (2007) Simple method for identification for metallothionein isoforms in cultured human prostate cells by MALDI-TOF/TOF mass spectrometry. Anal. Chem. 79, 4433–4441 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Alvarez L., Gonzalez-Iglesias H., Garcia M., Ghosh S., Sanz-Medel A., Coca-Prados M. (2012) The stoichiometric transition from Zn6Cu1-metallothionein to Zn7-metallothionein underlies the up-regulation of metallothionein (MT) expression: quantitative analysis of MT-metal load in eye cells. J. Biol. Chem. 287, 28456–28469 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Mounicou S., Ouerdane L., L'Azou B., Passagne I., Ohayon-Courtès C., Szpunar J., Lobinski R. (2010) Identification of metallothionein subisoforms in HPLC using accurate mass and online sequencing by electrospray hybrid linear ion trap-orbital ion trap mass spectrometry. Anal. Chem. 82, 6947–6957 [DOI] [PubMed] [Google Scholar]
  • 37. Mididoddi S., McGuirt J. P., Sens M. A., Todd J. H., Sens D. A. (1996) Isoform-specific expression of metallothionein mRNA in the developing and adult human kidney. Toxicol. Lett. 85, 17–27 [DOI] [PubMed] [Google Scholar]
  • 38. Kim D., Garrett S. H., Sens M. A., Somji S., Sens D. A. (2002) Metallothionein isoform 3 and proximal tubule vectorial active transport. Kidney Int. 61, 464–472 [DOI] [PubMed] [Google Scholar]
  • 39. Somji S., Garrett S. H., Sens M. A., Gurel V., Sens D. A. (2004) Expression of metallothionein isoform 3 (MT-3) determines the choice between apoptotic or necrotic cell death in Cd+2-exposed human proximal tubule cells. Toxicol. Sci. 80, 358–366 [DOI] [PubMed] [Google Scholar]
  • 40. Gurel V., Sens D. A., Somji S., Garrett S. H., Nath J., Sens M. A. (2003) Stable transfection and overexpression of metallothionein isoform 3 inhibits the growth of MCF-7 and Hs578T cells but not that of T-47D or MDA-MB-231 cells. Breast Cancer Res. Treat. 80, 181–191 [DOI] [PubMed] [Google Scholar]
  • 41. Gurel V., Sens D. A., Somji S., Garrett S. H., Weiland T., Sens M. A. (2005) Post-transcriptional regulation of metallothionein isoform 1 and 2 expression in the human breast and the MCF-10A cell line. Toxicol. Sci. 85, 906–915 [DOI] [PubMed] [Google Scholar]
  • 42. Shechter Y. (1986) Selective oxidation and reduction of methionine residues in peptides and proteins by oxygen exchange between sulfoxide and sulfide. J. Biol. Chem. 261, 66–70 [PubMed] [Google Scholar]
  • 43. Somji S., Garrett S. H., Sens M. A., Sens D. A. (2006) The unique N-terminal sequence of metallothionein-3 is required to regulate the choice between apoptotic or necrotic cell death of human proximal tubule cells exposed to Cd+2. Toxicol. Sci. 90, 369–376 [DOI] [PubMed] [Google Scholar]
  • 44. Dormeyer W., Mohammed S., van Breukelen B., Krijgsveld J., Heck A. J. R. (2007) Targeted analysis of protein termini. J. Proteome Res. 6, 4634–4645 [DOI] [PubMed] [Google Scholar]
  • 45. Ghesquiére B., Jonkheere V., Colaert N., Van Durme J., Timmerman E., Goethals M., Schymkowitz J., Rousseau F., Vandekerchkove J., Gevaert K. (2011) Redox proteomics of protein-bound methionine oxidation. Mol. Cell. Proteomics 10, M110.006866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Lipton S. H., Bodwell C. E. (1976) Specific oxidation of methionine to methionine sulfoxide. J. Agric. Food Chem. 24, 26–31 [DOI] [PubMed] [Google Scholar]
  • 47. Kojima Y., Berger C., Vallee B. L., Kägi J. H. R. (1976) Amino acid sequence of equine renal metallothionein-1B. Proc. Natl. Acad. Sci. U.S.A. 73, 3413–3417 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Landon M. (1977) Cleavage at aspartyl-prolyl bonds. Methods Enzymol. 47, 145–149 [DOI] [PubMed] [Google Scholar]
  • 49. Desiere F., Deutsch E. W., Nesvizhskii A. I., Mallick P., King N. L., Eng J. K., Adereem A., Boyle R., Brunner E., Donohoe S., Fausto N., Hafen E., Hood L., Katze M. G., Kennedy K. A., Kregenow F., Lee H., Lin B., Martin D., Ranish J. A., Rawlings D. J., Samelson L. E., Shiio Y., Watts J. D., Wollscheid B., Wright M. E., Yan W., Yang L., Yi E. C., Zhang H., Aebersold R. (2004) Integration with the human genome of peptide sequences obtained by high-throughput mass spectrometry. Genome Biol. 6, R9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Desiere F., Deutsch E. W., King N. L., Nescishskii A. I., Mallick P., Eng J., Chen S., Eddes J., Loevenich S. N., Aebersold R. (2006) The PeptideAtlas project. Nucleic Acids Res. 34, D655–D658 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Winge D. R., Nielson K. B., Zeikus R. D., Gray W. R. (1984) Structural characterization of the isoforms of neonatal and adult rat liver metallothionein. J. Biol. Chem. 259, 11419–11425 [PubMed] [Google Scholar]
