Skip to main content
NCBI home page
Molecular Therapy logoLink to Molecular Therapy
. 2014 Feb 4;22(4):821–827. doi: 10.1038/mt.2013.275

Targeting the Splicing of mRNA in Autoimmune Diseases: BAFF Inhibition in Sjögren's Syndrome as a Proof of Concept

N Roescher 1,2, JL Vosters 1,2, G Alsaleh 3, P Dreyfus 4, S Jacques 5, G Chiocchia 5, J Sibilia 3, PP Tak 1, JA Chiorini 2, X Mariette 6, Jacques-Eric Gottenberg 3,*
PMCID: PMC3982500  PMID: 24304965

Abstract

BAFF (B-cell–activating factor of the tumor necrosis factor family), a pivotal cytokine for B-cell activation, is overexpressed by salivary gland (SG) epithelial cells in primary Sjogren's syndrome (pSS). ΔBAFF, a physiological inhibitor of BAFF, is a minor alternative splice variant of BAFF. A U7 RNA was reengineered to deliver antisense sequences targeting BAFF splice regions. A major decrease of BAFF messenger RNA (mRNA) and protein secretion, concomitantly with the increase of ΔBAFF mRNA, was observed in vitro. In vivo, SG retrograd instillation of nonobese diabetic mice by the modified U7 cloned into an adeno-associated virus vector significantly decreased BAFF protein expression and lymphocytic infiltrates and improved salivary flow. This study offers a rationale for localized therapeutic BAFF inhibition in pSS and represents a proof of concept of the interest of exon skipping in autoimmune diseases.

Introduction

Primary Sjögren's syndrome (pSS) shares many pathogenic mechanisms with systemic lupus erythematosus (SLE), including common genetic factors, an interferon signature and involvement of BAFF (B-cell–activating factor of the tumor necrosis factor family) and of B lymphocytes. pSS is an innate-immune triggered autoimmune epithelitis, leading to disabling ocular, mouth and mucosal dryness, fatigue, pain, and various systemic manifestations.1 The incidence of lymphoma, the most severe complication, is 16- to 18-fold higher in pSS than in the general population.

In the pathogenesis of autoimmune diseases, B lymphocytes play a crucial role through the secretion of autoantibodies, proinflammatory cytokines, and antigen presentation. Numerous animal models have demonstrated that BAFF (also called B lymphocyte stimulator (BLyS)), an interferon-inducible cytokine, is essential for autoreactive B-cell activation, survival, and autoantibody secretion. Interestingly, BAFF also plays a pathogenic role in lymphomas. BAFF transgenic mice spontaneously develop SLE- and SS-like symptoms.2,3 In patients with pSS, BAFF levels are increased in serum, saliva epithelial cells of the ocular surface, and salivary glands (SGs).4,5 Epithelial cells play a pivotal pathogenic role in pSS, because they are able to present autoantigens, secrete cytokines, and differentiate T lymphocytes. In pSS, along with myeloid cells and T and B lymphocytes, salivary and lacrimal gland epithelial cells overexpress BAFF.6

The course of the disease is improved in mice models of SLE knockout for BAFF. An anti-BAFF monoclonal antibody, belimumab, was recently approved for the treatment of human SLE. However, no study has ever examined the therapeutic effect of BAFF-specific inhibition in an animal model of pSS or in the human disease. Systemic inhibition of BAFF, using soluble receptors or monoclonal antibodies, does not allow direct demonstration of the pathogenic contribution of BAFF secretion by epithelial cells. To study this pathogenic contribution, two conditions are required: (i) the capacity to target these producer cells and (ii) to interfere with the intracellular processing of BAFF.

The former condition is possible using retrograde instillation of SGs in a mouse model. Interfering with the intracellular processing of BAFF requires targeting the intracellular processing of BAFF messenger RNA (mRNA), either by using small-interfering RNAs, micro RNAs, or by modulating BAFF mRNA splicing.7 Interestingly, ΔBAFF, a minor alternative splice variant of BAFF mRNA resulting from a 57-bp single exon deletion (exon 3 and 4 are skipped in human and mouse, respectively) inhibits BAFF secretion and activity.8 The use of exon skipping to promote the expression of one shorter variant over the predominant full-length mRNA has shown encouraging effects in clinical trials for the treatment of monogenetic diseases.9,10

We therefore decided to investigate whether the specific inhibition of BAFF in epithelial cells could decrease lymphocytic infiltrates and improve dryness in the nonobese diabetic (NOD) model of pSS. The present study reports a novel approach for decreasing BAFF that might be potentially relevant for the treatment of human pSS.

Results

Exon-skipping results in decreased BAFF secretion in vitro

To assess the efficacy of exon skipping to inhibit BAFF expression, U937 cells, a sustained BAFF producer myelomonocytic cell line, were transduced with a targeting vector, a lentiviral vector encoding a modified U7 targeting human BAFF exon 3, or a control vector, a lentiviral vector encoding a modified U7 targeting mouse BAFF exon 4. This resulted in a major decrease of BAFF mRNA and protein secretion, concomitantly with the increase of ΔBAFF mRNA, as compared with a control vector (Figure 1a,c). Similar results were obtained with EBV-immortalized lymphoblastoid cell line PRI (Figure 1b).