  • 52. Ryan M. J., Johnson G., Kirk J., Fuerstenberg S. M., Zager R. A., Torok-Storb B. (1994) HK-2: an immortalized proximal tubule epithelial cell line from normal adult human kidney. Kidney Int. 45, 48–57 [DOI] [PubMed] [Google Scholar]
  • 53. Garrett S. H., Phillips V., Somji S., Sens M. A., Dutta R., Park S., Kim D., Sens D. A. (2002) Transient induction of metallothionein isoform 3 (MT-3) c-fos, c-jun, and c-myc in human proximal tubule cells exposed to cadmium. Toxicol. Lett. 126, 69–80 [DOI] [PubMed] [Google Scholar]
  • 54. Garrett S. H., Somji S., Todd J. H., Sens D. A. (1998) Exposure of human proximal tubule cells to Cd2+, Zn2+, and Cu2+ induces metallothionein protein accumulation but not metallothionein. Environ. Health Perspect. 106, 587–595 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Garrett S. H., Somji S., Todd J. H., Sens M. A., Sens D. A. (1998) Differential expression of human metallothionein isoform I mRNA in human proximal tubule cells exposed to metals. Environ. Health Perspect. 106, 825–832 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Bylander J. E., Li S. L., Sens M. A., Hazen-Martin D., Re G. G., Sens D. A. (1994) Induction of metallothionein mRNA and protein following exposure of cultured human proximal tubule cells to cadmium. Toxicol. Lett. 71, 111–122 [DOI] [PubMed] [Google Scholar]
  • 57. Bylander J. E., Li S. L., Sens M. A., Sens D. A. (1995) Exposure of human proximal tubule cells to cytotoxic levels of CdCl2 induces the additional expression of metallothionein 1A mRNA. Toxicol. Lett. 76, 209–217 [DOI] [PubMed] [Google Scholar]
  • 58. Beck M., Schmidt A., Malmstroem J., Claasen M., Ori A., Szymborska A., Herzog F., Rinner O., Ellengerg J., Aebersold R. (2011) The quantitative proteome of a human cell line. Mol. Syst. Biol. 7, 549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Munoz J., Low T. Y., Kok Y. J., Chin A., Frese C. K., Ding V., Choo A., Heck A. J. R. (2011) The quantitative proteomes of human induced pluripotent stem cells and embryonic stem cells. Mol. Syst. Biol. 7, 550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Nagaraj N., Wisniewski J. R., Geiger T., Cox J., Kircher M., Kelso J., Pääbo S., Mann M. (2011) Deep proteome and transcriptome mapping of a human cancer cell line. Mol. Syst. Biol. 7, 548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Phanstiel D. H., Brumbaugh J., Wenger C. D., Tian S., Probasco M. D., Bailey D. J., Swaney D. L., Tervo M. A., Bolin J. M., Ruotti V., Stewart R., Thomson J. A., Coon J. J. (2011) Proteomic and phosphoproteomic comparison of human ES and iPS cells. Nat. Methods 8, 821–827 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Geiger T., Wehner A., Schaab C., Cox J., Mann M. (2012) Comparative proteomic analysis of eleven common cell lines reveals ubiquitous but varying expression of most proteins. Mol. Cell. Proteomics 11, M111.014050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Helbig A. O., Gauci S., Raijmakers R., van Breukelen B., Slijper M., Mohammed S., Heck A. J. R. (2010) Profiling of N-acetylated protein termini provides in-depth insights into the N-terminal nature of the proteome. Mol. Cell. Proteomics 9, 928–939 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64. Gevaert K., Goethals M., Martens L., Van Damme J., Staes A., Thomas G. R., Vandekerckhove J. (2003) Exploring proteomes and analyzing protein processing by mass spectrometric identification of sorted N-terminal peptides. Nat. Biotechnol. 21, 566–569 [DOI] [PubMed] [Google Scholar]