Figure 1.

Figure 1

Open in a new tab

Decrease of BAFF concomitant to ΔBAFF increase after induction of exon skipping in vitro. Five days after infection of (a) the U937 human cell line and (b) the EBV-immortalized lymphoblastoid cell line PRI with a modified U7 vectorized in a lentivirus targeting either mouse BAFF (control) or human BAFF (three experiments (Exp 1–3)), a significant increase of ΔBAFF messenger RNA was evidenced. The induction of exon skipping resulted in a significant decrease of BAFF secretion assessed by enzyme-linked immunosorbent assay in U937 human cell infected with a modified U7 vectorized in a lentivirus targeting human BAFF (target vector) as compared with a control lentivirus targeting mouse BAFF (control vector), mean and bar errors of the three experiments are represented in (c). BAFF, B-cell–activating factor of the tumor necrosis factor family.

Cell proliferation of transduced U937 cells with the splicing vector significantly decreased compared with cells transfected with the control vector (n = 10 at days 1, 2, and 3; median: 1,688 ± 273 versus 49,532 ± 10,295 cpm; P = 0.002 and in serum-free condition, 7,090 ± 1,073 versus 28,946 ± 55,44 cpm; P = 0.002).

Exon-skipping therapy results in decreased BAFF expression by SG epithelial cells

The efficacy of exon skipping was investigated in vivo, using the NOD mice model of pSS. In NOD mice, T and B lymphocytic infiltrates start at 8 weeks of age, and large focal infiltrates can be observed at 20 weeks of age. BAFF is already strongly expressed in the SG ductal epithelial cells of young mice (8 weeks of age), and its expression level increases with the infiltrate of monocytic cells.11 Adeno-associated virus (AAV) vectors are known to stably transduce SG ductal epithelium without causing any significant immune response.12 An AAV vector was constructed containing a modified U7 exon-skipping vector targeting mouse BAFF exon 4 (AAV-U7ΔBAFF). Ten-week-old NOD mice were anesthetized, and their SGs were infused with 1 × 1011 viral particles per gland of either AAV-U7ΔBAFF or AAV-LacZ. Mice were euthananized at 20 weeks of age. The presence of vector DNA in SG tissue at 20 weeks of age in all mice confirmed local delivery of the vector. At 20 weeks, BAFF mRNA, normalized to that of glyceraldehyde 3-phosphate dehydrogenase (GAPDH), tended to decrease, though not significantly, in AAV-U7ΔBAFF–treated mice compared with AAV-LacZ–treated mice (15.4 ± 4.2 versus 33.3 ± 10.2; P = 0.20), with a trend toward an increase of ΔBAFF (3.1 ± 0.7 versus 2.3 ± 0.3; P = 0.20) and a decrease of the BAFF/ΔBAFF ratio (6.0 ± 1.9 versus 13.7 ± 5.1; P = 0.30).

Exon skipping significantly decreased BAFF protein expression within SGs at 20 weeks, firstly assessed using immunohistochemistry (Figure 2a,b). Digital analysis clearly showed a significant reduction of BAFF expression (176,243 ± 126,120 versus 359,696 ± 213,450 integrated optical density/mm2 in controls; P = 0.04; Figure 2c). Western blotting of the SGs also showed decreased BAFF protein SG expression in treated versus control mice (Figure 3).

Figure 2.

Figure 2

Open in a new tab

Decreased BAFF protein expression in salivary glands (SGs) assessed by immunohistochemistry. Immunohistochemical detection of BAFF in SGs in (a) AAV-LacZ (control) and (b) AAV-U7ΔBAFF–treated mice. (c) Positive staining for BAFF was expressed as integrated optical density per mm2. A significant decrease of BAFF expression was observed in treated versus control mice. Data shown are mean ± SD. AAV, adeno-associated virus; BAFF, B-cell–activating factor of the tumor necrosis factor family.

Figure 3.

Figure 3

Open in a new tab

Decreased salivary gland (SG) expression of BAFF protein assessed by western blotting. BAFF expression was investigated using western blotting. In SGs of two control mice (S1 and S2), (a) BAFF was not detected without using an anti-BAFF antibody, (b) whereas it was detected using an anti-BAFF rabbit polyclonal immunoglobulin G1 antibody. (c) BAFF expression of AAV-LacZ (control) and of AAV-U7ΔBAFF (treated) mice was analyzed. For protein loading control, membranes were reprobed with anti-GAPDH antibodies. AAV, adeno-associated virus; BAFF, B-cell–activating factor of the tumor necrosis factor family; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Exon-skipping therapy results in decreased SG infiltrates and salivary flow in the NOD mice model for pSS

Changing BAFF levels in SGs might play a crucial role in the survival of infiltrating B and T lymphocytes. Therefore, we measured the number of SG infiltrates, expressed, as for patients with pSS, by a focus score (FS). Treated mice showed a significant decrease of the FS in the SGs (2.8 ± 1.1 versus 3.8 ± 0.8; P = 0.04; Figure 4a). Subsequent analysis of the lymphocytic infiltrates showed that the decrease of FS primarily reflected a reduction in B lymphocytes (95.2 ± 140 versus 612.8 ± 458.5 count/mm2; P = 0.006) and plasma cells (29.6 ± 63.8 versus 103.6 ± 28.5 count/mm2; P = 0.006; Figure 4b).

Figure 4.

Figure 4

Open in a new tab

Significant decrease of focus score (FS), B cells and plasma cells in treated mice. (a) FS was determined for each mouse, in which one focus is defined as an aggregate of 50 or more lymphocytes and the FS defined as the average foci per 4 mm2 salivary gland tissue. Slides were scored blindly by two different researchers (N.R. and J.L.V.). A significant decrease of the FS was observed in AAV-U7ΔBAFF (treated) compared with AAV-LacZ (control) mice. Paraffin sections were stained with rat anti-mouse B220 and anti-CD138. (b) Digital analysis was performed. Positive staining for the cellular markers was expressed as the number of positive cells per mm2. Treated mice showed a significant decrease in B and plasma cells. Data shown are mean ± SD. AAV, adeno-associated virus; BAFF, B-cell–activating factor of the tumor necrosis factor family.

Because oral dryness is one of the most disabling and frequent symptoms in patients with pSS, for which treatment remains exclusively symptomatic and unsatisfactory, the efficacy of exon skipping on salivary flow rates, as a surrogate indicator of dryness, was assessed. BAFF-treated mice had significantly higher salivary flow versus those of control mice (3.48 ± 1.35 versus 2.18 ± 0.67 μl/20 minutes/g body weight; P = 0.02; Figure 5).

Figure 5.

Figure 5

Open in a new tab

Significant increase in stimulated salivary flow among treated mice. Stimulated whole saliva was collected in Lac-Z (control) (n = 9)) and AAV-U7ΔBAFF (n = 10) (treated) mice in a blinded manner for 20 minutes from the oral cavity. A significant increase in salivary flow, measured after 20 minutes in microliters/gram of body weight (BW) (µl/20 minutes/g BW), was observed in treated mice. AAV, adeno-associated virus; BAFF, B-cell–activating factor of the tumor necrosis factor family.

Discussion

Downregulation of the epithelial BAFF expression by interfering with the splicing of BAFF mRNA resulted in decreased dryness and SG lymphocytic infiltrates in a mouse model of pSS. The present results add new evidence to the pathogenic role of BAFF in autoimmune-induced dryness and offer a rationale for the treatment of pSS by localized blocking BAFF expression with the use of an exon-skipping strategy.

As frequently observed in exon-skipping studies, the efficacy of exon skipping at the mRNA level was easier to demonstrate in vitro than in vivo. In vitro, a clear and significant decrease of BAFF and concomitant increase of ΔBAFF mRNA were observed, whereas only modest changes were observed in vivo regarding mRNA levels. A similar observation was recently made in clinical trials in Duchenne muscular dystrophy,9,10 in which induced skipping in muscle biopsies was variable. Such discrepancies between in vitro and in vivo can be related to the technique of exon skipping and to the mechanisms of action of ΔBAFF. Exon-skipping studies in animals and initial clinical trials raised concern that stochastic events affect the targeting of pre-mRNAs, and the splicing contribute to variability. Additionally, ΔBAFF limits BAFF bioactivity not only by a splicing-related consumption of BAFF mRNA but also by affecting the intracellular compartmentalization of BAFF, preventing the shedding of membrane-bound BAFF. ΔBAFF protein can also combine to BAFF protein to form heterotrimers which reduces the binding specificity of BAFF to BAFF receptors.7 This contrast between the very modest effect on BAFF mRNA and a significant decrease in BAFF protein might also be related to the time point of analysis, 20 weeks, which could be too late to see the decrease in BAFF mRNA. A last possiblility to explain the modest decrease of BAFF mRNA could be that the number of B cells decreased after exon skipping and that some B cells were shown to express BAFF in SGs of patients with pSS.13

Importantly, specific inhibition of BAFF expression by SG epithelial cells in vivo resulted in a significant decrease of infiltrating B lymphocytes, plasma cells, and to lesser extent, T lymphocytes. The immunological consequences of ΔBAFF overexpression were well illustrated in ΔBAFF transgenic mice, with reduced B-cell numbers and T-cell–independent antibody responses, a phenotype closely resembling that of the BAFF-R+/− receptor mice.14 More recently, it was reported that ΔBAFF transgenic 3H9 mice had reduced B-cell numbers with a repertoire similar to that of 3H9 mice, but lacking usage of a subset of Vk genes.15 Previously, we have shown that BAFF overexpression begins very early and before the occurrence of SG infiltrates in NOD mice.11 It could therefore be speculated that this overexpression also plays a chemotactic role,16 which may contribute to the SG infiltrates. Locally, inhibiting BAFF expression might thus contribute to the subsequent decreased recruitment of myeloid, T and B cells into SGs.

The immunological effects on B and T cells of BAFF inhibition might explain the second important result of the present study, the marked improvement of salivary flow rates in treated mice. Decreased salivary flow in SS patients is currently envisioned as the result of epithelitis, activation of innate immunity and of B and T cells, autoantibodies, proinflammatory cytokines, matrix disorganization rather than the result of direct tissue damage. B-cell targeting in one controlled trial using rituximab demonstrated a significant effect on salivary flow, and normalization of salivary sodium levels was observed after treatment.17 Likewise, an open-label study of another drug targeting B cells, epratuzumab (an anti-CD22 antibody), also resulted in improved salivary function.18 The present results support the potential therapeutic benefit of a novel immunomodulatory intervention on salivary flow, and thus dryness, a disabling symptom of pSS currently only treatable symptomatically (saliva substitutes, pilocarpine). Ocular dryness is also a frequent disabling symptom of pSS. Given that BAFF is increased in lachrymal glands of animal models of the disease19 and in epithelial cells of the ocular surface of patients with pSS,6 a similar gene therapy approach could be evaluated in lacrimal glands.

Previously, it was shown that epithelial cells secrete BAFF after stimulation with type I interferon, activation of Toll-like receptor-3 or infection with a double-stranded DNA virus.20,21 However, the pathogenic contribution of BAFF expression by epithelial cells compared with BAFF expression by myeloid or lymphoid cells had never been studied. The present study demonstrates that the specific inhibition of BAFF expression in epithelial cells results in decreased SG infiltrates and improved salivary flow. These results add new evidence that epithelial cells actively contribute to the pathogenesis of pSS, notably by the secretion of BAFF.

No previous data were available regarding the efficacy of BAFF-specific inhibition in animal models of pSS. Although BAFF inhibition resulted in the improvement of insulitis in NOD mice, its effect on salivary flow rates and salivary infiltrates was not studied.22 Interestingly, our group also studied the local SG gene therapy expressing transmembrane activator and calcium modulator and cyclophilin ligand interactor-Fc (TACI-Fc), which inhibits both BAFF and proliferation-inducing ligand (APRIL) signaling. Inhibition of BAFF and APRIL using TACI-Fc only resulted in a reduction of SG infiltrates but not in the improvement of salivary flow,23 in contrast to the present results obtained by inhibiting only BAFF. APRIL levels are decreased in SGs of patients with pSS, suggesting that this cytokine could play a protective role in pSS.24 This might explain why our approach of specific inhibition of BAFF is more efficient than inhibition of BAFF and APRIL. During the course of the present study, belimumab, a monoclonal antibody against BAFF administered intravenously, was approved for use in SLE, a disease that shares many pathogenic features with pSS. Open clinical trials are currently evaluating its efficacy in pSS. Our results suggest that this may be beneficial.

Finally, this study is a proof of concept for the use of exon-skipping therapy in autoimmune diseases. This approach was first developed in monogenic diseases to recover a disrupted open reading frame and help to produce a shortened but functional mRNA and protein. It is now clear that this strategy can apply to all mRNAs that have physiological splicing isoforms. Other shortened mRNA isoforms of pro/antiapoptotic genes have inhibitory functions with regards to their full-length counterparts, like BCL-xs compared with BCL-xl.25 Thus, exon-skipping therapy may be useful for other targets in autoimmune diseases. Practical barriers to the clinical use of exon-skipping therapy are being lowered, with the development of new oligonucleotide antisenses such as phosphorodiamidate morpholino oligomers which have high stability and efficacy and low toxicity,26 and avoid the need for viral vector delivery. Of interest, local SG gene therapy, as used in the present study, has already been shown to be effective in phase I clinical trials with radiotherapy-related salivary hypofunction (ClinicalTrial.gov Identifier: NCT00372320).27 Thus, use of SG retrograde instillation in patients with pSS is feasible.

In conclusion, the present study gives new insights into the pathogenesis of pSS, a paradigm model of autoimmune diseases. It also sheds new light on the central role of epithelial cells in BAFF-driven local activation of adaptive immunity. In addition, this study demonstrates improvements in salivary flow after BAFF inhibition, suggesting a rationale for evaluating BAFF antagonists in clinical trials. Finally, this study also represents a proof of concept of the efficacy of modulating mRNA splicing in autoimmune diseases.

Materials and Methods

Reagents.Nucleospin RNA II extraction kit was from Macherey-Nagel (Souffelweyersheim, France). The SensiMix Plus SYBR (Quantace) was from Corbett Life Science (Sydney, Australia). The enzyme immunoassay kits for human BAFF detection were from R&D Systems (Lille, France). For western blotting, polyclonal anti-BAFF rabbit immunoglobulin G were from Sigma (Saint-Quentin-Fallavier, France), and anti-GAPDH mouse immunoglobulin G monoclonal antibodies were from Millipore (Molsheim, France).

Construction and expression of plasmid encoding exon-skipping constructs.The full U7 small nuclear RNA gene (445 bp) was amplified by polymerase chain reaction (PCR) from mouse genomic DNA using the following primers: 5′-TAACAACATAGGAGCTGTG-3′and 5′-CAGATACGCGTTTCCTAGGA-3′. The Sm domain (AATTTGTCTAG) was changed into smOPT (AATTTTTGGAG) as previously described.28 The histone pre-mRNA pairing region was replaced by the sequence complementary to sequences immediately adjacent to exon 23 donor splice site (SD23: 5′-GGCCAAACCTCGGCTTACCT-3′) and a) CTGCAATCAGTTGCAAGCAGTCTTGAGTGAGTGACTAAAAAGCA, predicted to be a putative exonic splicing enhancer in sequence in the human exon 3; or b) ctgcaatcagctgcagacagtcttgaatgactgaaaagta predicted to be a putative exonic splicing enhancer in sequence in the mice exon 4. For the experiments in mice, the resulting U7 fragment was then introduced at the XbaI site of the pSMD2 AAV2 vector. AAV2/1 pseudotyped vectors were prepared by co-transfection in 293 cells of pAAV2(U7smOPT-SD23/BP22), pXX6 encoding adenovirus helper functions and pAAV1pITRCO2 that contains the AAV2 rep and AAV1 cap genes. Vector particles were purified on cesium chloride gradients from cell lysates obtained 48 hours after transfection, and titers were measured by quantitative dot-blot hybridization. The vector preparation was performed in the Genethon (Evry, France) and had a titer of 2 × 1013 vector genomes/ml.

Proliferation assay.U937 cell lines at a concentration of 150,000 cells/ml were transduced with a lentivirus containing a modified U7 targeting human or mouse (control) BAFF. At days 1, 2, and 3, [3H]thymidine (2 µCi/well) was added for 16 hours, then [3H]thymidine incorporation was measured.

Animals and vector administration.Female NOD mice (Jackson Laboratory, Bar Harbor, ME) were kept under specific pathogen-free conditions in the animal facilities of the National Institute of Dental and Craniofacial Research. Animal protocols were approved by the National Institute of Dental and Craniofacial Research Animal Care and Use Committee and the National Institutes of Health Biosafety Committee. Vectors were delivered into the submandibular glands by retrograde instillation as previously described.29 In short, female NOD mice were anesthetized with a mild anesthesia (ketamine and xylazine) at the age of 10 weeks. Then 50 µl, containing 1 × 1011 AAV-U7 targeting BAFF (AAV-U7ΔBAFF) or control AAV-LacZ, vector particles was administered to each submandibular gland by retrograde ductal instillation using a thin cannula (Intermedic PE10, Clay Adams, Parsippany, NJ). Mice were euthanized with CO2 and heart puncture at 20 weeks of age, and the blood and the SGs were collected and divided into four equal parts for further analysis. All the mRNA, protein, and histological analyses concerned mice of 20 weeks of age.

Detection of viral particles in SGs.Total genomic DNA was extracted from homogenized SGs using DNeasy blood & tissue kit (Qiagen, Venlo, The Netherlands). Vector delivery was confirmed using quantitative PCR on an ABI StepOnePlus Real-Time PCR system (Applied Biosystems, Carlsbad, CA) on the acquired SG DNA using the following primers: forward 5′-GTAGCCATGCTCTAGCCACA-′3, reverse 5′- CGGTGTGTGAGAGGGGCTTTG-3 and probe 5′-CTAGGAAACCAGAGAAG-3'.

Quantification of BAFF and ∆BAFF mRNA.Total RNA isolated was reverse transcribed using the First Strand cDNA Synthesis Kit according to the manufacturer's instructions. Real-time quantitative reverse transcriptase–PCR was performed in 96-well plates in a total volume of 20 µl using a SensiMix Plus SYBR (Quantace) and the following gene specific primers: in mice: BAFF forward 5′-GACTGTCTGCAGCTGATTGC-3′ and reverse 5′-AATAGCCTGTTTGCCTCACC-3′. ΔBAFF forward 5′-GGAATGAACCTCAGAAACAGAACTTAC-3′ and reverse 5′-ATAGAACCTGGCTGTAGATGAAG-3′. GAPDH forward 5′- GGTGAAGGTCGGAGTCAACGGA-3′ and reverse 5′- GAGGGATCTCGCTCGCTCCTGGAAGA-3′.

After an initial incubation at 96 °C for 10 minutes, samples were subjected to 40 rounds of amplification for 10 seconds at 95 °C, 15 seconds at 60 °C, and 25 seconds at 72 °C using the Lightcycler Instrument (Roche Applied Science, Meylan Cedex, France). Amplification products were detected as an increased fluorescent signal of SYBR Green during the amplification cycles. Results were obtained using SDS Software (Perkin Elmer, Courtaboeuf Cedex, France) and evaluated using Excel (Microsoft, Issy Les Moulineaux, France). Melting curve analysis was performed to assess the specificity of PCR products. The relative expression of a specific gene was calculated according to the equation REn = 2−(Ctn−Ct1), where Ct (change in cycle threshold) is the cycle threshold of the test gene minus the cycle threshold of GAPDH, n is a specific sample and 1 is the sample with the lowest expression.

The following gene specific primers for human were used: BAFF and ΔBAFF forward: 5′-TGAAACACCAACTATACAAAAAG-3′, reverse 5′-TCAATTCATCCCCAAAGACAT-3′,

GAPDH forward 5′- GGTGAAGGTCGGAGTCAACGGA-3′ and reverse 5′- GAGGGATCTCGCTCGCTCCTGGAAGA-3′.

In humans, both BAFF and ΔBAFF were amplified, after an initial denaturing at 95 °C for 5 minutes, the temperatures used were 95 °C for 30 seconds, 57 °C for 30 seconds, and 72 °C for 2 minutes followed by an extension of 5 minutes at 72 °C. For GAPDH, after an initial denaturing at 94 °C for 5 minutes, the temperatures used were 94 °C for 1 minute, 56 °C for 45 seconds, and 72 °C for 1 minute followed by an extension of 5 minutes at 72 °C. PCR products were separated in 2% agarose gels and visualized with ethidium bromide.

Assessment of BAFF and ∆BAFF protein using western blotting.Homogenized SGs were lysed 20 minutes on ice in 300 µl of ice-cold lysis buffer (1% Triton X-100, 20 mmol/l Tris-HCl pH 8.0, 130 mmol/l NaCl, 10% glycerol, 1 mmol/l sodium orthovanadate, 2 mmol/l ethylenediaminetetraacetic acid, 1 mmol/l phenylmethylsulfonyl fluoride, and protease inhibitors). Lysates were centrifuged for 10 minutes at 14,000g at 4 °C, and supernatants were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred electrophoretically to polyvinylidenefluoride membranes. Membranes were blocked using 1% bovine serum albumin in tris-buffered saline (20 mmol/l Tris, pH 7.5, 150 mmol/l NaCl) for 1 hour at 25 °C. The blots were incubated with anti-BAFF rabbit immunoglobulin G1 polyclonal antibodies (Sigma) for 2 hours at 25 °C followed by incubation with horseradish peroxidase–conjugated goat anti-rabbit immunoglobulin G monoclonal antibodies (1 hour at 25 °C) and detected by enhanced chemiluminescence (Amersham ECL Plus Western Blotting Detection Reagents, GE Healthcare Europe GmbH, Velizy-Villacoublay, France) according to the manufacturer's instructions. To confirm the presence of equal amounts of proteins, bound antibodies were removed from the membrane by incubation in 0.2 mol/l glycine, pH 2.8 and 0.5 mol/l NaCl for 10 minutes at room temperature and reprobed again with anti-GAPDH mouse monoclonal antibodies (clone 6C5; Millipore).

Saliva collection.Mice were anesthetized as described above and saliva secretion was induced by subcutaneous injection of pilocarpine (0.5 mg/kg body weight; Sigma-Aldrich, St. Louis, MO). Stimulated whole saliva was collected in a blinded manner for 20 minutes from the oral cavity with a hematocrit tube (Drummond Scientific Company, Broomall, PA) and placed into a preweighed 0.5-ml microcentrifuge tube. Volume was determined gravimetrically.

Histological assessment and immunohistochemistry.One cross-sectional part of each SG was embedded in paraffin. Sections were cut at 5 µm, and three nonconsecutive sections were stained with hematoxylin and eosin. FS was determined for each mouse, in which one focus is defined as an aggregate of 50 or more lymphocytes and the FS defined as the average foci per 4 mm2 SG tissue. Slides were scored blindly by two different researchers. Other paraffin sections were stained with rat anti-mouse B220 (kindly provided by K. van Gisbergen, University of Amsterdam), anti-CD138 (BD, Breda, The Netherlands), anti-BAFF (Alexis Biochemicals, San Diego, CA), and anti-APRIL (Abcam, Cambridge, MA) after heat-induced citrate antigen retrieval. Another cross-sectional part of the SG was collected and frozen into optimal cutting temperature (OCT) compound mounting medium (Tissue-Tek, Sakura, Zoeterwoude, The Netherlands). The images of the high-power fields were analyzed using the Qwin analysis system (Leica, Cambridge, UK), as described previously.30 Positive staining for the cellular markers was expressed as the number of positive cells per mm2 and the staining for the cytokine markers as integrated optical density per mm2.

Statistical analysis.Differences were assessed using the nonparametric Mann–Withney test or the parametric Student's t-test depending on the Gaussian distribution. All the analyses were performed with GraphPad Prism statistical software (GraphPad Software version 5.01, La Jolla, CA). A P value ≤0.05 was considered to be statistically significant.

Acknowledgments

Bruce Baum (National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD), Luis Garcia, Aurélie Goyenvalle, Adeline Vulin, Aurélie Avril, (UPMC Um76, Inserm U974, CNRS UMR7215, Institut de Myologie, Paris, France), Jean-Claude Kaplan and Sylvie Mistou (Inserm, U1016; Institut Cochin, CNRS, UMR8104, Université Paris Descartes; Paris, France), Angélique Pichot (ImmunoRhumatologie Moléculaire, INSERM UMR_S 1109, Faculté de Médecine Université de Strasbourg; Centre de Recherche d'Immunologie et d'Hématologie, Fédération de Médecine Translationnelle de Strasbourg). The authors declare no conflicts of interest.

References

  1. Fox RI. Sjögren's syndrome. Lancet. 2005;366:321–331. doi: 10.1016/S0140-6736(05)66990-5. [DOI] [PubMed] [Google Scholar]
  2. Mackay F, Woodcock SA, Lawton P, Ambrose C, Baetscher M, Schneider P, et al. Mice transgenic for BAFF develop lymphocytic disorders along with autoimmune manifestations. J Exp Med. 1999;190:1697–1710. doi: 10.1084/jem.190.11.1697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Groom J, Kalled SL, Cutler AH, Olson C, Woodcock SA, Schneider P, et al. Association of BAFF/BLyS overexpression and altered B cell differentiation with Sjögren's syndrome. J Clin Invest. 2002;109:59–68. doi: 10.1172/JCI14121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Mariette X, Roux S, Zhang J, Bengoufa D, Lavie F, Zhou T, et al. The level of BLyS (BAFF) correlates with the titre of autoantibodies in human Sjögren's syndrome. Ann Rheum Dis. 2003;62:168–171. doi: 10.1136/ard.62.2.168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Lavie F, Miceli-Richard C, Quillard J, Roux S, Leclerc P, Mariette X. Expression of BAFF (BLyS) in T cells infiltrating labial salivary glands from patients with Sjögren's syndrome. J Pathol. 2004;202:496–502. doi: 10.1002/path.1533. [DOI] [PubMed] [Google Scholar]
  6. Gottenberg JE, Cagnard N, Lucchesi C, Letourneur F, Mistou S, Lazure T, et al. Activation of IFN pathways and plasmacytoid dendritic cell recruitment in target organs of primary Sjögren's syndrome. Proc Natl Acad Sci USA. 2006;103:2770–2775. doi: 10.1073/pnas.0510837103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Sazani P, Kole R. Therapeutic potential of antisense oligonucleotides as modulators of alternative splicing. J Clin Invest. 2003;112:481–486. doi: 10.1172/JCI19547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Gavin AL, Aït-Azzouzene D, Ware CF, Nemazee D. DeltaBAFF, an alternate splice isoform that regulates receptor binding and biopresentation of the B cell survival cytokine, BAFF. J Biol Chem. 2003;278:38220–38228. doi: 10.1074/jbc.M306852200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cirak S, Arechavala-Gomeza V, Guglieri M, Feng L, Torelli S, Anthony K, et al. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study. Lancet. 2011;378:595–605. doi: 10.1016/S0140-6736(11)60756-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Goemans NM, Tulinius M, van den Akker JT, Burm BE, Ekhart PF, Heuvelmans N, et al. Systemic administration of PRO051 in Duchenne's muscular dystrophy. N Engl J Med. 2011;364:1513–1522. doi: 10.1056/NEJMoa1011367. [DOI] [PubMed] [Google Scholar]
  11. Roescher N, Lodde BM, Vosters JL, Tak PP, Catalan MA, Illei GG, et al. Temporal changes in salivary glands of non-obese diabetic mice as a model for Sjögren's syndrome. Oral Dis. 2012;18:96–106. doi: 10.1111/j.1601-0825.2011.01852.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Wang J, Voutetakis A, Papa M, Rivera VM, Clackson T, Lodde BM, et al. Rapamycin control of transgene expression from a single AAV vector in mouse salivary glands. Gene Ther. 2006;13:187–190. doi: 10.1038/sj.gt.3302647. [DOI] [PubMed] [Google Scholar]
  13. Daridon C, Devauchelle V, Hutin P, Le Berre R, Martins-Carvalho C, Bendaoud B, et al. Aberrant expression of BAFF by B lymphocytes infiltrating the salivary glands of patients with primary Sjögren's syndrome. Arthritis Rheum. 2007;56:1134–1144. doi: 10.1002/art.22458. [DOI] [PubMed] [Google Scholar]
  14. Gavin AL, Duong B, Skog P, Aït-Azzouzene D, Greaves DR, Scott ML, et al. deltaBAFF, a splice isoform of BAFF, opposes full-length BAFF activity in vivo in transgenic mouse models. J Immunol. 2005;175:319–328. doi: 10.4049/jimmunol.175.1.319. [DOI] [PubMed] [Google Scholar]
  15. Ota M, Duong BH, Torkamani A, Doyle CM, Gavin AL, Ota T, et al. Regulation of the B cell receptor repertoire and self-reactivity by BAFF. J Immunol. 2010;185:4128–4136. doi: 10.4049/jimmunol.1002176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Badr G, Borhis G, Lefevre EA, Chaoul N, Deshayes F, Dessirier V, et al. BAFF enhances chemotaxis of primary human B cells: a particular synergy between BAFF and CXCL13 on memory B cells. Blood. 2008;111:2744–2754. doi: 10.1182/blood-2007-03-081232. [DOI] [PubMed] [Google Scholar]
  17. Meijer JM, Meiners PM, Vissink A, Spijkervet FK, Abdulahad W, Kamminga N, et al. Effectiveness of rituximab treatment in primary Sjögren's syndrome: a randomized, double-blind, placebo-controlled trial. Arthritis Rheum. 2010;62:960–968. doi: 10.1002/art.27314. [DOI] [PubMed] [Google Scholar]
  18. Steinfeld SD, Tant L, Burmester GR, Teoh NK, Wegener WA, Goldenberg DM, et al. Epratuzumab (humanised anti-CD22 antibody) in primary Sjögren's syndrome: an open-label phase I/II study. Arthritis Res Ther. 2006;8:R129. doi: 10.1186/ar2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Nguyen CQ, Sharma A, She JX, McIndoe RA, Peck AB. Differential gene expressions in the lacrimal gland during development and onset of keratoconjunctivitis sicca in Sjögren's syndrome (SJS)-like disease of the C57BL/6.NOD-Aec1Aec2 mouse. Exp Eye Res. 2009;88:398–409. doi: 10.1016/j.exer.2008.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Ittah M, Miceli-Richard C, Eric Gottenberg J, Lavie F, Lazure T, Ba N, et al. B cell-activating factor of the tumor necrosis factor family (BAFF) is expressed under stimulation by interferon in salivary gland epithelial cells in primary Sjögren's syndrome. Arthritis Res Ther. 2006;8:R51. doi: 10.1186/ar1912. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Ittah M, Miceli-Richard C, Gottenberg JE, Sellam J, Eid P, Lebon P, et al. Viruses induce high expression of BAFF by salivary gland epithelial cells through TLR- and type-I IFN-dependent and -independent pathways. Eur J Immunol. 2008;38:1058–1064. doi: 10.1002/eji.200738013. [DOI] [PubMed] [Google Scholar]
  22. Mariño E, Villanueva J, Walters S, Liuwantara D, Mackay F, Grey ST. CD4(+)CD25(+) T-cells control autoimmunity in the absence of B-cells. Diabetes. 2009;58:1568–1577. doi: 10.2337/db08-1504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Vosters JL, Roescher N, Illei GG, Chiorini JA, Tak PP. TACI-Fc gene therapy improves autoimmune sialadenitis but not salivary gland function in non-obese diabetic mice. Oral Dis. 2012;18:365–374. doi: 10.1111/j.1601-0825.2011.01885.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Vosters JL, Roescher N, Polling EJ, Illei GG, Tak PP. The expression of APRIL in Sjogren's syndrome: aberrant expression of APRIL in the salivary gland. Rheumatology (Oxford) 2012;51:1557–1562. doi: 10.1093/rheumatology/kes080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Mercatante DR, Mohler JL, Kole R. Cellular response to an antisense-mediated shift of Bcl-x pre-mRNA splicing and antineoplastic agents. J Biol Chem. 2002;277:49374–49382. doi: 10.1074/jbc.M209236200. [DOI] [PubMed] [Google Scholar]
  26. Malerba A, Boldrin L, Dickson G. Long-term systemic administration of unconjugated morpholino oligomers for therapeutic expression of dystrophin by exon skipping in skeletal muscle: implications for cardiac muscle integrity. Nucleic Acid Ther. 2011;21:293–298. doi: 10.1089/nat.2011.0306. [DOI] [PubMed] [Google Scholar]
  27. Baum BJ, Alevizos I, Zheng C, Cotrim AP, Liu S, McCullagh L, et al. Early responses to adenoviral-mediated transfer of the aquaporin-1 cDNA for radiation-induced salivary hypofunction. Proc Natl Acad Sci USA. 2012;109:19403–19407. doi: 10.1073/pnas.1210662109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Gorman L, Suter D, Emerick V, Schümperli D, Kole R. Stable alteration of pre-mRNA splicing patterns by modified U7 small nuclear RNAs. Proc Natl Acad Sci USA. 1998;95:4929–4934. doi: 10.1073/pnas.95.9.4929. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Vosters JL, Yin H, Roescher N, Kok MR, Tak PP, Chiorini JA. Local expression of tumor necrosis factor-receptor 1:immunoglobulin G can induce salivary gland dysfunction in a murine model of Sjögren's syndrome. Arthritis Res Ther. 2009;11:R189. doi: 10.1186/ar2888. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Haringman JJ, Vinkenoog M, Gerlag DM, Smeets TJ, Zwinderman AH, Tak PP. Reliability of computerized image analysis for the evaluation of serial synovial biopsies in randomized controlled trials in rheumatoid arthritis. Arthritis Res Ther. 2005;7:R862–R867. doi: 10.1186/ar1757. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Molecular Therapy are provided here courtesy of The American Society of Gene & Cell Therapy

RESOURCES