  • 65. Arnesen T., Van Damme P., Polevoda B., Helsens K., Evjenth R., Colaert N., Varhaug J. E., Vandekerckhove J., Lillehaug J. R., Sherman F., Gevaert K. (2009) Proteomics analyses reveal the evolutionary conservation and divergence of N-terminal acetyltransferases from yeast and humans. Proc. Natl. Acad. Sci. U.S.A. 106, 8157–8162 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Huang I.-Y., Yoshida A., Tsunoo H., Nakajima H. (1977) Mouse liver metallothioneins: complete amino acid sequence of metallothionein-I. J. Biol. Chem. 252, 8217–8221 [PubMed] [Google Scholar]
  • 67. Huang I.-Y., Kimura M., Hata A., Tsunoo H., Yoshida A. (1981) Complete amino acid sequence of mouse liver metallothionein-II. J. Biochem. 89, 1839–1845 [DOI] [PubMed] [Google Scholar]
  • 68. Boissel J.-P., Kasper T., Bunn H. F. (1988) Cotranslational amino-terminal processing of cytosolic proteins: cell-free expression of site-directed mutants of human hemoglobin. J. Biol. Chem. 263, 8443–8449 [PubMed] [Google Scholar]
  • 69. Knudsen C. B., Bjornsdottir I., Jons O., Hansen S. H. (1998) Detection of metallothionein isoforms from three different species using on-line capillary electrophoresis-mass spectrometry. Anal. Biochem. 265, 167–175 [DOI] [PubMed] [Google Scholar]
  • 70. Beattie J. H., Wood A. M., Duncan G. J. (1999) Rat metallothionein-2 contains N-acetylated and unacetylated forms. Electrophoresis 20, 1613–1618 [DOI] [PubMed] [Google Scholar]
  • 71. Van Vyncht G., Bordin A., Rodriguez A. R. (2000) Rabbit liver metallothionein subisoform characterization using liquid chromatography hyphenated to diode array detection and electrospray ionization mass spectrometry. Chromatographia 52, 745–752 [Google Scholar]
  • 72. Andón B., Barbosa J., Sanz-Nebot V. (2006) Separation and characterization of rabbit liver apothioneins by capillary electrophoresis coupled to electrospray ionization time-of-flight mass spectrometry. Electrophoresis 27, 3661–3670 [DOI] [PubMed] [Google Scholar]
  • 73. Ray W. J., Koshland D. E. (1962) Identification of amino acids involved in phosphoglucomutase action. J. Biol. Chem. 237, 2493–2505 [PubMed] [Google Scholar]
  • 74. Savige W. E., Fontana A. (1977) Interconversion of methionine and methionine sulfoxide. Methods Enzymol. 47, 453–459 [DOI] [PubMed] [Google Scholar]
  • 75. Sechi S., Chait B. T. (1998) Modification of cysteine residues by alkylation. A tool in peptide mapping and protein identification. Anal. Chem. 70, 5150–5158 [DOI] [PubMed] [Google Scholar]
  • 76. Gygi S. P., Rist B., Gerber S. A., Turecek F., Gelb M. H., Aebersold R. (1999) Quantitative analysis of complex protein mixtures using isotope-coded affinity tags. Nat. Biotechnol. 17, 994–999 [DOI] [PubMed] [Google Scholar]
  • 77. Zhang R., Regnier F. E. (2002) Minimizing resolution of isotopically coded peptides in comparative proteomics. J. Proteome Res. 1, 139–147 [DOI] [PubMed] [Google Scholar]
  • 78. Zhang R., Sioma C. S., Thompson R. A., Xiong L., Regnier F. E. (2002) Controlling deuterium isotope effects in comparative proteomics. Anal. Chem. 74, 3662–3669 [DOI] [PubMed] [Google Scholar]
  • 79. Faca V., Coram M., Phanstiel D., Glukhova V., Zhang Q., Fitzgibbon M., McIntosh M., Hanash S. (2006) Quantitative analysis of acrylamide labeled serum proteins by LC-MS/MS. J. Proteome Res. 5, 2009–2018 [DOI] [PubMed] [Google Scholar]
  • 80. Nielson K. B., Winge D. R. (1983) Order of metal binding in metallothionein. J. Biol. Chem. 258, 13063–13069 [PubMed] [Google Scholar]
  • 81. Nielson K. B., Atkin C. L., Winge D. R. (1985) Distinct metal-binding configurations in metallothionein. J. Biol. Chem. 260, 5342–5350 [PubMed] [Google Scholar]
  • 82. Babendure J. R., Babendure J. L., Ding J.-H., Tsien R. Y. (2006) Control of mammalian translation by mRNA structure near caps. RNA 12, 851–861 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83. Hiller M., Huse K., Szafranski K., Jahn N., Hampe J., Schreiber S., Backhofen R., Platzer M. (2004) Widespread occurrence of alternative splicing at NAGNAG acceptors contributes to proteome plasticity. Nat. Genet. 36, 1255–1257 [DOI] [PubMed] [Google Scholar]
  • 84. Bradley R. K., Merkin J., Lambert N. J., Burge C. B. (2012) Alternative splicing of RNA triplets is often regulated and accelerates proteome evolution. PLoS Biol. 10, e1001229. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Data

Articles from Molecular & Cellular Proteomics : MCP are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES